ID: 959918131

View in Genome Browser
Species Human (GRCh38)
Location 3:111841328-111841350
Sequence ATTGAGTAGGAGTAGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 732
Summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 669}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959918131 Original CRISPR ATTGAGTAGGAGTAGGAGGA GGG Intronic
900129188 1:1080422-1080444 ACTGGGTGGGAGGAGGAGGAGGG + Intergenic
900665127 1:3810108-3810130 ATTGGGTAGCAGGAGGAGGGAGG - Intergenic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
901842621 1:11963706-11963728 GATGAGGAGGAGGAGGAGGAAGG - Intronic
902568214 1:17329581-17329603 GTTGAGTAGGCTGAGGAGGAAGG + Intronic
902614909 1:17618489-17618511 ACAGAGGAGGAGGAGGAGGAGGG - Intronic
903187450 1:21636849-21636871 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
903729249 1:25478465-25478487 ATTGGGTAGGATTAGGGAGAAGG + Intronic
904037482 1:27566679-27566701 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
905119763 1:35672674-35672696 GGTGGGTGGGAGTAGGAGGAGGG - Intergenic
905323643 1:37134782-37134804 ATTGAGAAGGTGTGGGAGGAGGG + Intergenic
905508855 1:38502735-38502757 ATAGAGGAGGAGGGGGAGGAAGG - Intergenic
905741493 1:40374642-40374664 AATGACGAGGAGGAGGAGGAGGG + Intronic
906559150 1:46742223-46742245 ATTGTGGAGGAGCAGGAGGATGG + Intergenic
907228154 1:52969053-52969075 GTTGAGTAGGCTGAGGAGGAAGG + Intronic
907476955 1:54712270-54712292 ATTGATTAGGGTAAGGAGGAGGG + Intronic
907722575 1:56985829-56985851 AGTGAGTTGGAGGAGGAAGAAGG - Intergenic
908353157 1:63306225-63306247 AATAAGGAGGAGAAGGAGGAAGG + Intergenic
908675212 1:66595911-66595933 TTTGAGGAGGGGGAGGAGGAAGG + Intronic
909009458 1:70318330-70318352 CTTCAGTCGGAGAAGGAGGAAGG - Intronic
909098894 1:71325151-71325173 CTTGAGTAGGAGAAGGAAGCTGG - Intergenic
910040110 1:82840393-82840415 ATTGGGTAGGACTGTGAGGAGGG - Intergenic
910548469 1:88448194-88448216 TTTGCCTAGGAGTAGGATGATGG + Intergenic
910760713 1:90728792-90728814 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
910857870 1:91714087-91714109 AGTGAGTAGGAGAAGGACTACGG + Intronic
911323566 1:96443181-96443203 AATGAGGAGGAGGAGGAGGAGGG - Intergenic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
912259143 1:108092051-108092073 AAAGAGGAGGAGAAGGAGGAAGG - Intergenic
912454297 1:109787499-109787521 TTTGTCTAGGAGGAGGAGGAGGG - Intergenic
912993435 1:114510928-114510950 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
913507627 1:119532861-119532883 ACTGAGTAGGAGTCGGTGGCCGG - Intergenic
913653960 1:120943993-120944015 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
914644153 1:149638161-149638183 AAAGAGAAGGAGGAGGAGGAAGG - Intergenic
916176756 1:162046647-162046669 ATTGTGTAAGAGTAAGATGAGGG + Intergenic
916239794 1:162627766-162627788 ATTGAGTACAATTAGCAGGAGGG - Intergenic
916332076 1:163628341-163628363 ATGGAGGGGGAGGAGGAGGAGGG - Intergenic
916506815 1:165435695-165435717 AATGACTAGGAGTGGGAGGCAGG + Intronic
916862707 1:168823762-168823784 ATTAGGCTGGAGTAGGAGGAAGG + Intergenic
916924869 1:169507555-169507577 ATTGAGGAGGAGGATGGGGAAGG + Intergenic
