ID: 959916264

View in Genome Browser
Species Human (GRCh38)
Location 3:111819936-111819958
Sequence CATGGTATGAAATGTCTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959916259_959916264 19 Left 959916259 3:111819894-111819916 CCAAACAAGGTTGACAAGTCCTC 0: 1
1: 0
2: 1
3: 6
4: 77
Right 959916264 3:111819936-111819958 CATGGTATGAAATGTCTTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 132
959916260_959916264 0 Left 959916260 3:111819913-111819935 CCTCATTTAGTAACCGCATCTGG 0: 1
1: 0
2: 0
3: 3
4: 44
Right 959916264 3:111819936-111819958 CATGGTATGAAATGTCTTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959916264 Original CRISPR CATGGTATGAAATGTCTTGC AGG Intronic
902194305 1:14786777-14786799 CCTTCTATTAAATGTCTTGCAGG - Intronic
906443853 1:45876046-45876068 CATGGCAAGAAAAGTCTTCCAGG + Intronic
907991042 1:59583141-59583163 CATGGTATAAAAGGACCTGCAGG - Intronic
908693383 1:66808124-66808146 CAAATCATGAAATGTCTTGCAGG - Intergenic
908915610 1:69122341-69122363 CATGGTATGAACTGTCTGGTGGG + Intergenic
911889476 1:103348926-103348948 CAAAGTATGAAGTGTCTTGCAGG + Intergenic
912587442 1:110779761-110779783 CAAGGTAGGAAATCTCTGGCAGG - Intergenic
916825787 1:168440791-168440813 CATGCTATGTAATGTGGTGCTGG - Intergenic
919429139 1:197471304-197471326 CAGGGTTTGAAGTCTCTTGCTGG - Intronic
1064862063 10:19837185-19837207 CCTGGTGAGGAATGTCTTGCTGG - Intronic
1066707361 10:38195306-38195328 CATGGGATGAAAGGTTTTGTGGG + Intergenic
1066982337 10:42429432-42429454 CATGGGATGAAAGGTTTTGTGGG - Intergenic
1067405212 10:46016432-46016454 CATGGGGTGAAATTTTTTGCTGG + Intronic
1067485536 10:46646382-46646404 CATTGTAAGAAATGGGTTGCAGG - Intergenic
1067609222 10:47695270-47695292 CATTGTAAGAAATGGGTTGCAGG + Intergenic
1071624809 10:87156916-87156938 CATTGTAAGAAATGGGTTGCAGG + Intronic
1075734478 10:124655437-124655459 CGTGGGATGAGATGTCTTGGTGG - Intronic
1076375422 10:129980386-129980408 CCTGCTATGCACTGTCTTGCTGG + Intergenic
1077846510 11:6030882-6030904 CATGGCATGAAATGTCTAATTGG - Intergenic
1086642088 11:89171473-89171495 CATTGAATGAAGTGTCATGCAGG - Intergenic
1088189250 11:107209104-107209126 CCTAGTTTGAAATGTTTTGCAGG + Intergenic
1089331082 11:117689500-117689522 CAGGGTATGAAACGTGTTTCTGG + Intronic
1090952247 11:131483906-131483928 AATGGCATGAATTCTCTTGCAGG - Intronic
1093572538 12:20683539-20683561 CATGCTAATAAATGTCTTTCCGG + Exonic
1093614502 12:21206668-21206690 CATGGAAAGAAAGGTTTTGCAGG - Intronic
1096038952 12:48497505-48497527 ATTGGTATAAAATATCTTGCTGG - Intergenic
1098195874 12:68001747-68001769 CATGGTTTGAAATCTCTAGGTGG + Intergenic
1099190702 12:79559214-79559236 CATGGTAGGAAATGTCGTCTTGG - Intergenic
