ID: 959916381

View in Genome Browser
Species Human (GRCh38)
Location 3:111821087-111821109
Sequence AATCACTGGGGACCCTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959916381_959916386 10 Left 959916381 3:111821087-111821109 CCATGTCAGGGTCCCCAGTGATT 0: 1
1: 0
2: 2
3: 14
4: 203
Right 959916386 3:111821120-111821142 AGTGTAAGTCTTAGCTGAATCGG 0: 1
1: 0
2: 1
3: 3
4: 100
959916381_959916387 11 Left 959916381 3:111821087-111821109 CCATGTCAGGGTCCCCAGTGATT 0: 1
1: 0
2: 2
3: 14
4: 203
Right 959916387 3:111821121-111821143 GTGTAAGTCTTAGCTGAATCGGG 0: 1
1: 0
2: 1
3: 13
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959916381 Original CRISPR AATCACTGGGGACCCTGACA TGG (reversed) Intronic
900102022 1:966049-966071 AAGCCTTGGGGACCCTGACTCGG + Intergenic
900560590 1:3304001-3304023 AATCCTTGGGGACAGTGACATGG + Intronic
902828231 1:18992107-18992129 GGTCACTGGTGACCTTGACAAGG - Intergenic
903019290 1:20382696-20382718 AGACACTTGGAACCCTGACAAGG + Intergenic
904249266 1:29211187-29211209 AGCCACTGGGGAGGCTGACATGG - Intronic
905976431 1:42177710-42177732 AATCACTGGGAAGCCAGCCATGG - Exonic
906747736 1:48233544-48233566 GTTCACTGGAGACTCTGACAGGG - Intronic
907268056 1:53274793-53274815 AATCTGCGGGGACCCTCACAGGG + Intronic
908618478 1:65949437-65949459 AATCACTGGGGCTCTTGCCAGGG + Intronic
909051379 1:70772634-70772656 AATCACTGGCATCCCTGAAAGGG - Intergenic
909691412 1:78411206-78411228 AATCACTGGCATCCCTGAAAGGG + Intronic
911186530 1:94910059-94910081 AATCACTGGGGACAATAACCAGG - Intronic
915210577 1:154305854-154305876 AGTCACAGGGATCCCTGACAGGG + Intergenic
916497856 1:165361257-165361279 AATCACAGGGGAGTCTGACGTGG - Intergenic
916635672 1:166665798-166665820 AATAAAAGGGGACACTGACATGG + Intergenic
917173149 1:172200525-172200547 AATCACTGGCATCCCTGAAAGGG - Intronic
918866493 1:189906900-189906922 AATCACTGGCATCCCTGAAAGGG - Intergenic
919899253 1:202031845-202031867 AAACACTGATGTCCCTGACAGGG - Intergenic
920203143 1:204273022-204273044 GGTCACAGGGGACCCTGACAAGG - Intronic
921977002 1:221213817-221213839 AATCACTGGAGAAAATGACAGGG - Intergenic
923362254 1:233223260-233223282 AATCAACGGTGACCCTGACAAGG + Intronic
1063280143 10:4619917-4619939 AATCACTAGGAGCGCTGACATGG + Intergenic
1063630179 10:7726068-7726090 CATCATTGGTGACCTTGACAAGG + Intronic
1064548532 10:16475379-16475401 AATGACTGGGGGCCCTGGGATGG + Intronic
1064948310 10:20817399-20817421 AGTCACTGGGAACCCTGAGGTGG + Intronic
1068587517 10:58816025-58816047 AAACATTGGTGACCTTGACAAGG - Intronic
1070829410 10:79409482-79409504 AATCAGAGGGGACCCCTACAGGG - Intronic
1073507508 10:104012169-104012191 AACCACTGGGGACCATGACATGG + Intronic