917000327 1:170350828-170350850 ATTAAAAAGGAGGAGGAGGAGGG + Intergenic
918688063 1:187444497-187444519 ATTGAGTAGTAGTTGGAAGCAGG + Intergenic
919367132 1:196675818-196675840 AAGGAGGAGGAGAAGGAGGAAGG + Intronic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919449341 1:197751886-197751908 AGGGAGGAGGAGGAGGAGGAGGG + Intronic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919632830 1:199975629-199975651 ATAGAGGAGGAGTTAGAGGAAGG + Intergenic
919990363 1:202705008-202705030 GTTGAGTAGAAGCAGGAGGCTGG - Intronic
920084927 1:203408523-203408545 TGGGAGTAGTAGTAGGAGGAGGG + Intergenic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
920646496 1:207807749-207807771 AGTGAGTAGCAGGAGGAGGAAGG + Intergenic
920756216 1:208736436-208736458 ATTTAGAAGGAGTAGGAAGAAGG + Intergenic
921350710 1:214231501-214231523 ATTAATTAGGAGAAGGAGCAGGG - Intergenic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921444397 1:215227877-215227899 ATTCAGTAAGAGGAGGAGCAAGG + Intronic
921472586 1:215567284-215567306 AATGAGGAGGAGGAGGAGGAAGG - Intergenic
921500885 1:215901540-215901562 ATTGAGTAAGGGCAGGAGAAGGG - Intronic
921887521 1:220321621-220321643 ATGGAGGAGGAAGAGGAGGAAGG + Intergenic
922030955 1:221797667-221797689 ATGGAGTGGGAGAAAGAGGAAGG + Intergenic
922376607 1:224974718-224974740 AGAGAGTAGGAATAAGAGGAAGG - Intronic
922722606 1:227906413-227906435 AGGGAGTAGGAGGAGGAGGGAGG - Intergenic
922960660 1:229643128-229643150 GTTGAGGAGGAGGAAGAGGAGGG + Intronic
923135998 1:231119759-231119781 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
923470305 1:234284395-234284417 CATGAGCAGGAGTAGGTGGAGGG - Intronic
923852520 1:237813011-237813033 AATGAATAGGCGTGGGAGGAGGG - Intronic
924481176 1:244435656-244435678 ATGGAGGAGGAAGAGGAGGATGG - Intronic
1063443164 10:6089446-6089468 CATGAGGAGGAGGAGGAGGAAGG - Exonic
1063662757 10:8045289-8045311 AGTGAGCAGGAGAAGGCGGAGGG + Intergenic
1063943234 10:11152121-11152143 CTTGGGTAGGAGTAAGTGGATGG + Intronic
1064315726 10:14254198-14254220 CTGGAGTTGAAGTAGGAGGAAGG - Intronic
1065188249 10:23189613-23189635 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
1066017335 10:31260916-31260938 AAGGAGAAGGAGTAGTAGGAGGG - Intergenic
1066428736 10:35333141-35333163 CTTGAGGAGGATTAGGAAGATGG - Intronic
1066529028 10:36316119-36316141 ATTGAGGAGAATAAGGAGGAGGG - Intergenic
1066551393 10:36561609-36561631 ATTCTGTGGGAGTAGTAGGATGG + Intergenic
1067031661 10:42882192-42882214 GCTGAGGAGGAGGAGGAGGAAGG + Intergenic
1067572131 10:47379435-47379457 AATAAGAAGGAGCAGGAGGATGG + Intronic
1068588471 10:58827885-58827907 GTTGAGAAGGAGGAGGAGAAGGG - Intronic
1068646009 10:59469129-59469151 ATTGGGTGGGAGTAGGAGGAAGG + Intergenic
1069026161 10:63544486-63544508 ATTGGGTGTGAGGAGGAGGAAGG + Intronic
1069061481 10:63899344-63899366 TTGGGGTAGGAGGAGGAGGAGGG - Intergenic
1069298473 10:66877101-66877123 ATGAAGTAGGAGTGAGAGGAGGG - Intronic
1070634660 10:78115330-78115352 TGGGAGTAGGAGTAGGAGTAGGG + Intergenic
1071304538 10:84286830-84286852 ATGGAGTAGGGGTGGGAGGAAGG + Intergenic
1071501135 10:86204981-86205003 ACTGAGCAGGAGTGGGAGGGTGG + Intronic