1099362825 12:81727160-81727182 CATGGTCTGAAATGTATGGAAGG - Intronic
1100589695 12:96014999-96015021 CATGTTATTTCATGTCTTGCAGG - Exonic
1106761181 13:32869398-32869420 CATAGTATGAAAAGTATTCCCGG - Intergenic
1107962141 13:45568002-45568024 CAGGGTAAGAAAAGGCTTGCAGG - Intronic
1108726494 13:53188559-53188581 CAAGGTATGAAATGCATTACTGG - Intergenic
1113209743 13:107962292-107962314 CATGATAAGAAATGTATTGAGGG + Intergenic
1114862287 14:26539048-26539070 CATGGTATAAAATATCTTGGGGG - Intronic
1119987859 14:79159993-79160015 ATTGGAATGAAATGGCTTGCAGG + Intronic
1202848265 14_GL000009v2_random:201466-201488 CATGCATTGAAATGTCATGCTGG - Intergenic
1202875204 14_GL000225v1_random:200626-200648 AATGGAATGAAATTTCTTTCTGG + Intergenic
1130685131 15:86030623-86030645 CATATTAAGAAATGTATTGCTGG - Intergenic
1130874267 15:87998870-87998892 CCTGGAAAGAAATGCCTTGCTGG + Intronic
1131409727 15:92197132-92197154 AATGGTATGGAATTTCTTCCGGG + Intergenic
1131486244 15:92823271-92823293 GATAGTAGGAACTGTCTTGCTGG - Intergenic
1136586153 16:31186412-31186434 CCTGGTGTGAAATGTCTTCTGGG + Intronic
1138143412 16:54587471-54587493 CATAGGATAAAATGTATTGCAGG - Intergenic
1138404851 16:56783043-56783065 CAAGGTATTAAAAGTATTGCAGG - Intronic
1139091344 16:63651621-63651643 CATTGTATAAAATGTGTTCCAGG - Intergenic
1149132796 17:53326781-53326803 CATGGTATGAAAAGTCTCAATGG + Intergenic
1149374229 17:56028088-56028110 CTTTGAATGAAATGACTTGCAGG + Intergenic
1149857517 17:60095906-60095928 TATGGTTTGAAATATCATGCTGG - Intergenic
1153425141 18:4954530-4954552 CATAGTCCCAAATGTCTTGCAGG - Intergenic
1157344412 18:46811574-46811596 CATTGAATGAAATGTCTTTGGGG - Exonic
1158231999 18:55266957-55266979 CATGTTATAATATGTCTTTCTGG - Intronic
1159348680 18:67241555-67241577 AATGTGATGAAATATCTTGCTGG + Intergenic
1164407540 19:27965835-27965857 CATGGGATGAAAGGTTTTGTGGG + Intergenic
1202675312 1_KI270710v1_random:40066-40088 CATGCATTGAAATGTCATGCTGG - Intergenic
925113423 2:1355079-1355101 CACGGTGTGAAATGTGTTGTAGG - Intronic
927078675 2:19605889-19605911 CCTGCTATTAAATGTCTAGCAGG + Intergenic
927835197 2:26391476-26391498 CAAAGTATGAAAGGTCTTTCAGG + Exonic
931299381 2:60961952-60961974 CATCGTTTGAAATGTATTGAAGG + Intronic
937038014 2:118797784-118797806 CATGGCAGGAAATGTCTTCATGG + Intergenic
938956010 2:136298971-136298993 CATGGTAAGAAATGTCTGATTGG - Intergenic
939508909 2:143082703-143082725 CATTGTCTGGAATGTCTTACAGG + Intergenic
941406865 2:165100660-165100682 CATGGTATAAAATATCTAACTGG - Intronic
1169568527 20:6881928-6881950 CAAGAGAAGAAATGTCTTGCTGG + Intergenic
1176636633 21:9250101-9250123 CATGTATTGAAATGTCATGCTGG + Intergenic
1178150888 21:29792367-29792389 CATTATTTGAAATGTCTTGTGGG + Intronic