1073876044 10:107922116-107922138 AATCACTGGCATCCCTGAAAGGG + Intergenic
1075739298 10:124684105-124684127 AGGGGCTGGGGACCCTGACAGGG + Intronic
1075786994 10:125056844-125056866 AAGCACTGGGGCCACAGACACGG - Intronic
1075893642 10:125976431-125976453 AATCACTGGCATCCCTGAAAGGG - Intronic
1077051802 11:569885-569907 AGTCAGTGGGGTCCCTGAGAAGG + Intergenic
1077965097 11:7121876-7121898 AACAATTGGGAACCCTGACAAGG + Intergenic
1081271670 11:41092393-41092415 AATCACTGTTACCCCTGACAGGG + Intronic
1085267908 11:75248210-75248232 AATCTCTGTGCACCCTGACTGGG - Intergenic
1085446640 11:76605058-76605080 AGTCACTGGTGACCTTGAGAAGG - Intergenic
1087302726 11:96454861-96454883 AAACACTGGGGACTATGACAAGG - Intronic
1087880078 11:103405560-103405582 GATAACTGGGGCACCTGACATGG - Intronic
1090397277 11:126427340-126427362 GATAACTGGGGAAGCTGACATGG + Intronic
1090675674 11:128993040-128993062 AATCACATAGGAGCCTGACAAGG - Intronic
1091490823 12:931132-931154 AATCCCTGAGGACCCAGAGAGGG + Intronic
1092678398 12:10948247-10948269 AATCACTGGAATCCCTGAAAGGG - Intronic
1096648710 12:53051596-53051618 GATCACTTGGGCCCCTCACATGG - Intronic
1100411123 12:94320993-94321015 AATCACTGGCATCCCTGAAAGGG - Intronic
1103567517 12:121823908-121823930 ATTCACTCGGGAGCCTGGCATGG - Intronic
1104611341 12:130230869-130230891 AATCACTGTGTGCCCTGACAAGG + Intergenic
1108234505 13:48389298-48389320 AGTCACTGGTGACAGTGACAAGG + Intronic
1112261786 13:97884167-97884189 AGTCACTGGGGACCCTGGTCAGG + Intergenic
1113227057 13:108170291-108170313 AATCACTGGTATCCCTGAAAGGG + Intergenic
1114591252 14:23866834-23866856 AATCACTTGGCATCCTGAAATGG - Intergenic
1116305115 14:43243710-43243732 AGACACTGGGGACCCAGAAATGG - Intergenic
1117820767 14:59646332-59646354 AATCACTGGCATCCCTGAAAGGG + Intronic
1118276042 14:64387382-64387404 ATTGCCTGGGGAGCCTGACAGGG - Intergenic
1118652737 14:67915058-67915080 AGACACTGGGGACCATTACAGGG + Intronic
1118774000 14:68962121-68962143 CATCAGTGGGGATCCTGACTCGG - Intronic
1118957834 14:70499089-70499111 AATCACTGGTGTCCCTGAAAGGG + Intergenic
1120234386 14:81874422-81874444 ATCCTCTGGTGACCCTGACAGGG + Intergenic
1120743647 14:88134461-88134483 AAGAAATGGGGACCATGACAAGG + Intergenic
1121553961 14:94822442-94822464 AATCCTTGGGGAGCCTCACAGGG + Intergenic
1122038722 14:98966850-98966872 CAACACTGGGGACCTTGGCATGG - Intergenic
1122414699 14:101543292-101543314 AGCCACTGAGGACCCTCACATGG + Intergenic
1123937566 15:25201439-25201461 AATCAATGAGGTCCCTGGCAGGG + Intergenic
1125601214 15:40916650-40916672 AAGCACGGGGGACCCTGACAGGG + Intergenic
1126411069 15:48373695-48373717 AGTCATTGGTGACACTGACATGG - Intergenic
1128809509 15:70560607-70560629 AATAACTGGAGACCCTGGCCAGG + Intergenic