1071851237 10:89572574-89572596 ACTGAATAGCAGTAGGAGGAAGG + Intergenic
1073037856 10:100576614-100576636 GTTGAGGAGGAGGAGGATGAAGG - Intergenic
1073214075 10:101827045-101827067 CTAGAGTAGGGGTAGGAGGTGGG + Intronic
1074427552 10:113365442-113365464 ATTGGAGAGAAGTAGGAGGAGGG - Intergenic
1074765568 10:116697448-116697470 ATAGAGGAGGAGGGGGAGGAGGG + Intronic
1075213147 10:120508766-120508788 TTTGAGTAGCAGGAGGAGGTTGG - Intronic
1075358073 10:121801821-121801843 CTCTAGCAGGAGTAGGAGGATGG - Intronic
1075962614 10:126582290-126582312 ATTGAGAAGGAGTTGGGGCAGGG - Intronic
1076752867 10:132552437-132552459 ATTGAGTAGGATAGGGAGGGAGG + Intronic
1076752890 10:132552551-132552573 ATTGAGTAGGATAGGGAGGGAGG + Intronic
1076752912 10:132552665-132552687 ATTGAGTAGGATAGGGAGGGAGG + Intronic
1076752951 10:132552836-132552858 ATTGAGTAGGACAGGGAGGGAGG + Intronic
1076753001 10:132553066-132553088 ATTGAGTAGGACAGGGAGGGAGG + Intronic
1076753076 10:132553408-132553430 ATTGAGTAGGATAGGGAGGGAGG + Intronic
1076753087 10:132553465-132553487 ATTGAGTAGGATAGGGAGGGAGG + Intronic
1076753121 10:132553642-132553664 ATTGAGTAGGATAGGGAGGGAGG + Intronic
1076753144 10:132553760-132553782 ATTGAGTAGGATAGGGAGGGAGG + Intronic
1076753204 10:132554045-132554067 ATTGAGTAGGACAGGGAGGGAGG + Intronic
1078075258 11:8153552-8153574 ATTGAGAAGGAATAGGTTGAAGG - Intronic
1078972675 11:16432127-16432149 AGTTAGTAGGAGTAGAAGGATGG - Intronic
1079985908 11:27200751-27200773 AAGGAGTAGGAGTAGGAGTAAGG - Intergenic
1080002243 11:27363091-27363113 ACTGAGCAGGAGTCCGAGGAGGG + Exonic
1080031990 11:27671156-27671178 ATGGAGTAGGGGTAGGGGGGAGG + Intronic
1080561668 11:33469199-33469221 ATTGCGTAGGACTGGGAGGAAGG - Intergenic
1081371934 11:42314760-42314782 GTTGAGTACGATGAGGAGGAGGG + Intergenic
1082892418 11:58154159-58154181 AAGGAGGAGGAGAAGGAGGAGGG + Intronic
1082968563 11:58994341-58994363 AGTGAGAAAGAGTAGGAGAAAGG - Intronic
1083431112 11:62613890-62613912 AGGGAGGAGGAGGAGGAGGAAGG - Intronic
1083489201 11:63002648-63002670 GTGGAGTAGGAGAGGGAGGAAGG - Intronic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084717292 11:70882162-70882184 ATGGAGGAGGAGGAGGAGGGAGG + Intronic
1085700204 11:78739187-78739209 ATAGAGTAAGAGTGGGAGGAGGG - Intronic
1085729481 11:78984007-78984029 AGTGAGGAGGAGTGGGAGGCAGG + Intronic
1086308110 11:85503935-85503957 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1086401021 11:86460988-86461010 ATTCTGTAGGAGTTAGAGGAAGG + Intronic
1086748646 11:90462331-90462353 ACTGGGTAGTCGTAGGAGGATGG + Intergenic
1088224318 11:107603010-107603032 GTTGAGTGGGAGAAGAAGGATGG + Intronic
1088297910 11:108321024-108321046 GTTGAGTAGGATAAGGAGGAAGG + Intronic
1088531917 11:110819651-110819673 TTTGGGTAGGGGAAGGAGGAGGG + Intergenic
1088672182 11:112153023-112153045 GTAGAGTAGGAGTAGGAGACTGG - Intronic
1089837425 11:121383422-121383444 ATTGGGTAGTAGTGGGAGAAAGG - Intergenic
1089933598 11:122340130-122340152 AAAGAGAAGGAGGAGGAGGATGG + Intergenic
1090408629 11:126492537-126492559 AGTGGGAAGGAGGAGGAGGAGGG + Intronic
1090490132 11:127153316-127153338 ATTGTGTAGGAGAAGGAGTGGGG + Intergenic
