ID: 959916643

View in Genome Browser
Species Human (GRCh38)
Location 3:111823870-111823892
Sequence ATGTGTGAGGAGATGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 651
Summary {0: 1, 1: 2, 2: 1, 3: 49, 4: 598}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959916633_959916643 15 Left 959916633 3:111823832-111823854 CCAGCCCCCTTGCCTGCATAGCA 0: 1
1: 0
2: 0
3: 20
4: 206
Right 959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG 0: 1
1: 2
2: 1
3: 49
4: 598
959916636_959916643 9 Left 959916636 3:111823838-111823860 CCCTTGCCTGCATAGCACTGCAG 0: 1
1: 0
2: 0
3: 10
4: 160
Right 959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG 0: 1
1: 2
2: 1
3: 49
4: 598
959916634_959916643 11 Left 959916634 3:111823836-111823858 CCCCCTTGCCTGCATAGCACTGC 0: 1
1: 0
2: 0
3: 16
4: 160
Right 959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG 0: 1
1: 2
2: 1
3: 49
4: 598
959916632_959916643 20 Left 959916632 3:111823827-111823849 CCTCACCAGCCCCCTTGCCTGCA 0: 1
1: 0
2: 6
3: 65
4: 612
Right 959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG 0: 1
1: 2
2: 1
3: 49
4: 598
959916635_959916643 10 Left 959916635 3:111823837-111823859 CCCCTTGCCTGCATAGCACTGCA 0: 1
1: 0
2: 0
3: 10
4: 165
Right 959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG 0: 1
1: 2
2: 1
3: 49
4: 598
959916631_959916643 29 Left 959916631 3:111823818-111823840 CCTGACGTTCCTCACCAGCCCCC 0: 1
1: 0
2: 0
3: 18
4: 234
Right 959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG 0: 1
1: 2
2: 1
3: 49
4: 598
959916638_959916643 3 Left 959916638 3:111823844-111823866 CCTGCATAGCACTGCAGTATGTG 0: 1
1: 0
2: 1
3: 9
4: 101
Right 959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG 0: 1
1: 2
2: 1
3: 49
4: 598
959916637_959916643 8 Left 959916637 3:111823839-111823861 CCTTGCCTGCATAGCACTGCAGT 0: 1
1: 0
2: 0
3: 12
4: 178
Right 959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG 0: 1
1: 2
2: 1
3: 49
4: 598

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959916643 Original CRISPR ATGTGTGAGGAGATGGTGGA GGG Intronic
900509341 1:3051200-3051222 ATGGGTGAGTGGATGGTGGGTGG - Intergenic
900573330 1:3370817-3370839 ATGGATGAATAGATGGTGGATGG - Intronic
901006675 1:6175066-6175088 ATGGATGAGTGGATGGTGGATGG + Intronic
901006731 1:6175341-6175363 ATGGATGAGTGGATGGTGGATGG + Intronic
901235164 1:7663800-7663822 AGGTGAGAGGAGGTGGTGGTTGG - Exonic
902202562 1:14844859-14844881 ATGGGTGAGTAGGTGGTGAATGG + Intronic
902249433 1:15144294-15144316 ACGTTTGGGGAGATGGAGGATGG - Intergenic
902619692 1:17643721-17643743 AAATGTGGGGAGATGGTGCATGG + Intronic
902758829 1:18567452-18567474 TTGTGTGAGGAAAGGGTGGAGGG - Intergenic
902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG + Intergenic
903329470 1:22589873-22589895 TTTTGGGAGGAGATGGTGGGTGG - Intronic
903578432 1:24353501-24353523 ATGGGTGGGTAGATGGTGGATGG + Intronic
903694086 1:25194833-25194855 CAGTGTCATGAGATGGTGGAAGG + Intergenic
904066365 1:27754945-27754967 ATGTGAGAGAAGATGCTGCAGGG + Intronic
904338120 1:29810968-29810990 ATGTGTGAGGCGAAGGAGGGTGG + Intergenic
904392518 1:30195372-30195394 ATGTGAGAAGAGAAGGAGGAAGG - Intergenic
904625212 1:31798554-31798576 CTGAGTGAGGAGGTGGTGGAGGG - Exonic
905548901 1:38820200-38820222 GTGTGTGTGGAGGTGGTGGGAGG - Intergenic
906045547 1:42828102-42828124 ATGTTAGAAGAGATGGAGGAAGG + Intronic
906241959 1:44247796-44247818 ATAGGTGGGGGGATGGTGGAAGG - Intronic
906466648 1:46087116-46087138 GTGTGTGGGGGAATGGTGGAGGG + Intronic
907819921 1:57957137-57957159 ATGTGTGAAGAGATTGTACAGGG + Intronic
908209648 1:61887185-61887207 TAGTCTGTGGAGATGGTGGAGGG + Intronic
908466943 1:64405553-64405575 ATGTGTGTGGGGAGGGTTGAAGG + Intergenic
909201331 1:72693420-72693442 ATGTGTCAGCAGATAGTGGGAGG + Intergenic
909573306 1:77142779-77142801 ATGTGTGGAGAGAAGGAGGAAGG - Intronic
909652510 1:77991574-77991596 GTGTGTGTAGAGATGGTGGGAGG - Intronic
910356720 1:86365875-86365897 GTGTGTGAGCAGGGGGTGGAGGG - Intronic
910434630 1:87192806-87192828 ATGTGTGTGGTGAAGGTTGATGG + Intergenic
911792304 1:102032926-102032948 CTGTGTGAGGAGATGGATGCAGG + Intergenic
914351262 1:146842578-146842600 ATGGATGAGTAGATGATGGATGG + Intergenic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
915123685 1:153648741-153648763 ATCCATGAGGAGATGGGGGAAGG + Intergenic
915790902 1:158669882-158669904 ATGTGGGAGGAGAAGTTTGAAGG + Intronic
916787262 1:168095684-168095706 ATCTGTGAGGAGGAGGAGGATGG + Intronic
916836014 1:168545826-168545848 GTGTGTGAGTGAATGGTGGAAGG - Intergenic
916838452 1:168574749-168574771 GTGTGTGAGTGAATGGTGGAAGG + Intergenic
918170264 1:181989631-181989653 ATGTGTGAGGAGAAAGAAGAAGG - Intergenic
918170283 1:181989765-181989787 ATATGGGTGCAGATGGTGGAAGG - Intergenic
918213035 1:182368398-182368420 ATGTTTGAGGAAAAGGTGGAAGG + Intergenic
918585868 1:186187788-186187810 ATGTGTGACTAGAATGTGGAGGG - Intronic
918705789 1:187660388-187660410 ATTTGGGAGAAGGTGGTGGAAGG - Intergenic
918765162 1:188472587-188472609 ATGTGTAAGCAGAGGGTTGAAGG + Intergenic
918860464 1:189819604-189819626 ATGTGTGTGGAGATTGGGGTAGG + Intergenic
918965749 1:191345070-191345092 ATGTGAGAGGAAAAGGGGGAGGG - Intergenic
919200825 1:194353258-194353280 ATGTATGTGGTGATGGTGAATGG - Intergenic
919282533 1:195509738-195509760 ATTTATGTGGAGATGGTGAAAGG - Intergenic
919763383 1:201112032-201112054 TTGAGTGAGGAGCTGGGGGAAGG - Intronic
920029844 1:203030275-203030297 AGGTGTGAGGTGAGGCTGGATGG + Intronic
920504136 1:206504879-206504901 ATGTGGGAGGAGATTGTGCAGGG - Intergenic
920722733 1:208402700-208402722 ATTGGTAAGGAGGTGGTGGATGG - Intergenic
920941860 1:210491107-210491129 AAGTGGGAAGAAATGGTGGAGGG + Intronic
922245172 1:223789037-223789059 AAGTGCGAGGAAATGGAGGAAGG - Exonic
922719723 1:227893987-227894009 ATGTTTGAGAATGTGGTGGATGG - Intergenic
923083143 1:230679324-230679346 ATGAATGAGGACATGGTGGGTGG - Intronic
924331019 1:242940565-242940587 AAGTGAGAGGAAATGGTGAAAGG - Intergenic
