ID: 959914630

View in Genome Browser
Species Human (GRCh38)
Location 3:111802859-111802881
Sequence AACCTTTAACTTTTCCTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959914630_959914635 23 Left 959914630 3:111802859-111802881 CCTGTCAGGAAAAGTTAAAGGTT 0: 1
1: 0
2: 1
3: 11
4: 146
Right 959914635 3:111802905-111802927 ATAATTAATCATCTTTAAAATGG 0: 1
1: 0
2: 5
3: 133
4: 1162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959914630 Original CRISPR AACCTTTAACTTTTCCTGAC AGG (reversed) Intronic
905683540 1:39892039-39892061 AACCCTCTACTTTTCCTTACTGG - Intergenic
906635799 1:47409672-47409694 GACCTTTTACCTTTCCAGACAGG + Intergenic
907423263 1:54361854-54361876 AATTTTTAACTGTCCCTGACTGG + Intronic
907508164 1:54937170-54937192 GACCTTTTATTTTTCCTTACTGG - Intergenic
910828818 1:91439389-91439411 AACCTTGAAGTTTTTCTGTCTGG + Intergenic
917001499 1:170366333-170366355 TATCTTTACCTTTTTCTGACTGG + Intergenic
917036334 1:170751210-170751232 AATCTTTATCATTTACTGACAGG - Intergenic
917203668 1:172545301-172545323 AGCCCTTATCTTTTCCTAACTGG - Intronic
917678919 1:177346714-177346736 GACATTTAACTTTTCCAGAAAGG + Intergenic
919177881 1:194042460-194042482 AACCTTTAACTCTTACTCTCTGG - Intergenic
919238079 1:194872153-194872175 AACTTATAAATTTTCATGACAGG + Intergenic
919653093 1:200169723-200169745 AGCCTTTAAATTTTGATGACTGG - Intronic
920271217 1:204765599-204765621 AACTCTTATCTTTTGCTGACAGG - Intergenic
920593087 1:207241409-207241431 AACCCTAATCTTTTCCTTACAGG - Intergenic
921836139 1:219780922-219780944 AAAGTTTAGCTTATCCTGACTGG + Intronic
923642542 1:235779332-235779354 ATCCTTTTATTTTTCCTGAACGG - Intronic
1064788546 10:18928197-18928219 AACCTATGAATTTTTCTGACTGG - Intergenic
1064811609 10:19205937-19205959 AAACTTTTTCTTTTCTTGACAGG - Intronic
1064999760 10:21327821-21327843 AACCTTTAAGTTTTCTGGACAGG + Intergenic
1068313874 10:55316260-55316282 AAGCTGTAAGTTTCCCTGACAGG - Intronic
1071803512 10:89091495-89091517 AATCTTTAATTTTCCCTGTCTGG + Intergenic
1073883455 10:108009377-108009399 AATCTTTAACTTCCCCTGAAAGG - Intergenic
1081561404 11:44220532-44220554 AAGCTCTAACTGTACCTGACAGG - Intronic
1088872659 11:113904650-113904672 AACATTTCCATTTTCCTGACAGG - Intergenic
1088881841 11:113979044-113979066 AACAACTAACTTTTCCTGTCTGG + Intronic
1089168501 11:116496286-116496308 GACATTTGTCTTTTCCTGACTGG + Intergenic
1089667770 11:120031262-120031284 AACCCTTAGGTTTTCCTGTCTGG - Intergenic
1092317533 12:7433848-7433870 AAGCTTTAATTTTTCATGATAGG + Intronic
1092667549 12:10820350-10820372 TATCTTTATGTTTTCCTGACTGG - Intergenic
1092967927 12:13662790-13662812 AGGCTTTAACTTTTTCTTACTGG + Intronic
1094087984 12:26614694-26614716 AACATGTAGCTTTTCCAGACTGG - Intronic
1096443480 12:51666618-51666640 ATCCTTTATCTTTTCCTCATAGG + Intronic
1100373334 12:93990003-93990025 AACATTTATCTTTTTGTGACTGG - Intergenic
1104140179 12:125980383-125980405 AACCTTTAACTTTTGCCCCCAGG + Intergenic