1090620185 11:128553695-128553717 GCTGAGGAGGAGGAGGAGGAGGG - Intronic
1090661936 11:128888725-128888747 ACTGAGTAGGTGTAGGTGTAGGG + Intergenic
1090748635 11:129727218-129727240 ATGGAGAAGGAATCGGAGGAAGG + Intergenic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092139259 12:6171613-6171635 GTTGAGGAGGAGGAGGAGGAAGG + Intergenic
1092910939 12:13144480-13144502 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
1093206822 12:16261223-16261245 AATGAGAAGGGGTAAGAGGAAGG - Intronic
1093241794 12:16685973-16685995 ATTGAGGAAGGGAAGGAGGAGGG - Intergenic
1093363781 12:18266826-18266848 AATGAGGAGGAGGAGGAAGAAGG - Intronic
1093601412 12:21028919-21028941 ATTGAGTAGGTGGAGGAGGGAGG - Intronic
1093775328 12:23067138-23067160 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1093869230 12:24266916-24266938 GGTGAATAGAAGTAGGAGGAGGG - Intergenic
1094042697 12:26134280-26134302 GTTGAGTAGGAGGAAGAGAAGGG - Intronic
1094088138 12:26616818-26616840 ATTCAGGAGGAGGAGGAAGAGGG - Intronic
1095297120 12:40539718-40539740 ATTGGGTGGGAGGAGGGGGAAGG - Intronic
1095509252 12:42932002-42932024 AGAGAGGAGGAGTAGGAGAAAGG + Intergenic
1095578448 12:43766356-43766378 ATTTGGTTGGAGTAGGAGGTTGG - Intronic
1095651776 12:44619647-44619669 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1096156577 12:49344823-49344845 CTGGAGTAGGAGAAGGAGGAGGG + Intergenic
1096359114 12:50968129-50968151 AATGAGGAGGAGGAGGAGAAGGG + Intronic
1096524221 12:52201034-52201056 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1096595017 12:52689490-52689512 AGGGAGTAGGGGGAGGAGGAGGG + Intergenic
1096682164 12:53263188-53263210 AATGAGGAGGAGGAAGAGGAAGG + Intergenic
1096710505 12:53452221-53452243 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
1097098755 12:56571252-56571274 ATGGAGGAAGAGCAGGAGGAGGG - Intronic
1098652422 12:72990106-72990128 CTAGAACAGGAGTAGGAGGAAGG - Intergenic
1098860163 12:75700325-75700347 GAGGAGGAGGAGTAGGAGGAGGG + Intergenic
1098894979 12:76048813-76048835 ACTGAGTAAGAGTAGTTGGAAGG + Intronic
1099451231 12:82809665-82809687 ATTGAGTACGTGTTGGAGGCAGG + Intronic
1099788971 12:87305802-87305824 ATGGAGTGAGAGTAGGAGGGTGG + Intergenic
1100201240 12:92299896-92299918 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1100559885 12:95737580-95737602 AGTGAGCAGGAGTGAGAGGATGG - Intronic
1100806956 12:98295555-98295577 ATTGTGTAGGGGTAAGAGGCAGG - Intergenic
1100864499 12:98842412-98842434 CTGGAGTAGGAATAGGAGCAGGG + Intronic
1101541627 12:105670780-105670802 ATGGAGTATGAGAAGGAGGTAGG - Intergenic
1102230355 12:111257588-111257610 AGTGAGGAGGAGAAGGAGGAGGG - Intronic
1102425980 12:112844802-112844824 TGTGAGTAGGAATAGGAGGGTGG + Intronic
1102437615 12:112937702-112937724 ATTTTGGAGGAGAAGGAGGAAGG - Intergenic
1102655628 12:114480350-114480372 GGTGAGGAGGAGGAGGAGGAAGG + Intergenic
1103507426 12:121451170-121451192 ATTGTGTAGGCAGAGGAGGAGGG - Intronic
1103525150 12:121562646-121562668 ATGGAGGAGGAGGAGGAGGAAGG + Intronic
1103564621 12:121809440-121809462 ATTGAGGAGGAGTGTCAGGATGG - Intronic
1103932383 12:124457588-124457610 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1104091948 12:125525028-125525050 AATGAGTAGGAGCAAGAGCATGG + Intronic