1185082367 22:48717111-48717133 CGTGGTCTGAAATTTCATGCTGG - Intronic
949933268 3:9097330-9097352 AATGATATGAAATGTCTACCTGG - Intronic
950489348 3:13294117-13294139 CATGGGCTGAAATGCCGTGCGGG - Intergenic
955277219 3:57557564-57557586 CGTAGAATGAAATGTCATGCTGG - Exonic
955599211 3:60627053-60627075 CATGGTACAAAATATGTTGCTGG + Intronic
956419713 3:69074445-69074467 CACTGTATTTAATGTCTTGCTGG - Intronic
956997067 3:74838984-74839006 GATGGTATGATATATTTTGCTGG + Intergenic
957787138 3:84897606-84897628 TATGGTATCATATGTATTGCAGG + Intergenic
958731347 3:97963657-97963679 GATGGTATGAGAGGTCTTTCAGG + Intronic
959563735 3:107813163-107813185 CATGAAATGAAATCTCTTTCTGG + Intergenic
959916264 3:111819936-111819958 CATGGTATGAAATGTCTTGCAGG + Intronic
961255489 3:125547432-125547454 CTTGGTATGAAAAGTGATGCTGG + Exonic
964998817 3:162925609-162925631 CATGGAATGAAATCTCTTCTGGG - Intergenic
1202750262 3_GL000221v1_random:154918-154940 CATGTATTGAAATGTCATGCTGG - Intergenic
969889034 4:10242670-10242692 CATGGAATGGAGTGTCTTGGTGG - Intergenic
970296535 4:14636844-14636866 CATTGTCTGAAATGTCATGATGG + Intergenic
979642644 4:123027185-123027207 TATGGTCTGAAATGTCCTTCTGG - Intronic
982618555 4:157674905-157674927 CTGGGCATGAGATGTCTTGCTGG - Intergenic
1202751520 4_GL000008v2_random:8540-8562 CATGTATTGAAATGTCATGCTGG + Intergenic
985816755 5:2133112-2133134 ATTGGTATAAAATGTCTTGCGGG - Intergenic
986980639 5:13444662-13444684 CTTGCTATGAAATAGCTTGCTGG - Intergenic
987927188 5:24357491-24357513 CATTCTATGAAATGTATTGCTGG - Intergenic
988671112 5:33382885-33382907 CAAGGGATGAAATGACTTCCAGG + Intergenic
990605500 5:57405806-57405828 CTTGGAAAGAAATGTCTAGCAGG + Intergenic
990635157 5:57717648-57717670 CATGCTCTGAAATGACTTTCAGG + Intergenic
991478091 5:67044920-67044942 CATGGTATGAAACATCCTACTGG - Intronic
992449505 5:76863245-76863267 CATTGTCTGAATTGTTTTGCTGG + Intronic
994010253 5:94893984-94894006 CATGGTGGGAAATGTCCAGCGGG + Intronic
994166471 5:96614533-96614555 CATGATTTGAAATGTTTGGCAGG + Intronic
994498997 5:100550592-100550614 CATGGAATCAAATGTCTGGTAGG + Intronic
996811201 5:127517820-127517842 CATGGCATGGCATGGCTTGCAGG + Intronic
998951163 5:147394219-147394241 CAAGATATGAAGTGCCTTGCTGG + Intronic
999944490 5:156580563-156580585 CATGGTCTGATATTTCTTGGAGG + Intronic
1000827577 5:166065085-166065107 CATGATATGAAGTGTGTTTCTGG - Intergenic
1006147931 6:31970364-31970386 CATGGTAGGAAAGGTCTTGAGGG + Exonic
1007969543 6:46036743-46036765 TATAGTATCAAATGTTTTGCTGG + Intronic
1010785084 6:79991692-79991714 CATGGGAAGAAATGTCTTTGGGG - Intergenic
1018794781 6:167177372-167177394 CATGGCAGCAAATGTCTGGCTGG + Intronic
1021287660 7:18801320-18801342 CATTGTATGAAATGTTTTATAGG + Intronic