1105743908 13:23358706-23358728 AACCTTTAATTTTTCCTTTTTGG - Intronic
1106596157 13:31140309-31140331 AACCTTTCCTGTTTCCTGACAGG - Exonic
1107350857 13:39513108-39513130 AACCTTAAAATTTTACTAACTGG + Intronic
1107594603 13:41949882-41949904 AACTTTTAACTTTTCATTATAGG - Intronic
1107746320 13:43513803-43513825 AAGGGTTAACTTTTCCTGAAAGG - Intronic
1111440334 13:88274154-88274176 TACCTTTAATTTTACCTGCCAGG - Intergenic
1111712670 13:91836740-91836762 AATCCTTAATTTTTGCTGACTGG + Intronic
1111997518 13:95179327-95179349 TCCCTTTGGCTTTTCCTGACTGG - Intronic
1113446706 13:110374343-110374365 AACACTTAACTTTCCCTGAGGGG + Intronic
1117018666 14:51546937-51546959 AAACTTGAACTTTGCCTGGCAGG - Intronic
1118266566 14:64300457-64300479 CACCTTAAAATTTTTCTGACAGG + Intronic
1118496323 14:66311371-66311393 AACCTTTTAAATTTCTTGACTGG + Intergenic
1119860405 14:77931838-77931860 AAACTTTAACTTTGCCTGCAGGG - Intronic
1120495093 14:85225136-85225158 AATTTTTAACTTTTCCAGAAAGG - Intergenic
1120649047 14:87109158-87109180 AACATTTTTATTTTCCTGACTGG + Intergenic
1121160886 14:91738865-91738887 AACCTTTATCTTTTCTGAACAGG + Intronic
1122057381 14:99111638-99111660 AACCTTTATCATCTCCTCACAGG - Intergenic
1122698332 14:103569519-103569541 CTCCTTTAACATTTCCTGATGGG + Intronic
1123201415 14:106668896-106668918 AACCTTAAACTTTTGGTGATTGG - Intergenic
1125162123 15:36656886-36656908 CACCATGAATTTTTCCTGACAGG - Intronic
1125305472 15:38307535-38307557 AACCTTTATCATTTCCTCCCTGG + Intronic
1125441326 15:39707209-39707231 AACCTTTCAGCCTTCCTGACTGG + Intronic
1127254070 15:57273569-57273591 AACCATTAAATTTCCCTGCCTGG + Intronic
1128184061 15:65629482-65629504 AACATTTACCATTTCCTTACTGG - Intronic
1130407457 15:83614511-83614533 AACCTTTAACGCTTCCTTAGGGG + Intronic
1130446132 15:84003628-84003650 AACCCTTCACTTTTACTGCCTGG - Intronic
1131531339 15:93195241-93195263 AACCTTTATCACTTCCTCACAGG - Intergenic
1137451324 16:48577468-48577490 AACCTCTAACATTTCTTAACAGG + Intronic
1143314253 17:6019942-6019964 ACCCTTTACCTTTGCATGACGGG + Intronic
1143530507 17:7500474-7500496 AACCTTTAATTTTTTGAGACAGG - Intronic
1149315009 17:55430778-55430800 AGCCTTGAGATTTTCCTGACAGG - Intergenic
1150579841 17:66462346-66462368 AACCATCAACTTTTCATGAGCGG - Intronic
1151091390 17:71444078-71444100 ACCCTTTAACTTTTCCTGATAGG - Intergenic
1154196351 18:12270317-12270339 AACCTCACAATTTTCCTGACTGG + Intronic
1154963879 18:21337393-21337415 GACCTTTACCTTTTCCTCTCAGG - Intronic
1157920669 18:51710032-51710054 AACCTTTGTCTTGTCCTCACTGG + Intergenic
1159354408 18:67319063-67319085 AACCTTTAATTGTTTCTGACTGG - Intergenic
1162689293 19:12415448-12415470 AAACTGTAGCTTTTCCTGACAGG + Intronic
925866736 2:8234699-8234721 AAGCTTTACCTTTTCATGACAGG - Intergenic
927118684 2:19931280-19931302 TTCCTTTAACTTTTCCTCGCTGG + Exonic
928634317 2:33227651-33227673 CACCTCTTTCTTTTCCTGACAGG + Intronic
928947887 2:36788455-36788477 ATCTATTAATTTTTCCTGACAGG - Intronic