1104107381 12:125675858-125675880 TTTGAGAAGGTGCAGGAGGATGG + Intergenic
1104820278 12:131673061-131673083 ATGAAGGAGGAGGAGGAGGAGGG + Intergenic
1105261790 13:18785152-18785174 ATACAGCAGGAGTAGGAGCAAGG + Intergenic
1105264147 13:18801741-18801763 ATACAGCAGGAGTAGGAGCAAGG + Intergenic
1105775918 13:23659964-23659986 GCTGAGGAGGAGGAGGAGGAGGG + Intronic
1106359999 13:29022284-29022306 AGTGAGGAGGAGCATGAGGATGG + Intronic
1107215841 13:37917798-37917820 ATTTAGGAGGACTAGGATGACGG - Intergenic
1108700262 13:52937741-52937763 ATAGAGTTGGGGGAGGAGGATGG + Intergenic
1108892956 13:55284703-55284725 AAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1109050188 13:57470574-57470596 ATTGAACATCAGTAGGAGGAAGG - Intergenic
1109785201 13:67164847-67164869 ATTGGGTAGGGGCAAGAGGAGGG - Intronic
1110316094 13:74108803-74108825 ACTGAGTAGGCTAAGGAGGAGGG + Intronic
1110927290 13:81169882-81169904 CTTGAGTAGAAGTAGGAAAAGGG - Intergenic
1111086426 13:83380719-83380741 AGGGAGTGGGAGGAGGAGGAAGG - Intergenic
1111767553 13:92551700-92551722 ATTGAGAAACAGTAGGAGGTAGG + Intronic
1111912709 13:94329769-94329791 GAGGAGGAGGAGTAGGAGGAAGG - Intronic
1112399019 13:99059407-99059429 ATTGATTAGATGTAGGAGGGAGG - Intronic
1112622660 13:101067347-101067369 GAGGAGGAGGAGTAGGAGGAAGG + Intronic
1113159617 13:107365027-107365049 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
1113425151 13:110201393-110201415 AAGGAGGGGGAGTAGGAGGAGGG + Intronic
1113556594 13:111240534-111240556 AAGGAGGAGGAGGAGGAGGAAGG - Intronic
1114253948 14:20985824-20985846 AAAGAGGAGGAGGAGGAGGAGGG + Intergenic
1114364242 14:22010019-22010041 GATGAGGAGGAGAAGGAGGAAGG + Intergenic
1114674029 14:24429476-24429498 AGAGAGGAAGAGTAGGAGGAAGG - Exonic
1115275589 14:31605751-31605773 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1116055220 14:39855453-39855475 AGTGATGAGGAGGAGGAGGAAGG - Intergenic
1116233925 14:42253634-42253656 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1116658225 14:47675992-47676014 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1116665124 14:47764850-47764872 GCTGAGGAGGAGGAGGAGGAAGG + Intergenic
1116933643 14:50715248-50715270 ATTGAGTAGGAGGAAAAGGCAGG - Intergenic
1117043030 14:51785313-51785335 AGCAAGTAGGAGAAGGAGGAGGG - Intergenic
1117309668 14:54509418-54509440 GTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1117384700 14:55199718-55199740 ATTGAGTAGGCTGAAGAGGAGGG + Intergenic
1117422640 14:55562101-55562123 ATTGAGTAGGCTAAGGAGGAAGG + Intronic
1117569365 14:57031045-57031067 TTTGAGCAGGAGTGGGATGAAGG + Intergenic
1117761636 14:59035328-59035350 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1118171696 14:63395443-63395465 AGAGAGAAGGAGGAGGAGGAGGG + Intronic
1118182758 14:63509624-63509646 GATGAGAATGAGTAGGAGGAGGG - Intronic
1118668454 14:68096482-68096504 ATCGAAAAGGAGTAGGAGGAAGG - Intronic
1118877836 14:69799376-69799398 AATGGGAAGGAGTGGGAGGAGGG - Intergenic
1119042133 14:71284488-71284510 ATTGAGTAGTATTAGGAGAAGGG + Intergenic
1119071869 14:71594057-71594079 ATGGAGGAGGAGGAGAAGGAAGG - Intronic