1023355019 7:39357775-39357797 CATGTTATGAAAAGGTTTGCAGG + Intronic
1024154134 7:46603133-46603155 CGCAGTATGAAATGTCTTGCTGG + Intergenic
1028308750 7:89301889-89301911 AATGTTATAAAATGTGTTGCAGG - Intronic
1029867985 7:103656553-103656575 CATGGTCTGAAAGGTTTTACAGG + Intronic
1031283457 7:119835400-119835422 CATGGTTTGAAATGTATTAAAGG + Intergenic
1035082637 7:156230653-156230675 CACGCAATGAAATGTCATGCAGG + Intergenic
1037252809 8:16917013-16917035 CTTTGCATGAAATATCTTGCAGG - Intergenic
1037914791 8:22766469-22766491 CATGGTATGAAATTTCTGAAGGG + Intronic
1037923594 8:22827356-22827378 CATGGTACAAAATTTCTTTCTGG - Intronic
1041679358 8:60572236-60572258 CATGAGATGAAATGTGGTGCTGG + Intronic
1041908492 8:63060724-63060746 CCTGAGATGAAATGTCTTGCTGG + Exonic
1042034847 8:64521476-64521498 CATTGTAGGAATTGTGTTGCTGG - Intergenic
1045183123 8:99808001-99808023 CATAATATTAAATGTCTTGGTGG - Intronic
1045377268 8:101586439-101586461 CAAGGTGTGAGATGTCTTCCAGG - Intronic
1046573165 8:115992147-115992169 CAGGGTATGAAATGCCTCCCCGG - Intergenic
1048163494 8:132041606-132041628 AATGGTATGAAGTGTGTGGCTGG - Exonic
1048194874 8:132324133-132324155 CATGGTATTGAATGGCTTGAAGG - Intronic
1048977791 8:139682633-139682655 CATGGTAAGCAATGTATTGCAGG + Intronic
1050729070 9:8687046-8687068 AATGGTATGAAAGGTCTCCCAGG - Intronic
1053649442 9:40149649-40149671 CCTGGTATGAATTAGCTTGCTGG + Intergenic
1053756306 9:41314235-41314257 CCTGGTATGAATTAGCTTGCTGG - Intergenic
1054535139 9:66226524-66226546 CCTGGTATGAATTAGCTTGCTGG - Intergenic
1055975773 9:81954003-81954025 CATGGTGTGAATTGGTTTGCAGG - Intergenic
1057504731 9:95624230-95624252 ATAGGTATGAAATTTCTTGCTGG + Intergenic
1058236705 9:102499118-102499140 CATGGTGTTAAATATCATGCTGG + Intergenic
1203718902 Un_KI270742v1:185011-185033 CATGTATTGAAATGTCATGCTGG - Intergenic
1203653134 Un_KI270751v1:148688-148710 CATGTATTGAAATGTCATGCTGG - Intergenic
1185935724 X:4255516-4255538 AATGGATTGAAATGTCTCGCAGG - Intergenic
1187722301 X:22163897-22163919 CCCTGTATTAAATGTCTTGCTGG - Intronic
1189103769 X:38216665-38216687 CATAGTATGAAATTTGTAGCAGG - Intronic
1192323665 X:70113948-70113970 CATGGTATAAAATCTCTTAAAGG - Intergenic
1193945978 X:87735423-87735445 CATGGAAACAAATGACTTGCTGG + Intergenic
1195952632 X:110291962-110291984 CATAGAATGGAATGTCTTGTAGG + Intronic
1201173057 Y:11289852-11289874 CATGTATTGAAATGTCATGCTGG - Intergenic
1201720148 Y:17088004-17088026 CATAGATTGAAATGTCTTGCAGG - Intergenic
1202244457 Y:22804626-22804648 CTTCATATGAAATGTTTTGCCGG - Intergenic
1202397445 Y:24438372-24438394 CTTCATATGAAATGTTTTGCCGG - Intergenic
1202473336 Y:25231715-25231737 CTTCATATGAAATGTTTTGCCGG + Intergenic