1062879059 10:963771-963793 ACGTGTCATGACATGGTGGAAGG + Intergenic
1062940218 10:1415185-1415207 GTGGGTGAACAGATGGTGGATGG + Intronic
1063175749 10:3549417-3549439 AACCGTGAGGAGAAGGTGGATGG + Intergenic
1063345906 10:5312302-5312324 CTGTGTGATAACATGGTGGAGGG + Intergenic
1063361524 10:5463171-5463193 TTGTGTGAGCTGATGATGGAGGG - Intergenic
1063536337 10:6887307-6887329 ATGTGTGGGTTGATGGGGGATGG - Intergenic
1063957978 10:11283583-11283605 ATGGGTGACTAGATGATGGATGG + Intronic
1065710577 10:28513213-28513235 CTGTGAGAAGATATGGTGGAAGG - Intergenic
1066425124 10:35301279-35301301 ATGTGTGTAGACATGATGGAAGG + Intronic
1067225366 10:44372852-44372874 CTGTGGGATGGGATGGTGGAGGG - Intronic
1067741231 10:48897354-48897376 ATGTGGGTGGAGCTGGTGGAGGG + Intronic
1068137955 10:52969583-52969605 ATGTGTGAGGATATGGGGGTGGG - Intergenic
1068195291 10:53708224-53708246 ATGTGGGAGTTGATTGTGGATGG - Intergenic
1069598580 10:69688495-69688517 CTGTGTCATGACATGGTGGAAGG - Intronic
1069740230 10:70682677-70682699 AGGTCTGAGGGGATGGTGGCAGG + Intronic
1069815415 10:71190881-71190903 ATGTTTGAGGAGATATTGGCTGG + Intergenic
1069943388 10:71970253-71970275 CTTTGTGAGGAGGTGGTGGGGGG - Intronic
1071097388 10:81993588-81993610 CTTTGTGAGGACATGGTGGGAGG - Intronic
1071712383 10:88062337-88062359 CTGTGTGAGGAGGTGGGGGATGG - Intergenic
1072219112 10:93312804-93312826 ATGTGTTTGGAGTTGGAGGAAGG - Intronic
1072497457 10:95976248-95976270 ATGGGTGAGCAGAAAGTGGAGGG - Intronic
1072593044 10:96844900-96844922 AAGTGTGGGGTGGTGGTGGAGGG + Intronic
1072751034 10:97979004-97979026 CTGAGTGAGGAGATGGGGGCAGG + Intronic
1072946178 10:99811859-99811881 TTGTGTGTGCAGATTGTGGATGG + Intronic
1072994202 10:100229054-100229076 ATGTGTGAGAAGAGGGCTGAAGG - Intronic
1073887742 10:108060222-108060244 ATGGGTGAGGAGATAATAGAAGG - Intergenic
1074187137 10:111107098-111107120 CTGTGGGAAGAGATGGGGGAAGG - Intergenic
1074234064 10:111567016-111567038 GTGTGTGGGGAGGTGGGGGAGGG + Intergenic
1076214103 10:128679124-128679146 ATCTGGGAGGGGATTGTGGAGGG + Intergenic
1076845121 10:133066046-133066068 ATGGGTGGATAGATGGTGGATGG + Intergenic
1076984203 11:223624-223646 ACGTGTGAGGAGAAGGGAGAAGG - Intronic
1077537557 11:3131754-3131776 ATGGATGGGAAGATGGTGGATGG - Intronic
1079110228 11:17601273-17601295 ATGTGGCAGGAGAGGGTGCAGGG + Intronic
1079269580 11:18971787-18971809 ATGCCTGAGGTGAAGGTGGAGGG - Intergenic
1079664984 11:23093672-23093694 ATGTTTAAGGAAATGGTGGGTGG - Intergenic
1080488342 11:32734642-32734664 ATGAGTTAGGAGATGCTTGAAGG - Intronic
1081183561 11:40014429-40014451 TTGGGTGGGGAGATGGGGGAGGG + Intergenic
1081875762 11:46407476-46407498 CTCTGGGAGGAGGTGGTGGAAGG - Intronic
1082098346 11:48150238-48150260 ATCTGAGGGGAGTTGGTGGATGG + Intronic
1084174978 11:67418350-67418372 GTGGGTGTGGAGGTGGTGGAAGG + Intronic
1084430218 11:69106796-69106818 CTGAGTGGGAAGATGGTGGAGGG - Intergenic
1084609817 11:70194932-70194954 ATGGGTGGGTAGATGGTAGATGG + Intergenic
1084682989 11:70677934-70677956 ATGCCAGTGGAGATGGTGGAAGG - Intronic
1084918418 11:72449259-72449281 ATCTGTGAGGAGAAGCGGGAGGG + Intergenic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1085082795 11:73647894-73647916 AGGTGTGAGCAGGTGGGGGAGGG + Intronic
1085825835 11:79846346-79846368 ATGAGAGAGAAGAAGGTGGAGGG + Intergenic
1085858285 11:80201154-80201176 ATGTGTGTGAGGATGGGGGAGGG - Intergenic
1085881431 11:80471667-80471689 GTGTGTGTGGAGATGGGGGGGGG + Intergenic
1085934001 11:81122322-81122344 ATCTGTGAGGTGATTGTGGCTGG - Intergenic
1086141649 11:83506344-83506366 AGGTGTGAGATAATGGTGGAAGG - Intronic
1086202829 11:84224076-84224098 ATGTGGGAGGAGTTAGGGGAAGG - Intronic
1086215204 11:84370892-84370914 ATGTGTGGGCAGGTGGTGGGAGG + Intronic
1086367640 11:86123961-86123983 AAGGGTGAGGTGTTGGTGGAAGG - Intergenic
1086672856 11:89568424-89568446 ATGTGTGTGGCTATTGTGGATGG - Intergenic
1086734078 11:90283872-90283894 GTGGGTGAGGGGATGGAGGAAGG + Intergenic
1086935468 11:92741282-92741304 ATTTGTGAGGTGGTGGTGGGAGG - Intronic
1087213970 11:95474890-95474912 ATGTGTGATGAGATTATTGAAGG - Intergenic
1088232706 11:107689021-107689043 AAGTGGGAGGAGAAGCTGGAAGG - Intergenic
1091294483 11:134463993-134464015 ATGTTTGAGGAGAATGTGCAGGG + Intergenic
1091672021 12:2458631-2458653 ATGAGTTTGGAGATGGTGTAAGG + Intronic
1092725451 12:11481116-11481138 ATGTGTCAAGAGAAGGTGAAAGG + Intronic
1093058424 12:14578297-14578319 ATGGGTGAAGAGAAGGAGGAAGG + Intergenic
1093113997 12:15187133-15187155 ATCTTTGAGGAGATGGTGGGAGG + Intronic
1094354105 12:29559265-29559287 ATGGGTGAGCCCATGGTGGAAGG - Intronic
1095236487 12:39802322-39802344 ACGTATGTGAAGATGGTGGAAGG + Intronic
1095413863 12:41953945-41953967 ATGTCTAAGAAGATTGTGGATGG + Intergenic
1096127107 12:49128067-49128089 GTGGGTGAGGGGATGGAGGAAGG - Exonic
1096145080 12:49273102-49273124 GTGGGTGAGGGGATGGAGGAAGG + Exonic
1096418013 12:51430483-51430505 ATGTGTGAGGAGAGGGTGGAGGG - Intronic
1096481306 12:51942922-51942944 GTGTGTGAGAAGGGGGTGGATGG + Intergenic
1096563393 12:52453464-52453486 ATGGGTGAGGAAGAGGTGGAGGG + Intergenic
1097294683 12:57949857-57949879 TTGAGTGGGGAGATGGGGGATGG - Intronic
1097305637 12:58066243-58066265 ATGTGTGTGGAGACTGTGGCAGG + Intergenic
1097946933 12:65379222-65379244 ATGGATGGGTAGATGGTGGATGG - Intronic
1100056632 12:90519578-90519600 ATGTATGTGGAGAGGGAGGATGG - Intergenic
1101324537 12:103703530-103703552 AGGTGTGTGGGGATGGTGGGGGG + Intronic
1101655411 12:106715979-106716001 ATGTCTGAGAAGCAGGTGGATGG + Intronic
1101997980 12:109538702-109538724 CAGGGTGAGGAGATGCTGGATGG + Intergenic
1103006201 12:117422360-117422382 ATGTATGAATAGATGGTGGATGG - Intronic
1103215085 12:119195561-119195583 ATGTGGGGGGAGCTGGGGGAGGG + Intronic
1103675848 12:122655114-122655136 ATGGGGGATGAGATGGTAGACGG - Intergenic
1104055744 12:125228636-125228658 ACGTGTGGGGACATGGTGCATGG + Intronic
1104224307 12:126816365-126816387 AAGGGTGAGGGGATGGGGGAGGG - Intergenic