1119181015 14:72605283-72605305 AGGGAGCAGGAGCAGGAGGAGGG + Intergenic
1120055709 14:79921540-79921562 ACTGAGTGGGTGAAGGAGGAAGG + Intergenic
1120578650 14:86217756-86217778 ATGGAGGAGGAGGAGGAAGAAGG - Intergenic
1120736614 14:88060160-88060182 ATGGAGACAGAGTAGGAGGATGG + Intergenic
1120899897 14:89566826-89566848 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1121735729 14:96216749-96216771 AAGGAGGAGGAGGAGGAGGAAGG + Intronic
1121810257 14:96880482-96880504 GTGGAGTAGGAGTAGTAGGTGGG + Intronic
1122716323 14:103698844-103698866 ATCGTGTAGGAACAGGAGGAGGG + Exonic
1122942518 14:104988245-104988267 AGTGTGAAGGGGTAGGAGGAGGG - Intronic
1124186131 15:27531107-27531129 ATTGTGGAGGAGGAGGAGGGTGG + Intronic
1124599605 15:31122287-31122309 GTTGAAAAGGAGTAGTAGGAGGG - Intronic
1124696577 15:31869352-31869374 CTGGAGGAGGAGGAGGAGGATGG + Intronic
1124805948 15:32883110-32883132 GTTGACTATGAGTAGGAGGGAGG - Intronic
1125002292 15:34784181-34784203 GTTGAGTGGGAGTAGGAGTAGGG + Intergenic
1125253630 15:37736192-37736214 AGTGAGTAGAAGCAGGAGCAAGG - Intergenic
1125695168 15:41630206-41630228 ACTGAGTAGGAGTTTGAGGCAGG - Intronic
1126138338 15:45414110-45414132 ATAGAGAGTGAGTAGGAGGAGGG + Intronic
1126940858 15:53763514-53763536 AGTGACTTGCAGTAGGAGGAAGG - Intergenic
1127298989 15:57634266-57634288 ATTAAGTAGGAAGTGGAGGAAGG + Intronic
1127535304 15:59884694-59884716 GTTGAGTAGGCTGAGGAGGAGGG - Intergenic
1127876203 15:63113718-63113740 ATAGAGATGGAGTAGGAGGGAGG + Intergenic
1128047769 15:64634129-64634151 ATTGTGTGGGAGTATGAAGAGGG + Intronic
1129421275 15:75428881-75428903 ATTGAGGAGGCTGAGGAGGAGGG - Intronic
1130721103 15:86386264-86386286 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1130959842 15:88652423-88652445 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1131014180 15:89043625-89043647 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1131014192 15:89043665-89043687 AGGGAGGAGGAGAAGGAGGAGGG + Intergenic
1131319790 15:91376351-91376373 AATGTGAAGAAGTAGGAGGAAGG + Intergenic
1131852113 15:96554582-96554604 AAAGAGTAGGAGAAGGAGGGAGG - Intergenic
1131901070 15:97088539-97088561 ATGAAGGAGGAGGAGGAGGAAGG - Intergenic
1132028049 15:98419586-98419608 ATGGAGGAGGAGGAGGAGGAGGG + Intergenic
1133730199 16:8572109-8572131 AGTGAGCAGGAGGAGGAGGTAGG + Exonic
1133917127 16:10119215-10119237 ATTCAGTAGGAGGAGGAAGATGG + Intronic
1134997410 16:18750660-18750682 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1135114519 16:19713563-19713585 ATGGAGGTGGAGGAGGAGGATGG + Intronic
1135147753 16:19977813-19977835 ACTGAGGAGGAGGAAGAGGAGGG - Intergenic
1135967069 16:27044645-27044667 CTTGAGGAAGAGGAGGAGGAAGG - Intergenic
1138395351 16:56700030-56700052 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1139478644 16:67216045-67216067 AAAGAGCAGGAGAAGGAGGAAGG - Intronic
1139972616 16:70785675-70785697 AGTGAGGAGGAGGAGGAGGGCGG + Intronic
1140170446 16:72598860-72598882 ACTGAGTGGGAGGAGGAAGAGGG + Intergenic
1140725565 16:77808465-77808487 ATGGAGCAGGGGTGGGAGGATGG - Intronic