1129573506 15:76715619-76715641 GGTCACTTGGGACCCTGACTTGG - Intronic
1129584800 15:76851209-76851231 AATCACTGGCATCCCTGAAAAGG + Intronic
1132747876 16:1444485-1444507 CCTCCCTGGGGACCCTGAGAAGG - Exonic
1132806996 16:1779447-1779469 AGCCACAGGGGACCATGACATGG + Intronic
1133396154 16:5449108-5449130 AATCCCTGGGGTCCCAGACGAGG + Intergenic
1133777556 16:8909329-8909351 AGGAACTGGGGACCATGACAAGG + Intronic
1135219580 16:20602347-20602369 AACCACCGGGGACCCCGAGATGG - Intergenic
1136560459 16:31036124-31036146 CCTCACTGGGGACCCAGAGAGGG - Intronic
1137638988 16:50011996-50012018 AATCCCAGGAGACCCTGCCAAGG - Intergenic
1138997246 16:62470928-62470950 AATCACTGGCATCCCTGAAAGGG - Intergenic
1144635512 17:16905480-16905502 AGACACTGGGGACTCTGAAAGGG - Intergenic
1146390514 17:32417972-32417994 AAACACTGGGGACTCCTACAGGG - Intergenic
1146540009 17:33685935-33685957 AGTCACGGGGGACCGGGACACGG + Intronic
1152254741 17:79231325-79231347 CAGCACTGGGCACCCTCACAGGG + Intronic
1153785524 18:8530564-8530586 AATCACTGGCCTCCCTGAAAGGG + Intergenic
1155086485 18:22463974-22463996 TATCACTAAGGACCCTGGCATGG - Intergenic
1158108966 18:53918710-53918732 AAACCATGGGGACCCTGTCATGG - Intergenic
1158180959 18:54714402-54714424 AATCACTGGGGACCCCCATCAGG - Intergenic
1158984582 18:62801133-62801155 AATCACTGGGGCCCAGGAGAAGG - Intronic
1159606921 18:70484385-70484407 AACCACTGGTGTCCCTGAAAAGG - Intergenic
1161108442 19:2455850-2455872 GATCACGGGGGACCCTGAGCAGG - Intronic
1163769325 19:19181106-19181128 AATCACTTGGAACCCAGAGAGGG + Intronic
1166210153 19:41301778-41301800 AATCACTGGGGAGCCAGGGAAGG - Intronic
1166911554 19:46162412-46162434 AATCACTGGCATCCCTGAAAGGG - Intergenic
1167680853 19:50919782-50919804 ATACAATGGTGACCCTGACAGGG - Intergenic
925391522 2:3497774-3497796 AAACACTAAGGATCCTGACAGGG + Exonic
925489142 2:4372688-4372710 AATCACTCGGGTGGCTGACAGGG - Intergenic
927206132 2:20611727-20611749 AACCACTGGAGACCCAGAAAGGG - Intronic
928251602 2:29686016-29686038 AATCACAGGGGACCTTAAAAGGG - Intronic
928328604 2:30339579-30339601 AGCCACTGAGGCCCCTGACAGGG - Intergenic
928462015 2:31483938-31483960 AATCACTGGCAACCTTGAAAGGG - Intergenic
928607939 2:32961378-32961400 AATTAATGGGGATCCTTACATGG + Intronic
929946668 2:46377284-46377306 AGTCACTGGGGACCCCGGCAGGG + Intronic
929961076 2:46496764-46496786 AATCTTTGGGGAGCCTGATACGG - Intronic
930116758 2:47724798-47724820 AATCACTGTGGACTGTGAAAAGG + Intronic
930229583 2:48829244-48829266 AATCACTGGCATCCCTGAAAGGG + Intergenic
931807234 2:65819033-65819055 AGTCATTGGTGACCTTGACAAGG - Intergenic
931845163 2:66196181-66196203 AATCACTGTGGCCTCTGAGATGG - Intergenic
932269882 2:70399946-70399968 AATGCCTGGGGACCCTGTCAGGG + Intergenic