1105446473 13:20461900-20461922 TTGTGGGAGGAGAGGGTGGGAGG + Intronic
1107628170 13:42312588-42312610 ATGGGTGAGGGGATGTTGGGGGG - Intronic
1107630020 13:42333728-42333750 ATGAGGGAAGAGATGGAGGAGGG + Intergenic
1108276272 13:48813012-48813034 ATTGGTGAGGAGATGGAGAAAGG - Intergenic
1108563856 13:51674731-51674753 ATGTGGGTGGGGAGGGTGGAGGG + Intronic
1108813388 13:54259345-54259367 TTGTGGGAGCAGATAGTGGAAGG - Intergenic
1109241010 13:59888251-59888273 CTGTGTTCTGAGATGGTGGAGGG - Intronic
1110184473 13:72656991-72657013 AGGTGAGGGGAGATGGTGGGTGG + Intergenic
1111912576 13:94328786-94328808 CTGTGGGAGGAGATGCTGGCTGG + Intronic
1112298229 13:98207895-98207917 GTGTGTGTGGAGGTGGTGGTCGG - Intronic
1112441355 13:99426936-99426958 AGGAGGGAGGAGAGGGTGGAAGG + Intergenic
1112441394 13:99427037-99427059 AGGAGGGAGGAGAGGGTGGAAGG + Intergenic
1113087150 13:106580374-106580396 AGGTGGGAGGAGGTGGAGGATGG + Intergenic
1115341222 14:32294897-32294919 TTGTGTGAGGAGATGGTATCTGG - Intergenic
1115705320 14:35992544-35992566 ATGTGTGAGCAGATGGGCGTAGG + Intergenic
1116260830 14:42623570-42623592 TTGTGTGGGAAGATGGGGGAGGG + Intergenic
1116603080 14:46952758-46952780 ATGTGTGATGATTTGGGGGAAGG + Intronic
1117712709 14:58548960-58548982 TTGTGTGTGGAGATGGGGGTGGG + Intronic
1117749722 14:58908625-58908647 AAGGGTGAGGGGATGGAGGAGGG + Intergenic
1117756150 14:58976124-58976146 AGGAGTGAGGAGAAGCTGGAGGG + Intergenic
1118171774 14:63395704-63395726 AGGGGGGAGGAGAGGGTGGAAGG + Intronic
1118334406 14:64840695-64840717 AAGTGTGTGGGGATGGTGAAGGG - Intronic
1118365447 14:65091521-65091543 ATGAGTGAAGGGATGGTGGCAGG - Intronic
1119140196 14:72260508-72260530 ATCTAGGAGGAGATTGTGGAGGG + Intronic
1121936705 14:98026308-98026330 ATGAGTGAGTGGATGGTGGGTGG + Intergenic
1122064573 14:99163323-99163345 ATGTGTGAGGAGGTGGGATAAGG - Intergenic
1122388192 14:101362988-101363010 ATGGGTGTGGACATGGCGGATGG - Intergenic
1122723873 14:103737723-103737745 AAGTGTGAGGAGATGGAGGAAGG - Exonic
1122872136 14:104643612-104643634 GAGCGTGAGGAGCTGGTGGAGGG - Intergenic
1123205624 14:106710377-106710399 ATCTCTGAGGAGAATGTGGAAGG - Intergenic
1123210674 14:106757652-106757674 ATCTCTGAGGAGAATGTGGAAGG - Intergenic
1123466651 15:20521441-20521463 AGGTGAGAGGAGAAGTTGGAGGG + Intergenic
1123468046 15:20530585-20530607 AGCTGTGAGGAGCTGGTGGCTGG - Intergenic
1123650067 15:22470457-22470479 AGCTGTGAGGAGCTGGTGGCTGG + Intergenic
1123651463 15:22479600-22479622 AGGTGAGAGGAGAAGTTGGAGGG - Intergenic
1123728361 15:23125794-23125816 AGCTGTGAGGAGCTGGTGGCTGG - Intergenic
1123740473 15:23279299-23279321 AGCTGTGAGGAGCTGGTGGCTGG + Intergenic
1123741881 15:23288461-23288483 AGGTGAGAGGAGAAGTTGGAGGG - Intergenic
1123745115 15:23314097-23314119 AGGTGAGAGGAGAAGTTGGAGGG + Intergenic
1123746525 15:23323259-23323281 AGCTGTGAGGAGCTGGTGGCTGG - Intergenic
1123987942 15:25661534-25661556 AGGTGTGGGGGGCTGGTGGATGG - Intergenic
1124267858 15:28253506-28253528 AGGTGAGAGGAGAAGTTGGAGGG - Intronic
1124277386 15:28337417-28337439 AGGTGAGAGGAGAAGTTGGAGGG + Intergenic
1124278792 15:28346576-28346598 AGCTGTGAGGAGCTGGTGGCTGG - Intergenic
1124303907 15:28565032-28565054 AGCTGTGAGGAGCTGGTGGCTGG + Intergenic
1124305316 15:28574189-28574211 AGGTGAGAGGAGAAGTTGGAGGG - Intergenic
1125922043 15:43530712-43530734 GTGGTTGAGGAGATGGGGGATGG - Exonic
1126118707 15:45232010-45232032 AAGTGGGAGGATATGGAGGATGG + Intergenic
1126667371 15:51087429-51087451 ATGAGGGAGGAGATTCTGGAAGG - Intronic
1127222263 15:56892088-56892110 GTGTGTGAGCTGGTGGTGGAGGG + Intronic
1127760614 15:62135919-62135941 GTGTGGGAGGAGACGCTGGAGGG + Intergenic
1129508792 15:76104735-76104757 ATGTGTGAGGAGAGGGGAGAAGG + Intronic
1129671057 15:77607857-77607879 ATGGGTGAGCACATGGTGGCGGG - Intergenic
1129714567 15:77839690-77839712 ATCTGTGTGGAGATGGGAGAAGG - Intergenic
1129826009 15:78635485-78635507 AGCTGTGAGGAGCTGGTGGCTGG + Exonic
1130121296 15:81049960-81049982 ATATGTTAGGAGCTGGTGGGGGG - Intronic
1130677839 15:85969453-85969475 ATGTGTGAGGAAGGGGTGGATGG - Intergenic
1130913359 15:88285912-88285934 ATGAGTGAGTAGGTGGTGGATGG - Intergenic
1131461336 15:92619667-92619689 CTGTGTGGGGAGCTGGGGGAGGG - Intronic
1132644825 16:994027-994049 ATGGGTGAGTGGGTGGTGGATGG - Intergenic
1133530559 16:6651410-6651432 AGGTGTGACATGATGGTGGATGG - Intronic
1134008636 16:10835036-10835058 CTGAGTCAGGAGATGGTTGAAGG - Intergenic
1134254958 16:12603089-12603111 TTATGGGAGGAGGTGGTGGAAGG - Intergenic
1134302622 16:13005131-13005153 TGGTGTGTGGAGTTGGTGGAGGG + Intronic
1134794232 16:17020061-17020083 ATATTTGAGGAGATTCTGGAAGG - Intergenic
1134826188 16:17286279-17286301 ATGTGGGAGGAGTGGGTGGGAGG + Intronic
1134979756 16:18597714-18597736 ATGTGTGTAGACATGCTGGAAGG + Intergenic
1135135668 16:19884340-19884362 ATGTGTGAGGAGCTGCGGGCTGG - Intronic
1135489757 16:22899194-22899216 ATGAGGGTGCAGATGGTGGAGGG + Intronic
1135726537 16:24858440-24858462 ATGAGTGAGTGGATGGTGGATGG + Intronic
1135737140 16:24940758-24940780 ATGTGGCTGGAGAGGGTGGAAGG + Intronic
1136607835 16:31348461-31348483 ATGGGTGATGGGAGGGTGGATGG + Intergenic
1136640893 16:31564193-31564215 AGGTGAGAAGAGATAGTGGATGG - Intergenic
1136664073 16:31793121-31793143 AGGTGAGAAGAGATAGTGGATGG + Intronic
1137444272 16:48522309-48522331 ATGTGTGGAGAGAAGGTGTATGG + Intergenic
1137521741 16:49200863-49200885 ATGTAGGAGGAGATATTGGATGG - Intergenic
1138008738 16:53359288-53359310 AGCTGTGAGGAGCTGGTGGCTGG - Intergenic
1138091022 16:54174689-54174711 GTGTGGGAGGAGTTGGGGGAGGG - Intergenic
1138102611 16:54265951-54265973 CTGTGTGGGGACATGGGGGAAGG - Intronic
1138645704 16:58422954-58422976 GTGTGGGAGGCGATGGTGAAGGG - Intergenic
1139430396 16:66908034-66908056 ATGTGGCAGGAGATGGGGAAGGG + Intergenic
1139542134 16:67626030-67626052 AGGTGGGAGAAGATGGTGGCTGG - Intronic
1139853552 16:69964329-69964351 ATGTCTGAGGAGCTGGGTGAGGG - Exonic
1139882525 16:70187238-70187260 ATGTCTGAGGAGCTGGGTGAGGG - Exonic
1139919352 16:70449545-70449567 CAGTGTGAGGAGAAGGTGGGTGG + Intergenic