1140732456 16:77869126-77869148 AATGAGTAGCAGAAGGGGGAAGG + Intronic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141053915 16:80798413-80798435 ACTGAGGAGGAGGAGGAGGAAGG - Intronic
1141691438 16:85598974-85598996 ATTGAGGGGGAGTAGGAGAGAGG - Intergenic
1141703620 16:85653289-85653311 AGGGGGTAGGAGGAGGAGGAGGG - Intronic
1143164288 17:4890130-4890152 AGCGAGTTGGAGAAGGAGGAAGG - Intronic
1143289828 17:5820331-5820353 GCTGGGTAGGAGTGGGAGGAGGG - Intronic
1143374744 17:6460849-6460871 ATTGAGTAGGTCTAAGAGGGTGG + Intronic
1143791199 17:9297354-9297376 ATTAAGTGGGAGTGGCAGGAAGG - Intronic
1144317256 17:14073732-14073754 CTTGAGTAGGAGGAGGACCAAGG + Intronic
1144325096 17:14171659-14171681 CTAGAGTAGGTGGAGGAGGAAGG - Intronic
1144473970 17:15568538-15568560 CTAGAGTAGGTGGAGGAGGAAGG - Intronic
1144768972 17:17748646-17748668 ATAGAAAAGGTGTAGGAGGATGG + Intronic
1145297147 17:21600871-21600893 ATTGAGGAAGAGTAGGATGGAGG - Intergenic
1145925590 17:28644715-28644737 ACTGAATAGGAGTGTGAGGAAGG - Intronic
1146714047 17:35068789-35068811 ATGGAGGAGGAGGAGGAGAAAGG + Intronic
1146742552 17:35299223-35299245 ATGGAGAAGGAGAAGGAGCAGGG - Intergenic
1146915607 17:36676444-36676466 GTAGAGGAGGAGGAGGAGGAGGG + Intergenic
1147034654 17:37671084-37671106 ATTGAGTGTGAGTAGGGGGTGGG - Intergenic
1148623632 17:49053104-49053126 ATTGATAAGGACTGGGAGGAGGG - Exonic
1148689446 17:49518609-49518631 GGTGAGGAGGAGGAGGAGGATGG - Intergenic
1148854403 17:50570816-50570838 ATGGGGTAGGAGGAGGGGGAGGG + Intronic
1148876426 17:50690072-50690094 AATGAGTAAGAGTTGGAGGATGG + Intronic
1149028474 17:52057323-52057345 GTTGAGTAGGCTGAGGAGGAGGG - Intronic
1149103051 17:52928834-52928856 AATTAGGAGGAGAAGGAGGATGG + Intergenic
1149130017 17:53287900-53287922 TTTGAGTAGGATTAAGAGGTGGG - Intergenic
1149354197 17:55822842-55822864 ATTGAGTGGAAGGAAGAGGAAGG + Intronic
1149599269 17:57882676-57882698 ATTGAGTAGGCTGAGGAGGAGGG - Intronic
1149723639 17:58870113-58870135 CTGGAGGAGGAGGAGGAGGAAGG + Intronic
1150222325 17:63503188-63503210 TTTGCGTAGGAGAAGGAAGAGGG - Intronic
1151076246 17:71276337-71276359 TTTTAGTAGCAGTAGGAAGAAGG - Intergenic
1151355771 17:73557636-73557658 AGAGAGGAGGAGGAGGAGGATGG - Intronic
1151860836 17:76760373-76760395 ATTGAGAAGGAGGAGGAGGGAGG + Intronic
1152124550 17:78438425-78438447 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1152315955 17:79580279-79580301 AAGGAGGAGGAGGAGGAGGATGG - Intergenic
1152336691 17:79703025-79703047 GTGGAGGAGGAGTGGGAGGAAGG - Intergenic
1152340306 17:79720744-79720766 ATGGAGCAGGAGCAGGAGCAGGG - Intergenic
1152370161 17:79882677-79882699 ATTGAGGAGGAGGAGGAGGAGGG - Intergenic
1152799164 17:82323083-82323105 AGTGTGTAGGAGGAGGAGGCTGG - Intronic
1154424253 18:14259820-14259842 ATTAAGCAGGAGTAGGAGCAAGG - Intergenic
1154429652 18:14298556-14298578 ATTAAGCAGGAGTAGGAGCAAGG - Intergenic
1154431925 18:14314902-14314924 ATACAGCAGGAGTAGGAGCAAGG - Intergenic
1154991813 18:21604256-21604278 TTTGAGGAAGAGTGGGAGGAGGG + Intergenic
1155066517 18:22273718-22273740 ATGGAGGAGGAGGAGGAGGAGGG - Intergenic
1155106592 18:22672837-22672859 ATTGAGTAGACTGAGGAGGAGGG - Intergenic
1155462552 18:26099234-26099256 ATTGGGTAACAGTAGGAGTATGG + Intergenic