932290194 2:70570726-70570748 AATCAAGGGGGCCCCTGAAAAGG - Intergenic
933085624 2:78051469-78051491 AATCACTGGAATCCCTGAAAGGG - Intergenic
933695473 2:85214088-85214110 AATGCCTGGGTTCCCTGACACGG - Intronic
934622717 2:95825225-95825247 AATCACTGGCATCCCTGAAAGGG - Intergenic
934811061 2:97276878-97276900 AATCACTGGCATCCCTGAAAGGG + Intergenic
934826631 2:97431061-97431083 AATCACTGGCATCCCTGAAAGGG - Intergenic
942110638 2:172679196-172679218 AATGACTTGGGAGCCTGAGATGG + Intergenic
946629253 2:221648437-221648459 AATTACAGGGGAAACTGACAGGG - Intergenic
947380787 2:229543597-229543619 ATTCACTGGGAAGCCTGAGAAGG + Intronic
947854131 2:233311756-233311778 AATGACTGAGGCCCCTGAGAAGG - Intronic
948130856 2:235599710-235599732 AATCACGTGGGACCCAGAAAGGG - Intronic
1169204971 20:3734272-3734294 AGTCACTGGGGACCAGGATAGGG - Intronic
1169574186 20:6940199-6940221 AATCACTGGTGATCATGCCACGG + Intergenic
1172101150 20:32484324-32484346 AAGCACTGGGGGCCCTGCCGTGG - Intronic
1173342882 20:42169190-42169212 CATCACTGGGGTCTTTGACATGG + Intronic
1173405870 20:42764216-42764238 AAGCACTGGGGACATTTACAAGG + Intronic
1173570347 20:44071753-44071775 AAGCACTGGGGTCTCTGCCATGG + Intergenic
1177677804 21:24324707-24324729 AATTAATGTGGAGCCTGACAGGG - Intergenic
1180187637 21:46147319-46147341 AATCACAAGCCACCCTGACAGGG + Intronic
1181037558 22:20177248-20177270 AATCTAGGGGGAACCTGACATGG - Intergenic
1181857235 22:25790837-25790859 AATCTCTGAGGACCCAGAGAAGG + Intronic
1182337893 22:29597402-29597424 AAGCACTGTGGACCCAAACAAGG + Intergenic
1182354040 22:29714166-29714188 AAACACTGGGGGCCCCTACAGGG - Intergenic
1184110687 22:42392397-42392419 AGTCAATGGTGACCCTGAGAAGG + Intronic
1184882260 22:47315939-47315961 AATCCCTAGAGACCCTGAAAGGG - Intergenic
950600854 3:14034320-14034342 AATCACTGGCATCCCTGAAAGGG - Intronic
953720039 3:45347263-45347285 AATCACTGGGCATCCTCAAAGGG - Intergenic
953929560 3:46999151-46999173 ATTCACTGGGGCCCCTGCCTGGG + Intronic
954163474 3:48738612-48738634 AGTCACTGGGGACTGTGCCATGG + Intronic
954315819 3:49801161-49801183 GGTCACTGGGAACCCTGACAAGG - Intergenic
955520569 3:59771622-59771644 AATCACTGGAAATGCTGACATGG + Intronic
955731458 3:61991756-61991778 AATCACTGGGCTCTCTGATACGG + Intronic
957955537 3:87181821-87181843 TAACACTGGGGACCCTCACAGGG + Intergenic
958148359 3:89657042-89657064 AATCACTGGCATCCCTGAAAGGG - Intergenic
959916381 3:111821087-111821109 AATCACTGGGGACCCTGACATGG - Intronic
960242916 3:115366473-115366495 ATACACTGGGGCTCCTGACAGGG + Intergenic
961105222 3:124235020-124235042 AACCACTAGGGTCCCTGGCAGGG - Intronic
963368232 3:144365952-144365974 AATTAGTGGGGAGCCAGACATGG + Intergenic