1139982774 16:70872968-70872990 ATGGATGAGTAGATGATGGATGG - Intronic
1140369984 16:74408266-74408288 ATGTCTGAGGAGCTGGGTGAGGG + Intronic
1140517407 16:75553978-75554000 ATGTGATAGGGGATGGTGGGAGG - Intronic
1140654308 16:77123920-77123942 ATGGATGAAGAGATAGTGGAAGG + Intergenic
1140901315 16:79370635-79370657 ATGTGAGATGAGCTAGTGGAAGG - Intergenic
1140979405 16:80092487-80092509 ATGGGTGGGTAGATGGGGGATGG - Intergenic
1141163731 16:81646323-81646345 GTGGGTGAGTAGATGATGGATGG + Intronic
1141314319 16:82946260-82946282 ATGTGGGAGGGAAGGGTGGAAGG + Intronic
1141334129 16:83138925-83138947 ATGAGTGAGGAGGTAGAGGAAGG + Intronic
1142124216 16:88402151-88402173 ATGGATGGAGAGATGGTGGATGG + Intergenic
1142237774 16:88930726-88930748 AGGAGCGAGGAGATGGGGGAGGG + Intronic
1142237793 16:88930772-88930794 AGGAGCGAGGAGATGGGGGAGGG + Intronic
1143338377 17:6190470-6190492 AGGAGTGAGGAGTTGGAGGAAGG - Intergenic
1143703950 17:8683602-8683624 GTGTGTGTGGTGATGGTGGTGGG - Intergenic
1144051412 17:11500192-11500214 ATCTGTGAGGAGACTGAGGATGG - Intronic
1144124781 17:12192980-12193002 ATGAGTGAGGAGAAGGCAGATGG + Intergenic
1146375086 17:32288421-32288443 ATGAGTGAGTAGATGAAGGAAGG + Intronic
1146400232 17:32495632-32495654 TCGTGTGAGGAGCTGGAGGAAGG - Intronic
1146433975 17:32825534-32825556 ATTTGAGAGGCGAAGGTGGATGG - Intronic
1146840162 17:36146487-36146509 TTGTATTAGGAGATGATGGAGGG - Intergenic
1146981005 17:37161708-37161730 ATGTGTGGAGAGGTGGGGGAAGG - Intronic
1147020013 17:37523748-37523770 AGGTGGGGGGAGAAGGTGGATGG + Intronic
1147791120 17:43014877-43014899 ATGGGTGGGGAGATGGAGCAGGG - Exonic
1147947206 17:44086851-44086873 AAGTGGGAGGAGGTGGGGGAAGG - Intronic
1148722448 17:49763788-49763810 AAGTGTGAGGGGAAAGTGGATGG - Intronic
1148968983 17:51462845-51462867 ATAGGAGATGAGATGGTGGAAGG - Intergenic
1151325971 17:73379945-73379967 CTGTGTAAAGAGTTGGTGGATGG - Intronic
1151507962 17:74541791-74541813 AAGGGTCAGGGGATGGTGGAGGG - Intronic
1151927817 17:77211679-77211701 GTGTGTGTGAAGATGGTGTATGG + Intronic
1152041328 17:77905839-77905861 CTGTGTGAGCAGCTAGTGGACGG - Intergenic
1152259915 17:79261305-79261327 ATGTGTGAGTAAATGAAGGAGGG + Intronic
1152263879 17:79282185-79282207 ATGGGTGGGGAGGTGGTGGAAGG + Intronic
1152446206 17:80345839-80345861 CTGTGTGATCATATGGTGGATGG + Exonic
1152607656 17:81301068-81301090 ATGTGTGTGGTGTGGGTGGATGG + Intergenic
1152884513 17:82841720-82841742 TTGTGTCAGGAGTTTGTGGAGGG + Intronic
1153706387 18:7749637-7749659 CAGTGTGAGGAGGTGGTGTATGG + Intronic
1153994894 18:10432259-10432281 GTGTGTGAAGAGATGGGTGATGG - Intergenic
1155200833 18:23516183-23516205 CTGTGAGAGGACATGGGGGACGG + Intronic
1155582971 18:27332569-27332591 ATGGGTGGGGAGAAGGCGGATGG - Intergenic
1155770410 18:29690924-29690946 ATGCTTGAGTAGATGGTGGTAGG - Intergenic
1156403959 18:36766720-36766742 ATGTGTCAGGAGATGCTTAAAGG - Intronic
1156762893 18:40614676-40614698 ATGTCTGATGGGATGATGGATGG + Intergenic
1157208033 18:45717218-45717240 CTCTTTGAGGAGATGGTGGGGGG - Intergenic
1157676011 18:49569197-49569219 AAGTGTGGGGACAGGGTGGAGGG - Intronic
1157802224 18:50630063-50630085 CTGTGTTGGGAGATGGGGGAGGG + Intronic
1158210955 18:55049430-55049452 AAGTGTCAGGAAATGGAGGAAGG - Intergenic
1158424170 18:57324078-57324100 TTGTGTGTGGTGATGGTGGGAGG - Intergenic
1158457866 18:57623287-57623309 ATTTTTGTGGAGATGGGGGAGGG + Intergenic
1158464843 18:57680896-57680918 ATGTGAGAGCAGAATGTGGAAGG - Intronic
1158875204 18:61727178-61727200 ATGGGTGAGGACATGATGGTTGG - Intergenic
1159775882 18:72602266-72602288 ATAAGGGAGGGGATGGTGGACGG + Intronic
1159928239 18:74288254-74288276 GTGTGTGGTGAGATGGTGGAGGG - Intronic
1160226888 18:77018689-77018711 ATGTATGAGTGGATGGGGGATGG - Intronic
1160392649 18:78546907-78546929 ATGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160392658 18:78546926-78546948 AGGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160392667 18:78546945-78546967 AGGGGGGAGGAGAGGGTGGAGGG + Intergenic
1160589299 18:79933741-79933763 GTGTGTGGGGAGATGGGGGCGGG - Intronic
1160687114 19:442266-442288 ATGGGTGAGTGGATGATGGATGG + Intronic
1161347644 19:3776215-3776237 ATGTGTGAATGGATGGTGGGTGG + Intergenic
1161347731 19:3776547-3776569 ATGTGTGAGTGGATGGTAGGTGG + Intergenic
1161388483 19:4009137-4009159 ATGTGAAAGGGGATGGGGGAGGG - Intronic
1161641105 19:5423865-5423887 ATGTTTGGGCAGATGGTGGGTGG - Intergenic
1161984908 19:7647715-7647737 ATGTGTGAGGAGCCTGTGCAGGG - Exonic
1162228296 19:9243220-9243242 GTGTGTGTGGAGATGGCGGGAGG - Intergenic
1163007722 19:14406959-14406981 AGGTGAGAGGAGAGGCTGGAAGG + Exonic
1163382599 19:16978805-16978827 ATGGATGGGTAGATGGTGGATGG - Intronic
1163571257 19:18083697-18083719 ATGGATGGGTAGATGGTGGACGG - Intronic
1163580438 19:18135653-18135675 AAGTGAGGGGAAATGGTGGATGG + Intronic
1163609862 19:18295226-18295248 ATGAATGGGTAGATGGTGGATGG - Intergenic
1163609931 19:18295482-18295504 GTGGGTGAGTGGATGGTGGATGG - Intergenic
1163609980 19:18295650-18295672 ATGGATGAGTGGATGGTGGATGG - Intergenic
1163609990 19:18295695-18295717 ATGGATGAGTGGATGGTGGATGG - Intergenic
1163642147 19:18467898-18467920 GTGTGTGGGGAGATTGTGTATGG - Intronic
1163809079 19:19419130-19419152 ATGTGTGAGCACTCGGTGGAAGG + Intronic
1165161162 19:33817297-33817319 ATGTGTGATGAGAATGTGGGTGG + Intergenic
1165825762 19:38704924-38704946 CTGTGTGCAGAGATTGTGGACGG + Exonic
1166175292 19:41064300-41064322 ATGTGTGTGGTGATGGTGGTTGG + Intergenic
1168357735 19:55712897-55712919 AGGGGGGAGGAGATGGAGGAGGG + Intronic
1168464866 19:56594530-56594552 ATGGGTAAGGAGAGGGAGGAGGG - Intergenic
1168564503 19:57411842-57411864 AAGTGTGATGAGATTCTGGATGG + Intronic
925087851 2:1124776-1124798 AGAAGTGAGGAGATGGTGGTGGG + Intronic
925228266 2:2205785-2205807 ATATGTGAAGAGAAGGGGGATGG - Intronic
925902094 2:8515957-8515979 CTGTGTGGGGAGGTGGAGGAGGG - Intergenic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