929194886 2:39174692-39174714 ACTCTTTAATTTTTCCTGATAGG + Intergenic
933144279 2:78832279-78832301 AACCTCTCACTTTTCTTTACAGG + Intergenic
936733586 2:115412774-115412796 AACCTTTAACTCTTACTGAGAGG + Intronic
940683678 2:156819157-156819179 CTCCTTTAACTTTTCCTCAGAGG - Intergenic
941018400 2:160382949-160382971 TACATTTTACGTTTCCTGACAGG - Intronic
941542414 2:166803413-166803435 AACATTTATCTGTTCATGACAGG + Intergenic
941544771 2:166834900-166834922 AACCTTTTATTCTTCCTGCCTGG + Intergenic
944530432 2:200662629-200662651 AACATCTAACTACTCCTGACTGG - Intronic
946446120 2:219741152-219741174 AATCTTTCACTTTCTCTGACGGG + Intergenic
946811982 2:223535618-223535640 AACCCTTACCTCTTCATGACAGG + Intergenic
1169492044 20:6079421-6079443 AAACTTTCACTTTACCTGCCGGG + Exonic
1171988350 20:31676438-31676460 AACATTTAACTGTTCCTGGGTGG + Intronic
1173800715 20:45892785-45892807 AACAACAAACTTTTCCTGACCGG + Exonic
1177616813 21:23533390-23533412 AACCTTTATCACTTCCTCACAGG - Intergenic
1181095054 22:20499159-20499181 AAACTTTCTCTTTTTCTGACCGG - Intronic
1184066468 22:42124512-42124534 AACCTTTTTATTTTCCTGGCAGG - Intergenic
1184068936 22:42136664-42136686 AACCTTTTTATTTTCCTGGCAGG - Intergenic
1184220300 22:43095382-43095404 GTCCTTTAACCTTCCCTGACCGG - Intergenic
1184958756 22:47913245-47913267 TACCCTTAAATTTTCCTGACAGG - Intergenic
952699408 3:36310188-36310210 AACCTTGAACTTTTTCAGGCAGG - Intergenic
955748606 3:62165195-62165217 TTCCTTTAACCTTTCCTCACAGG + Intronic
957280699 3:78147220-78147242 AAAATTTAACATTTGCTGACAGG - Intergenic
958068363 3:88575493-88575515 AACCATTAACTTATCCTGAGAGG + Intergenic
959914630 3:111802859-111802881 AACCTTTAACTTTTCCTGACAGG - Intronic
960176162 3:114519875-114519897 ATACTTGAAATTTTCCTGACAGG - Intronic
960683250 3:120271188-120271210 AGCCTTAAAATTTTTCTGACAGG + Intronic
960917692 3:122713676-122713698 AACTTTTAAATTATGCTGACAGG + Intronic
963022723 3:140887456-140887478 AACCTTTAAAATTTCCAGAGTGG + Intergenic
967364734 3:188673173-188673195 CACATTTAACTTCTCGTGACTGG - Intronic
971530282 4:27679092-27679114 GACCTTTAACTTTTATTAACTGG + Intergenic
972974018 4:44611360-44611382 CATCTTTAACTTTCCCTTACTGG - Intergenic
972999776 4:44932052-44932074 AACCTTTATTTTTTTGTGACAGG + Intergenic
974252592 4:59405978-59406000 AACCTTTAACTTCTCATGTTTGG - Intergenic
974698108 4:65400364-65400386 AACCTTTAAATGTTTCTTACAGG - Intronic
976553209 4:86420781-86420803 AGCCCTTAACTTTTTTTGACAGG - Intronic
977851081 4:101830574-101830596 AACCTTGAACTGCTACTGACTGG - Intronic
978337648 4:107687036-107687058 GACCTTTAATTTCTCCTGCCCGG + Exonic
978687501 4:111463745-111463767 AACATGTCAATTTTCCTGACTGG + Intergenic
980775872 4:137435598-137435620 AACCATTGACTGTGCCTGACAGG - Intergenic
981678935 4:147372105-147372127 AACCTTTATCGTCTCCTTACTGG - Intergenic
983281872 4:165691043-165691065 AACCCTTTACTTCTCCAGACAGG + Intergenic