965317943 3:167213565-167213587 AATCACTGGCACCCCTGAAAGGG + Intergenic
966466058 3:180232483-180232505 AAGTACTGGTGACCATGACAAGG - Intergenic
966646934 3:182256472-182256494 AAGCATTGGGGACCTTGAAAGGG + Intergenic
969512126 4:7624194-7624216 TATCACTGCAGACCCTGACTGGG + Intronic
973574686 4:52274971-52274993 AATCACTGGCATCCCTGAAAGGG + Intergenic
977055924 4:92190412-92190434 TATCATTGGTGACCTTGACATGG - Intergenic
977509257 4:97940419-97940441 AATCACTGGCATCCCTGAAAGGG - Intronic
977971684 4:103220031-103220053 AATCACTGGTATCCTTGACAGGG + Intergenic
978238203 4:106486171-106486193 AATCACTGGCATCCCTGATAGGG - Intergenic
978585525 4:110272303-110272325 AATGTCTGGGGACTCTGACCCGG + Intergenic
979928773 4:126603099-126603121 AATCACTGGGGACCATTTTAGGG - Intergenic
981594158 4:146400243-146400265 GGTCACTGGTGACCTTGACAAGG + Intronic
983352166 4:166603475-166603497 AAGCAATGGGGAAACTGACAAGG + Intergenic
986611196 5:9569255-9569277 GGTCACTGGGGACCTTAACAAGG + Intergenic
987546665 5:19319347-19319369 AATAACTGGGGACTCTTGCAAGG - Intergenic
987660818 5:20873136-20873158 AATCACTGGTGTCTCTGAGAGGG + Intergenic
991899956 5:71450876-71450898 AAGCACTGTGGATCGTGACAAGG - Intergenic
992825655 5:80547581-80547603 ATTCACTGGGTAGACTGACAGGG + Intergenic
994385965 5:99132259-99132281 AGTCATTGGTGACCTTGACAAGG - Intergenic
994473280 5:100237226-100237248 AATCACTGGCATCCCTGAAAGGG - Intergenic
995584076 5:113628813-113628835 AATGACAGGGGACAATGACAGGG + Intergenic
995979385 5:118082698-118082720 AATCACTGTGAACAGTGACACGG - Intergenic
997199027 5:131998566-131998588 TGGCCCTGGGGACCCTGACATGG + Intronic
997438858 5:133894476-133894498 AAGCCCTGGGGACCCTGAGGGGG - Intergenic
999052307 5:148535757-148535779 AATCACTGGCATCCCTGAAAGGG + Intronic
1001143032 5:169161210-169161232 AATCCCCTGGGACCCTGCCAGGG - Intronic
1005670147 6:28097586-28097608 ACTCAATGGGGAACCTGACAAGG - Intergenic
1007113555 6:39327702-39327724 AATTAATGGAGAGCCTGACATGG + Intergenic
1007215890 6:40237104-40237126 AATCACTGGCATCCCTGAAAGGG + Intergenic
1008846234 6:55967171-55967193 AATCACAGGCCTCCCTGACAGGG - Intergenic
1010282340 6:74036209-74036231 AATCACTGACGACCTTGATAAGG - Intergenic
1010983565 6:82396840-82396862 GTTCACTGGGGACCCAGAGATGG - Intergenic
1012723052 6:102772565-102772587 AAACACTGGGGACTCTAATAGGG + Intergenic
1013194510 6:107833413-107833435 AAGCACTGGGGACCTAGCCATGG + Intergenic
1014726239 6:124975367-124975389 AATCACAGGTGACTCTGATATGG + Intronic
1017744017 6:157430798-157430820 AATCACTGGTGGCCCTGCCAAGG + Intronic
1018188448 6:161288016-161288038 AACCATTGGCCACCCTGACAAGG + Intergenic
1019336687 7:486171-486193 ACTCACTGAGGACCCTGCTATGG - Intergenic
1019543923 7:1563989-1564011 AACCACGGGGGCCCCTGACTGGG + Intergenic