926309722 2:11666788-11666810 ATGAGTGAGGAGAGGAGGGAGGG + Intronic
927322767 2:21767043-21767065 TTATGTGAGGAGATGGTGTTTGG + Intergenic
928477848 2:31649333-31649355 ATGTGTCAGGAGCCAGTGGATGG - Intergenic
929193272 2:39159763-39159785 ATGTGGGAGGCGAAGGTTGAAGG + Intergenic
929216924 2:39424345-39424367 AGGTGGGAGGGGATGGAGGAAGG + Intronic
929249116 2:39733197-39733219 AAGTGGGAGCAGATGCTGGAAGG - Intergenic
930063243 2:47308462-47308484 ATGAGTCAGGAGCTGGTGGAGGG - Intergenic
930825937 2:55696691-55696713 TTGTGTGAGGAAATGGGGGTGGG - Intergenic
931126512 2:59284134-59284156 AAGTGAGAGGAGATGAAGGAGGG + Intergenic
932326320 2:70864347-70864369 CTGTGTGAGGAGTGGATGGAAGG - Intergenic
932522009 2:72423686-72423708 ATGTGTGAGTAGATGTTTGTAGG - Intronic
932786537 2:74609693-74609715 ATTGGTGAGGAGATGGAGAAGGG - Intronic
933411615 2:81932755-81932777 ATGTTAGAGGCCATGGTGGATGG - Intergenic
933644113 2:84796149-84796171 ATCTTTGAGGGGGTGGTGGAAGG + Intronic
933820186 2:86104190-86104212 AGGTGTAAGGGGAGGGTGGAAGG + Intronic
935362908 2:102262803-102262825 ATGAGGGAGGAGATGGGTGAAGG + Intergenic
935407954 2:102728739-102728761 ATGTCCGAGGTCATGGTGGAAGG - Intronic
935438985 2:103069353-103069375 AGGAGTGAGAAGATGATGGAAGG - Intergenic
936644624 2:114354819-114354841 ATGTGTGTGGGGTTGGTGGATGG - Intergenic
937049257 2:118875250-118875272 ATGTCTGAGGAGCAGTTGGAGGG - Intergenic
937062719 2:118992342-118992364 ATGAGTGGGGAGCGGGTGGAGGG - Intronic
937362832 2:121240929-121240951 ATGTGTGTGGACATGCAGGAGGG - Intronic
938602661 2:132858236-132858258 ATGTCTGAGGATGTGGTGGGTGG - Intronic
939382143 2:141448852-141448874 ATGTGTGAGGATTGGGTGGATGG - Intronic
940052586 2:149479939-149479961 AGGTGTGAGGCCATGGAGGAAGG - Intergenic
940284424 2:152019531-152019553 ATGAGTGGGTGGATGGTGGATGG + Intronic
942326738 2:174782354-174782376 ACTTCTAAGGAGATGGTGGAAGG - Intergenic
943444153 2:187962657-187962679 AGGTATGAGGGGATGGTGGTGGG + Intergenic
944925426 2:204459093-204459115 ATGGGAGAGGAGAGGGTGGGAGG - Intergenic
945524761 2:210874463-210874485 CTGTGTTATCAGATGGTGGAAGG + Intergenic
945677571 2:212874252-212874274 ATGTGTGAGGAGCTTTTTGAAGG + Intergenic
946124899 2:217553935-217553957 ATGGGTGAGGAGATGGGGTGAGG - Intronic
946211390 2:218150108-218150130 ATGGGGGAAGAGATGGTGAAAGG - Intergenic
946431447 2:219628947-219628969 GAGTGGGAGGAGAGGGTGGATGG - Intronic
946547835 2:220765056-220765078 AAGAGTGAGGAAATGGAGGAAGG - Intergenic
946716035 2:222556328-222556350 AAGCGTGAGGGGATGGTGGAGGG + Intronic
947231533 2:227892623-227892645 CTGTGGGAGAAGATGGTAGAAGG + Intronic
947920462 2:233866915-233866937 CTTTGTAAGGAGATGGTGGATGG - Intergenic
948297582 2:236874112-236874134 ATCTATGAAGAGATGTTGGAAGG - Intergenic
948481238 2:238251842-238251864 ATGAGTGGGGTGAGGGTGGAGGG + Intronic
1168857642 20:1019879-1019901 ATAGGTGGGTAGATGGTGGATGG - Intergenic
1169625067 20:7557017-7557039 AAGAATGAGGAGATGTTGGATGG - Intergenic
1169968245 20:11240807-11240829 CTGTGTGAGGAGGTTGTGCAGGG - Intergenic
1170235705 20:14102711-14102733 ATGTTTGAGTAGGTGATGGATGG + Intronic
1170666816 20:18393845-18393867 TTGTGTGGGGAGTTGGGGGAGGG - Intronic
1172176191 20:32973178-32973200 ATGAGTGAGGAGTTGGTGGTTGG - Intergenic
1172301380 20:33852875-33852897 TTGTGCGAGGGGATGGGGGAAGG - Intronic
1172578298 20:36026570-36026592 AGGTGGCAGGAGATGCTGGAGGG - Intronic
1173285000 20:41662331-41662353 AAATGTGTGGAGAGGGTGGATGG + Intergenic
1175051945 20:56163943-56163965 CTGTGTCACCAGATGGTGGAGGG - Intergenic
1175089476 20:56489936-56489958 ATGTGTGGGAAGGTGGTGGTGGG + Intronic
1175375622 20:58521668-58521690 ATGGGTGTGGAGATGGAAGAGGG + Intergenic
1175578829 20:60082959-60082981 ATATGTAAGGAGATTATGGAAGG + Intergenic
1175770482 20:61620263-61620285 ATGGGTGGGTAGATGGTTGATGG + Intronic
1175817214 20:61889480-61889502 ATGAGTGAGTGGATGATGGATGG + Intronic
1175817265 20:61889780-61889802 ATGGGTGAGTGGATGGTGGATGG + Intronic
1175817331 20:61890124-61890146 ATGGGTGAGTGGATGGTGGATGG + Intronic
1175817374 20:61890368-61890390 ATGGGTAAGCAGATGGTGGATGG + Intronic
1175930304 20:62490683-62490705 AAGTGTGAGGGGTTGGGGGAGGG - Intergenic
1176057911 20:63158475-63158497 ATGGGTGAATAGATGGTGGGTGG + Intergenic
1176111658 20:63413706-63413728 CTGTGTGTGGAGCTGGTGGGCGG - Intronic
1176132893 20:63503729-63503751 CTGTGGGAGGCGATGGTGGGCGG - Intergenic
1176585649 21:8582294-8582316 ATTTGTGAGGCCAAGGTGGAAGG - Intergenic
1176678172 21:9800780-9800802 ATTTGTGTGGGGATGGTGGAAGG + Intergenic
1177914348 21:27069960-27069982 ATGTGAGATTAGATGATGGAAGG - Intergenic
1178016379 21:28351126-28351148 ATGCGGGAGGAGAGGGAGGAAGG - Intergenic
1178127471 21:29530597-29530619 ATGGGAGAGGAGAGGGTTGAAGG + Intronic
1178337715 21:31758633-31758655 ATCTGTGAGGTGATGGGGGCTGG - Intergenic
1178368630 21:32008817-32008839 ATGAATGAGTAGATGATGGATGG + Intronic
1178687559 21:34723414-34723436 ATGGGTAAGGAGCTGATGGAAGG + Intergenic
1178969396 21:37158445-37158467 ATGTTTGGGGTGAAGGTGGAAGG - Intronic
1179057568 21:37950169-37950191 ATGTGAGAGAATATGGGGGATGG - Intergenic
1180268458 22:10559193-10559215 ATTTGTGAGGCCAAGGTGGAAGG - Intergenic
1182772185 22:32803617-32803639 ATGTGGGTGGAGGTGGAGGAGGG - Intronic
1183066703 22:35368482-35368504 ATGGATGAGGAGAAGGTTGAGGG - Intergenic
1183245584 22:36690962-36690984 ATGGGAGAGGAGATAGGGGAAGG - Intronic
1183280315 22:36928802-36928824 AGGTGTGAGGAGATGGGGGTGGG - Intronic
1183398609 22:37587894-37587916 ATGGGTGAGGAGGTGGAGGGAGG + Intergenic
1184123708 22:42471705-42471727 ATGGGTGGGTGGATGGTGGATGG - Intergenic
1184291319 22:43499426-43499448 ATGTGGGAGGTGGTGGTGGTGGG + Intronic
1184414668 22:44345394-44345416 ATGAGTGAACAGATGGTAGATGG + Intergenic
1184414729 22:44345635-44345657 ATGGGTGAGTAGATGATGGGCGG + Intergenic
1184852342 22:47128055-47128077 ATGGGTGAGGGGAGGGGGGATGG - Intronic
1185018805 22:48361283-48361305 ATGGATGAGTAGATGATGGATGG + Intergenic
1185146233 22:49138287-49138309 ATGGATGAGTAGATGATGGATGG - Intergenic