984015327 4:174418919-174418941 AATCTTTAGCTTTTCCAGATCGG - Intergenic
984286749 4:177740048-177740070 AATATTAAACTTTACCTGACCGG - Intronic
989738745 5:44742274-44742296 AACCTATAACTTTTCCTCTTTGG - Intergenic
990785781 5:59417949-59417971 AACGCTTTACTTTTCCTGATAGG + Intronic
990890186 5:60640299-60640321 AACCGTATACTTATCCTGACAGG - Intronic
994610435 5:102031189-102031211 AGCCAGTAACTTTTCCTGACTGG - Intergenic
994812923 5:104545944-104545966 GACCTTTAACTTTTCCCAAAAGG - Intergenic
994856111 5:105121635-105121657 AACCTTAAATTTTTCCTGTTTGG + Intergenic
996723361 5:126651461-126651483 AACTTCTACCATTTCCTGACAGG + Intergenic
997748777 5:136324635-136324657 TACCTTTAACTTTTGATGATAGG + Intronic
1000571669 5:162922602-162922624 AACCTTTAACATTTCTTGTAGGG + Intergenic
1003214082 6:4092937-4092959 AAATTTTAACTTTTCCTAATAGG - Intronic
1005033733 6:21536157-21536179 AACATTTAACATTTCTTGCCTGG - Intergenic
1006753059 6:36391440-36391462 AACCTTGAACATTTCCTTCCAGG - Exonic
1021453118 7:20800024-20800046 AACCTTTTACTTCTCCCAACTGG + Intergenic
1023625350 7:42109858-42109880 AGATTTTAACTTTGCCTGACAGG + Intronic
1025970316 7:66317856-66317878 AACCTTTAAATATTACTGTCAGG + Intronic
1027409324 7:77898008-77898030 AACCTTTAAATTATCTTGATAGG + Intronic
1028103000 7:86844711-86844733 AACCTTTCACAGTTCTTGACAGG - Intronic
1033783284 7:144698310-144698332 ATACTTTTACTTTTGCTGACTGG - Intronic
1035216543 7:157371913-157371935 AACCTTTAAGGTTTCCAGAGAGG + Intronic
1039449053 8:37656969-37656991 CACCTTTAAATTCTCCAGACAGG - Intergenic
1040831046 8:51677374-51677396 AACATTTATCTTCTCCTGAACGG - Intronic
1042304471 8:67316823-67316845 AACCCTTGACACTTCCTGACAGG + Intronic
1042431122 8:68707386-68707408 AAATTATAACTGTTCCTGACAGG - Intronic
1046193596 8:110831688-110831710 TACCTGTAACTTTTACTGCCAGG + Intergenic
1046367284 8:113251750-113251772 CACCTTTTAATTTTCCTGGCAGG - Intronic
1049481021 8:142822786-142822808 ATCCTTTACCTTTACCTGAGAGG + Intergenic
1050757273 9:9021059-9021081 AACCTTTAAATTATCCTCAAAGG + Intronic
1051771669 9:20585968-20585990 AACCATTATCTTTTCCTCACGGG + Intronic
1052045602 9:23790587-23790609 AACCTTTAACTTTTTCTTGAGGG - Intronic
1057685464 9:97230238-97230260 AACCTTAAACATTCCCTGATAGG - Intergenic
1059811564 9:117860951-117860973 ACTCTTTAACTTTTCCAGGCGGG - Intergenic
1186393846 X:9188123-9188145 AAGCATTAACTTTTTCTGAAAGG + Intergenic
1186471617 X:9826380-9826402 AACCTTTTTCTTTTTTTGACAGG + Intronic
1186949521 X:14607921-14607943 AACCATCAACTTTTCTGGACAGG - Intronic
1187641448 X:21295307-21295329 AACATTTAACATTTCATGACAGG + Intergenic
1194995808 X:100590354-100590376 AAGCTTTAGCCTGTCCTGACAGG - Intronic
1195670664 X:107467080-107467102 AAGGTTGAATTTTTCCTGACTGG + Intergenic
1196800164 X:119535650-119535672 AACATTTAACTTTTTGTGACTGG - Intergenic
1198447433 X:136731403-136731425 AACCTCTAAGTTTCCCTGTCTGG - Intronic
1201230018 Y:11855300-11855322 CTCCTTTAACCTTTACTGACTGG + Intergenic