1020452364 7:8334820-8334842 AGTCACTGGGGACACAGAGATGG + Intergenic
1023308104 7:38852723-38852745 AGTCTCTGGGAACCATGACAGGG - Intronic
1023338636 7:39196111-39196133 AATCACTGTGGAGCTTGACAAGG - Intronic
1023425865 7:40035636-40035658 AATCAGTGGGGGCCCTGAGCTGG - Intronic
1023886222 7:44358957-44358979 AATCACTGGCATCCCTGAAAGGG - Intergenic
1027766159 7:82345031-82345053 AATCATTGGTGATCCTGACTAGG - Intronic
1030066804 7:105665855-105665877 AATCTCTGTGGACCCTGAGGAGG - Intronic
1030200749 7:106901174-106901196 AATCACTGGCATCCCTGAAAGGG - Intronic
1030679732 7:112422326-112422348 AGTCACTGGGGAACCTGAATTGG - Intergenic
1032062380 7:128735818-128735840 TATCCCTGGAGACCCTGATATGG - Intergenic
1032479224 7:132233207-132233229 CACATCTGGGGACCCTGACAAGG + Intronic
1035047868 7:155981048-155981070 AAACACAGGGGACCCAGAGATGG + Intergenic
1035478059 7:159157804-159157826 ATTCACTTGGGACCCTCACTGGG + Intergenic
1036633050 8:10528972-10528994 AATCACTGAGGCCCTTGAGAGGG - Intronic
1037881129 8:22574009-22574031 AGTCACTGGGGACCCAGGCCGGG - Intronic
1038629746 8:29230511-29230533 AATCCCTGAGGACACAGACAAGG + Intronic
1040482286 8:47836994-47837016 AAGCAATGGCGATCCTGACAAGG + Intronic
1044162394 8:88935795-88935817 AGTGACTGGGGACCCTGGCTGGG - Intergenic
1047139462 8:122121001-122121023 AGTCATTGGTGACACTGACAAGG + Intergenic
1052094481 9:24368166-24368188 AATCACTGGCATCCCTGAAAGGG - Intergenic
1053067196 9:35077066-35077088 GATCACAGGGAACCCAGACAAGG - Exonic
1055132867 9:72795148-72795170 AATCACTGGCATCCCTGAAAGGG + Intronic
1055707641 9:79023988-79024010 AATCACTGGGGAACCATACAGGG - Intergenic
1056271281 9:84950282-84950304 ACTCACTGTGGACCCTACCAGGG - Intronic
1059573575 9:115466717-115466739 AGTAAATGAGGACCCTGACAAGG + Intergenic
1060342546 9:122789875-122789897 AATCACTGGGACCCCTGCCCTGG - Exonic
1061338773 9:129961967-129961989 AGTCTCTGGGGACCCAGACAGGG - Intronic
1061442639 9:130616734-130616756 GTTCACTGGGGCCCCTGATAGGG - Intronic
1186303107 X:8222081-8222103 AATCAGTGAGGAACTTGACACGG + Intergenic
1188970482 X:36609370-36609392 AATCACTGGTCATCCTGAAAGGG - Intergenic
1190854546 X:54280762-54280784 AAACACTGGGGACTATGAGAGGG + Intronic
1192030031 X:67500547-67500569 AGACACTGGGGGCCCTGAAAGGG + Intergenic
1192254188 X:69441849-69441871 AATCACTGGCCCCCCTGAAAGGG - Intergenic
1193133353 X:77942530-77942552 GATCACTTGGGACCCGGTCAAGG - Intronic
1193299189 X:79868886-79868908 AATCACTGGCATCCCTGAAAGGG + Intergenic
1193455475 X:81726318-81726340 AATCACTGGTATCCCTGAAAGGG + Intergenic
1194593780 X:95834146-95834168 AATCACTGGTATCCCTGAAAGGG - Intergenic
1199695353 X:150339983-150340005 AATCACTGCAGCCCCAGACAGGG + Intergenic