1185193361 22:49452713-49452735 ATGGGTGGAGAGATGATGGATGG + Intronic
949777224 3:7646722-7646744 ATGTATGAGAAGTTGGAGGATGG + Intronic
950202938 3:11057607-11057629 ATGGGTGAGTGGATGGTGAATGG + Intergenic
950620306 3:14200261-14200283 ATGTGTCAGGAAATGGAGGGAGG + Exonic
951098548 3:18659773-18659795 ATTTGTGGGTAGAGGGTGGAAGG + Intergenic
952071068 3:29636478-29636500 ATGTGCGAGGGGAGGGTGGAAGG + Intronic
952331976 3:32371934-32371956 ATGTGTGAGCAGGTGGTGTCGGG + Intergenic
952523286 3:34184030-34184052 CTGGGAGAGGAGGTGGTGGAAGG - Intergenic
953320749 3:41969029-41969051 ATGTGTGTGTAGATGGTGCCTGG + Intergenic
954144396 3:48627222-48627244 ATGTGTGGGGACATGCAGGAGGG + Intronic
954667467 3:52264534-52264556 ATGTGTGAGGAGGTGGAGATGGG + Intronic
954673111 3:52301160-52301182 ATGTTTGTGGAGATGGTGGCAGG + Intergenic
955113875 3:55976980-55977002 CTGTGTGAGAACAAGGTGGAAGG - Intronic
955633130 3:60996212-60996234 GAGTGTGACGAGATGGTGGGAGG + Intronic
956126410 3:66015026-66015048 CTGGGTGAGGGGATGGTGGTGGG - Intronic
956206009 3:66755262-66755284 ATGGGTGAGGAAAGGGTGCAGGG - Intergenic
956806355 3:72817075-72817097 ATGTGTGTGGTGGTGGTGGTGGG - Intronic
957426126 3:80041394-80041416 ATGTGTGTGGGGTTGGTGGGGGG + Intergenic
958019100 3:87977081-87977103 ATATGTAAGGGGATGGTGGGAGG - Intergenic
958143103 3:89588739-89588761 ATGTGTGGTAAGGTGGTGGACGG + Intergenic
958642048 3:96816089-96816111 TTGTGTGAGGAGAAGGTTAAGGG + Intronic
959832646 3:110882507-110882529 TTGTGTGAGGAGAGGTTGTAAGG - Intergenic
959895898 3:111605589-111605611 ATCTCTGAGGAGGTGGAGGACGG - Intronic
959916643 3:111823870-111823892 ATGTGTGAGGAGATGGTGGAGGG + Intronic
959944556 3:112113040-112113062 ATGAGTGAGGAGTTGGTGCTGGG + Intronic
960231628 3:115234850-115234872 GTGTGAGAAGAGATGGTGGTAGG + Intergenic
960380695 3:116957337-116957359 ATGATTGAGTAGATGGTGGCAGG + Intronic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
960623595 3:119659610-119659632 ATGTGTGTGGTGATGGTAGAGGG + Intronic
960902044 3:122563605-122563627 ATGGGTGAGGGGATGAAGGAGGG - Intronic
961524440 3:127487647-127487669 AGGTGTGAGGGGAGGGTGGGGGG - Intergenic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
962181838 3:133214336-133214358 ATTTGTGAGGAGATTGAGAAAGG - Intronic
962202817 3:133414844-133414866 AGGTGTGAGTAGATGGAAGAGGG - Intronic
963447589 3:145434319-145434341 ATGTGTGTGGGGGTGGGGGAGGG + Intergenic
964261770 3:154847606-154847628 ATGAGGGAGGAGTTGGTGGAGGG + Intergenic
965778314 3:172256875-172256897 ATATGTGGGCAGATGGTGAAGGG + Intronic
965871401 3:173269534-173269556 ATGTGGAAGGGGATGGTTGAAGG + Intergenic
968665855 4:1822049-1822071 CAGTGAGAGGAGATGGTGCAAGG - Intronic
968707218 4:2085374-2085396 TTGAGTGACTAGATGGTGGATGG - Intronic
968865584 4:3209218-3209240 AGGTATGAGGAGATGGAGGGAGG - Intronic
968954041 4:3709125-3709147 ATGTGTGAGTGGATGGGTGAGGG - Intergenic
969254339 4:5992213-5992235 ATGAATGAAGAGATGATGGAGGG + Intergenic
969435435 4:7186533-7186555 ATTAGGGAAGAGATGGTGGAGGG - Intergenic
969640861 4:8397614-8397636 GCGTGCGAGGAGATAGTGGACGG - Intronic
970696477 4:18684273-18684295 ATTTGAGAGCAGATTGTGGATGG + Intergenic
971114655 4:23630749-23630771 GTGTGTGTGGTGGTGGTGGACGG - Intergenic
971523289 4:27582640-27582662 TGGTGTGAGGGGATGGAGGAGGG + Intergenic
972869459 4:43279347-43279369 GTGTGTGGGTAGATCGTGGATGG + Intergenic
973122455 4:46539188-46539210 ATATGAGAGAAGATGGTGGTGGG + Intergenic
973163449 4:47047912-47047934 AGGAGTGAGAAGATGCTGGAAGG + Intronic
975168253 4:71202400-71202422 ATATTTGAGGAGGTGGGGGAAGG - Intronic
975997876 4:80336865-80336887 AAGTGTGGGGAGCTGGTGGCAGG - Intronic
976460479 4:85305519-85305541 ATATGTGAGGTGCTGGTAGATGG - Intergenic
977065225 4:92305283-92305305 ATGTGAGAAGAGAGGGTGGCTGG - Intronic
977901973 4:102432882-102432904 ATGTGTGAGGAGAGGGTTATTGG - Intergenic
979309358 4:119184056-119184078 CTTTGGGAGGAGAAGGTGGATGG - Intronic
980538187 4:134158131-134158153 ATTTGTAGGGAGATGGGGGAGGG - Intergenic
980668268 4:135969074-135969096 ATGTGTGTGGACATGGAGTATGG - Intergenic
982786306 4:159540791-159540813 CTATGTGAGCAGGTGGTGGAAGG + Intergenic
983344872 4:166515531-166515553 ATGTGTGAGGAGAAGGATGATGG - Intergenic
985125889 4:186693942-186693964 AAGAGTGGGGAGATGGTGGTTGG - Intronic
985397351 4:189558016-189558038 ATTTGGGTGGGGATGGTGGAAGG - Intergenic
985468968 5:25319-25341 ATGTGAGATGAGCTGGTGGCAGG + Intergenic
985529613 5:426294-426316 ATGGATGAGAAGATGATGGATGG + Intronic
985837272 5:2280621-2280643 ATGGGTGGGTAGGTGGTGGATGG + Intergenic
986178800 5:5374329-5374351 ATGTGAGAGGAGAAAGGGGATGG + Intergenic
986806301 5:11311764-11311786 GTGTGTGAGGTGAGGGTGCATGG - Intronic
987201387 5:15581352-15581374 AGGGGTGGGGAGATGGAGGATGG - Intronic
987224957 5:15830788-15830810 AAGGGAGAGAAGATGGTGGAGGG + Intronic
987831540 5:23102103-23102125 GGGTGTGAGAAAATGGTGGAAGG - Intergenic
987875878 5:23680656-23680678 GTGTTTTAGGAGATGGAGGAGGG + Intergenic
989384957 5:40845932-40845954 ATCTGTGATGAGGTGGTTGAAGG + Intronic
989651735 5:43697712-43697734 ATGTGGATGGTGATGGTGGAAGG + Intronic
990491520 5:56307656-56307678 ATGTGTTAGGACTTGGTGGTAGG + Intergenic
990742953 5:58930884-58930906 ATTTGACAGAAGATGGTGGATGG + Intergenic
990823514 5:59871052-59871074 ATCTGGGAGGAGATAGTGTAAGG - Intronic
990976311 5:61564696-61564718 ATGTGAGAGGGGATGATGCAAGG + Intergenic
993363344 5:87004528-87004550 ATCTGCCAGGAGATGGTGGCAGG - Intergenic
995376625 5:111481391-111481413 ATCTGAGAGGACATGGAGGAAGG - Intronic
995518105 5:112974246-112974268 GTGTGTGAGGAGGCAGTGGAGGG + Intergenic
995994121 5:118279037-118279059 ATCTTTGAGGAGATGGGAGAGGG - Intergenic
996090892 5:119350821-119350843 ATGAGTGTGGAGATGAGGGAAGG - Intronic
997747862 5:136315406-136315428 AGGTGGGAAGGGATGGTGGAGGG + Intronic
997879286 5:137574954-137574976 ATGTGTGGTGGGATGGTAGAGGG - Intronic
998153500 5:139770717-139770739 ATGTGTGAGGAGGGGCTGAAAGG - Intergenic
998350118 5:141494921-141494943 ACGTGGGAGGAGATGGGGGAGGG + Intronic
998416741 5:141951710-141951732 TTGTGTGATCAGATGGGGGATGG + Intronic
998519963 5:142791326-142791348 ATGGGAGAGGAGATGGAGGCTGG - Intronic
999128051 5:149261181-149261203 TTGTGTGAGGACATGGTGCCTGG - Intergenic
999241133 5:150128058-150128080 ATGTGTGATGAGCGGGAGGAGGG - Intronic
999409323 5:151336684-151336706 ATGTGTGGGGGGGTGGGGGACGG - Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999531650 5:152469605-152469627 AAGTGTGGAGAGAGGGTGGAAGG + Intergenic
999673379 5:153976454-153976476 AAGAGTGAGGAGAGGGAGGATGG - Intergenic
1001043172 5:168351534-168351556 ATGAGTTAGGATATGATGGAAGG + Intronic
1001046292 5:168374553-168374575 ATGAGTGAGGAGAGGGGAGAAGG + Intronic
1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG + Intronic
1001517056 5:172363288-172363310 ATGGGTGATGAGATGGTTGATGG - Intronic
1001663463 5:173413474-173413496 CTGGGTGAGGGGATGGTGGGGGG + Intergenic
1003064864 6:2895257-2895279 GTGGGTGAGGAGAGGGAGGAGGG + Intronic
1003349241 6:5300570-5300592 GTCTGTGTGGAGATGGTGGGTGG + Intronic
1003513458 6:6800380-6800402 ATGAGTGTGGATAGGGTGGAGGG - Intergenic
1003793177 6:9570097-9570119 ATGAGAGAAAAGATGGTGGAGGG - Intergenic
1003794303 6:9582614-9582636 ATGTGTCTGCAAATGGTGGATGG + Intergenic
1003843434 6:10147024-10147046 GAGTGGGAGGAGATGGGGGATGG - Intronic
1004797624 6:19105472-19105494 ATGTGTGTGGAAATTGTGAATGG - Intergenic
1007133166 6:39495831-39495853 ATGGGGGAGGGGATGGAGGAGGG + Intronic
1007246748 6:40468776-40468798 ATGCATGAGGAGATGGGGTAAGG - Intronic
1007373955 6:41443757-41443779 GTGTGCGAGGGGATGGGGGAAGG + Intergenic
1007720567 6:43882796-43882818 CTGAGTGAGGAGAGGGTGGCAGG - Intergenic
1007727981 6:43928320-43928342 AGGTGTGAGGAGGTGGTGATGGG - Intergenic
1008927562 6:56902913-56902935 GTGTGTGTGTAGAGGGTGGAGGG - Intronic
1009648287 6:66438308-66438330 CCTGGTGAGGAGATGGTGGAGGG + Intergenic
1009732695 6:67630478-67630500 ATGTGGGAGGAGGTAGTGAATGG - Intergenic
1010712582 6:79192516-79192538 ATGTCTGAGCAGAAGGTTGATGG - Intergenic
1011231608 6:85167959-85167981 ATGAGTGAGGAGATGAAGGGAGG - Intergenic
1011369578 6:86620338-86620360 ATGTGTGTGGTGGTGGTGGGAGG - Intergenic
1011371428 6:86640986-86641008 ATGTGTGCTGGGAAGGTGGAGGG + Intergenic
1011555968 6:88571859-88571881 ATGTATGTGAAGATGATGGAAGG + Intergenic
1011870971 6:91892221-91892243 ATGTTTAAGGGGATTGTGGAGGG - Intergenic
1011990776 6:93514730-93514752 ATGTGGGTGTAGATGCTGGAAGG - Intergenic
1013170895 6:107635368-107635390 ATGGGCGAGGAGATGATGCACGG - Exonic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013604229 6:111732963-111732985 CTTTGGGAGGAGATGGGGGAGGG + Intronic
1013837115 6:114345707-114345729 ATTTGGGAGGAGAAGGTGGAAGG + Intergenic
1014601266 6:123416316-123416338 ATGAGTGAGGAGCAGGTGGTAGG - Intronic
1015145250 6:129977947-129977969 ATTTTGGGGGAGATGGTGGAGGG + Intergenic
1015464432 6:133533071-133533093 TAGTGTGATGAGATGGTGAAAGG - Intergenic
1015991206 6:138945315-138945337 ATGTGTGTGGAGAAGTTGGTGGG + Exonic
1017301619 6:152867593-152867615 GTATGTGAGGTGAGGGTGGATGG - Intergenic
1017557121 6:155583486-155583508 ATGGGGGAGGAGGTGCTGGATGG + Intergenic
1018287719 6:162258413-162258435 ATCTGTCAGGAGATGATGAATGG + Intronic
1019351057 7:554130-554152 ATGTGGGGGCAGATGGCGGAGGG + Intronic
1019436017 7:1022556-1022578 CCGTGGGAGGAGGTGGTGGAGGG - Intronic
1019659383 7:2215566-2215588 CTGGGTGTGGAGATGGAGGACGG - Intronic
1019704687 7:2491876-2491898 ATGTGTGGGTGGATGATGGATGG - Intergenic
1019704694 7:2491915-2491937 ATGTGTGGGTGGATGATGGATGG - Intergenic
1020372660 7:7451039-7451061 ATGTGTGAGGAGAGAAGGGAGGG + Intronic
1020790492 7:12621546-12621568 ATATGTGAGGAGATCTTTGATGG + Intronic
1021509486 7:21420151-21420173 ATGGGTGGGGTTATGGTGGAGGG + Intergenic
1021606710 7:22415551-22415573 ACGTGGTAGGAGATGGTGAAAGG - Intergenic
1022306037 7:29147329-29147351 AGCTGTGAGGAGATGGAGGTTGG - Intronic
1022945381 7:35278861-35278883 ATGTGTGTGGAGATGGATGCAGG + Intergenic
1022989198 7:35691463-35691485 ATGGGTCAGGAGTAGGTGGAGGG - Intronic
1023460641 7:40392693-40392715 ATGGGTGAGGAGATGGTTTTAGG + Intronic
1023907329 7:44531886-44531908 ATTTGTGGGGAGATGGGGGACGG - Intronic
1024944957 7:54799192-54799214 CTGTGTGAGGAGACGCAGGATGG - Intergenic
1026677748 7:72442164-72442186 AGGTGAGAGGTGATGGTGGCTGG - Intronic
1026774128 7:73220714-73220736 CTATGTGAGTAGCTGGTGGAGGG + Intergenic
1027014985 7:74774100-74774122 CTATGTGAGTAGCTGGTGGAGGG + Exonic
1027073046 7:75171853-75171875 CTATGTGAGTAGCTGGTGGAGGG - Intergenic
1027523847 7:79243192-79243214 ATGTGTGAGCTGATGCTGTATGG - Intronic
1027724678 7:81789104-81789126 CTGTGTGCTGACATGGTGGATGG - Intergenic
1027987884 7:85318128-85318150 ATGTAGGTGGATATGGTGGAAGG + Intergenic
1028538169 7:91912484-91912506 ATGAGAGAGGAGATGGTATAAGG + Intergenic
1029200712 7:98837384-98837406 CTGTGTGGGGAGAGGGTGGCTGG + Intergenic
1030547562 7:110916607-110916629 ATCTGTGTGGGGATGGAGGAAGG - Intronic
1031571141 7:123361658-123361680 ATATGTGGGGAGGTGGTGGTAGG + Intergenic
1031976890 7:128099753-128099775 ATGTGTTAGGACAGGCTGGAGGG - Intergenic
1032079875 7:128853519-128853541 AACTGTGAGGACATGGAGGACGG + Exonic
1032464841 7:132137700-132137722 ATGGGTGGGGAGATGGTGGGAGG + Intronic
1032534813 7:132653968-132653990 CTGCCTGAGAAGATGGTGGAAGG + Intronic
1032537644 7:132678103-132678125 ATGAGTGGGGAGGTGGAGGAAGG - Intronic
1032702396 7:134393993-134394015 ATGTCAGAGGAAATGGTGGTTGG - Intergenic
1033180561 7:139173609-139173631 CTTTTTAAGGAGATGGTGGATGG - Intronic
1034488049 7:151378560-151378582 TTTTGTGAGGAGATGATGGAAGG + Intronic
1034904618 7:154933247-154933269 ATGTGTGAACTGATGGTGGAGGG - Intronic
1034970985 7:155418959-155418981 CTCTGTGAGGAGGTGGAGGAAGG + Intergenic
1035109661 7:156470681-156470703 AAGTGTGGGGAGATGAGGGAGGG - Intergenic
1036702032 8:11019296-11019318 ATGAGTGAGGAGACTGTGAATGG + Intronic
1037483782 8:19328696-19328718 ATTTCTGAGCAGATGGTGCAAGG - Intronic
1037671238 8:21016980-21017002 AGGTGTCAGGAGAGGGTTGACGG + Intergenic
1037735730 8:21564426-21564448 AAGTGTGGGGAGATGGGGGTAGG - Intergenic
1037881726 8:22576797-22576819 AGGTGTGAAGAGGTGGTGGCTGG + Intergenic
1039103896 8:33970066-33970088 TTGCCTGAGGAGAGGGTGGATGG + Intergenic
1039563184 8:38529394-38529416 AGCAGCGAGGAGATGGTGGAGGG + Intergenic
1039677534 8:39685788-39685810 ATATGTTAGCAGATGGTGGAGGG - Intronic
1040817182 8:51520534-51520556 AGGTGGGAGGACATGGTGGGTGG - Intronic
1042192266 8:66198916-66198938 ATGTGTGAGGTGGGGGTGGGTGG - Intergenic
1042253717 8:66781938-66781960 ATGTGTGAGGGGAGGGGAGAAGG + Intronic
1042313911 8:67405517-67405539 ATCTTGGAGGACATGGTGGATGG + Intergenic
1043488195 8:80719727-80719749 ATGTGTTAGGAGCTGAGGGATGG + Intronic
1043516170 8:80996792-80996814 TTGAGTGAGGGGAAGGTGGAGGG + Intronic
1043593362 8:81855611-81855633 CAGTATGAGGACATGGTGGAGGG - Intergenic
1044188094 8:89280734-89280756 GTGTTTTAGGAGATGGAGGAGGG - Intergenic
1044774006 8:95668918-95668940 ATGTCCCAGGAGATGTTGGAAGG - Intergenic
1045145664 8:99341088-99341110 CTTTGTAAGGAGATGGTGGATGG - Intronic
1045723293 8:105139674-105139696 ATGTGTGTGGGGAGGGTGGTGGG + Intronic
1045768887 8:105710449-105710471 ATTTGTAAGCAGATGGTGAAAGG + Intronic
1046238078 8:111453388-111453410 ATCTGTGAGGAGATGGACGCAGG + Intergenic
1046705405 8:117444456-117444478 TTGTGTTTGGAGAAGGTGGAAGG + Intergenic
1047462894 8:125085733-125085755 AGGGGTGAGCAGATGGTAGAAGG + Intronic
1047683308 8:127277200-127277222 GTGTGTGTTGAGATGGTGGGGGG + Intergenic
1047844761 8:128793984-128794006 CTGTGTCATGATATGGTGGAGGG - Intergenic
1048205618 8:132412934-132412956 ATGTGTTGGGAGGTGGTGGATGG - Intronic
1048402221 8:134082840-134082862 AGCTGTGAGGAGATGGTGAGAGG - Intergenic
1048693560 8:136996321-136996343 GTGTGTGCGGAGGTGGGGGATGG - Intergenic
1048736953 8:137512766-137512788 ATGGGAGAGGATATGGTGGATGG + Intergenic
1049350675 8:142162877-142162899 AAGAGAGAGGAGATGGAGGATGG + Intergenic
1049364217 8:142228927-142228949 ATGTGTGAACAGATTGTGGATGG + Intronic
1049474729 8:142791489-142791511 ATGAGTGGGCAGATGGTAGATGG - Intergenic
1050290525 9:4149412-4149434 ATGTGGGAGGTGATGGTTAAGGG - Intronic
1051634460 9:19169148-19169170 GTGTGTTATGAGCTGGTGGAAGG - Intergenic
1052048365 9:23820984-23821006 TTGTGTGCGGAGGTGGTGTAGGG - Intronic
1053008749 9:34621566-34621588 AGGGGTGAGGAGATGGTAGAGGG + Intronic
1053442808 9:38129901-38129923 ATGAGTGTAGTGATGGTGGAGGG + Intergenic
1054810932 9:69433302-69433324 GTGTGTGAGGTAAGGGTGGAGGG - Intronic
1055535989 9:77245021-77245043 ATGAGTGAGGGGAGAGTGGAGGG + Intronic
1056955230 9:91075834-91075856 ATCTCTGAGAAGATGGTGGTGGG - Intergenic
1057706080 9:97396080-97396102 ATCAGTGAGGAGCTGGTTGATGG - Intergenic
1058013802 9:100007500-100007522 ATGGGAGAGGAGATGATGAAAGG + Intronic
1059040790 9:110813609-110813631 ATTTGTGATGAGCAGGTGGAAGG - Intergenic
1059542479 9:115144251-115144273 AGGAGAGAGGAGAAGGTGGAAGG - Intronic
1060250897 9:121986196-121986218 AGCTGTGGGGAGCTGGTGGAGGG - Intronic
1060733235 9:126050782-126050804 AGGGGTGTGGAGATGGAGGACGG + Intergenic
1060827031 9:126693423-126693445 ATGTGCGGAGAGATGGAGGATGG - Intronic
1060864401 9:126983687-126983709 ATGAGGGAGGAGAGGGAGGATGG - Intronic
1061355065 9:130098375-130098397 ATGTGTGAGGAGAAAGTGCCAGG - Intronic
1061528935 9:131194634-131194656 AGGAGAGAGGAGATGGTGAAAGG + Intronic
1062092378 9:134685208-134685230 ATGGGTGAATGGATGGTGGATGG - Intronic
1062092411 9:134685356-134685378 ATGGGTGAATGGATGGTGGATGG - Intronic
1062159723 9:135073689-135073711 CTCTGTGAGGAGATGGTGCTGGG - Intergenic
1062247967 9:135579329-135579351 ATGGGTGGATAGATGGTGGATGG - Intergenic
1203615551 Un_KI270749v1:59818-59840 ATTTGTGAGGCCAAGGTGGAAGG - Intergenic
1203663322 Un_KI270754v1:3272-3294 ATTTGGGTGGGGATGGTGGAAGG + Intergenic
1185762156 X:2696839-2696861 AGTTTTGAGGAGATGGTGCATGG + Intronic
1186181656 X:6979307-6979329 ATGTGTGTGGAGGAGGTGGTGGG - Intergenic
1186670573 X:11763787-11763809 CTTTGTAAGGAGATGGTGGATGG + Exonic
1186796369 X:13050474-13050496 ATGAGAGAGGAGATGGTCAATGG + Intergenic
1186811736 X:13197017-13197039 AATTGTGAGGATATGGTGTAAGG - Intergenic
1187279916 X:17850353-17850375 ATGGCTGAGGAGAGGGTGAAGGG + Intronic
1188450718 X:30306259-30306281 TTGGGTGGGGAGAAGGTGGAGGG - Intronic
1188736858 X:33727396-33727418 GTGTGTGGGGAGGTGGGGGAGGG - Intergenic
1188976651 X:36683541-36683563 CTGAGTGAGCAGATGGTGGAAGG - Intergenic
1188985107 X:36762120-36762142 ATGTGTGTGGAGGTGGGGGTAGG - Intergenic
1189280914 X:39819711-39819733 ATTTGTGAGGTGATAGTGCAGGG - Intergenic
1189351159 X:40276826-40276848 ATGTGTGAGGACATGGTGGAAGG - Intergenic
1189378079 X:40481213-40481235 ATTTGTGGGAAGATGGAGGAAGG - Intergenic
1189753074 X:44242753-44242775 CAGTAGGAGGAGATGGTGGATGG - Intronic
1190024973 X:46913697-46913719 ATTTGTGAGGAGGGGGTGGCGGG + Intronic
1190404016 X:50068232-50068254 GTGTGTGTGGAGGTGGGGGAGGG - Intronic
1190447189 X:50537996-50538018 AGGGGTGTGGAGATGGGGGATGG - Intergenic
1191898051 X:66014331-66014353 AGGTGTGAAAAGAAGGTGGATGG - Intergenic
1192423481 X:71054420-71054442 GTGTGTGTAGAGATGGGGGAGGG - Intergenic
1192550868 X:72052555-72052577 ATGAGGGAGGAGATGGAGTAAGG + Intergenic
1193095504 X:77544005-77544027 ATGTGTTATGAGATGGTGTTAGG + Intronic
1195034187 X:100956197-100956219 ATGTGGGAGGAGGTGGGGGGAGG + Intergenic
1196624518 X:117863182-117863204 ATGTGTGGGGGGGTGGTGGGAGG - Intergenic
1196805676 X:119583402-119583424 ATGTTTAAGGAGAGGGTAGAAGG - Exonic
1197842970 X:130769699-130769721 GTGTGTCAGGTGATGTTGGATGG - Intronic
1197954870 X:131935287-131935309 ATCTGTGAAGTAATGGTGGAAGG - Intergenic
1198108291 X:133481377-133481399 GTGATTGAGAAGATGGTGGATGG + Intergenic
1199769471 X:150965215-150965237 ATGTGTGTGCAGTTGGTGGGTGG + Intergenic
1199860253 X:151795014-151795036 ATCTGTTAGGAGATGGGAGAAGG - Intergenic
1200807573 Y:7448036-7448058 ATGTGTGAGATAATCGTGGAAGG - Intergenic
1201382686 Y:13401186-13401208 CTGTGTCAGAACATGGTGGAAGG - Intronic