1155583610 18:27339985-27340007 AATGTGCAGGAATAGGAGGAAGG - Intergenic
1156002783 18:32403739-32403761 AATGAGTAGGATTAGGACCAGGG - Intronic
1156315449 18:35965087-35965109 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1156465657 18:37346704-37346726 TTTGGGGAGGAGTAGGTGGAAGG + Intronic
1157130353 18:45001591-45001613 TTTGAGGAGGAGCAGCAGGAAGG + Intronic
1157317642 18:46605779-46605801 AGAGAGGAGGAGTAGGAAGATGG + Intronic
1157381947 18:47226481-47226503 ATTGAGTGGGAGTAGGTGTTTGG - Intronic
1157382031 18:47227207-47227229 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1157385587 18:47257372-47257394 AAGGAGTGGGAGTAGGGGGAGGG + Intergenic
1157711359 18:49851987-49852009 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1158755026 18:60313005-60313027 ATTGAGTAGGATGAGTGGGAGGG - Intergenic
1159079793 18:63724254-63724276 ACAGAGGAGGAGGAGGAGGAAGG - Intronic
1159807654 18:72975274-72975296 AGTGAGGAGGAGTTGCAGGAGGG + Intergenic
1159834625 18:73324116-73324138 ACTGAGAAGGAGGAAGAGGAAGG - Intergenic
1160017829 18:75157901-75157923 ATTGGGTATGAGAAGGGGGAGGG - Intergenic
1160057656 18:75499541-75499563 AAGGAGTAGGAGAAGGAGAAGGG + Intergenic
1160254226 18:77233865-77233887 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1160819711 19:1052344-1052366 CTTGAGGAGGAGGAGGGGGAGGG + Intronic
1160965783 19:1746329-1746351 ATGGAGGAGGAGGGGGAGGAAGG + Intergenic
1161070030 19:2255440-2255462 AGTGAGGAGGGGTGGGAGGACGG - Intronic
1161207593 19:3049478-3049500 GTTGAGTAGGAGTGAAAGGAGGG + Intergenic
1161509544 19:4662919-4662941 CTGGGGTAGGAGGAGGAGGAAGG - Intronic
1161865971 19:6832474-6832496 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
1162053115 19:8046863-8046885 AAGGAGGAGGAGAAGGAGGATGG - Intronic
1162695959 19:12475662-12475684 GTTGAGTAGGAGTGGTAAGAGGG - Intronic
1163361856 19:16851741-16851763 TTTGAAAAGGAGGAGGAGGAAGG + Intronic
1163502620 19:17686019-17686041 AGTGAGGAGGAGTAGGAGGCAGG - Intronic
1164027117 19:21362474-21362496 AGTGAGCAGGAGTGGGTGGAAGG + Intronic
1164234901 19:23323370-23323392 AGAGAGTAGGAGGAAGAGGAAGG - Intronic
1164394347 19:27850673-27850695 ATGGTGTAGGAGGAGGAGGCGGG - Intergenic
1164395329 19:27858656-27858678 GTGGAGTGGGAGTTGGAGGAGGG + Intergenic
1165775918 19:38404230-38404252 AGTGGGTTGGATTAGGAGGAAGG + Intronic
1165796620 19:38523635-38523657 AATGGGGAGGAGGAGGAGGAGGG - Intronic
1166700220 19:44878044-44878066 ATGGAGGAGGAGGAGGAGGGGGG - Intronic
1167050575 19:47075448-47075470 ACTGAAGAGGAGGAGGAGGAGGG - Intronic
1167189961 19:47979169-47979191 ATGGAAGAGGAGGAGGAGGAGGG - Intronic
1167517698 19:49932801-49932823 GTTGAGGTGGAGAAGGAGGAGGG - Exonic
1167622036 19:50566072-50566094 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1167844284 19:52148017-52148039 AATGAGTAGGAGCAGAAGAAAGG + Intergenic
1168107021 19:54171975-54171997 CTGGAGGAGGAGGAGGAGGATGG - Exonic
925034238 2:673732-673754 AGGGAGGAGGAGGAGGAGGAGGG + Intronic
925789810 2:7472537-7472559 ACTGAGCAGGAGATGGAGGAGGG - Intergenic
925831372 2:7899269-7899291 TATGAGTAGGAGCAGGAGGAAGG - Intergenic
926546892 2:14252676-14252698 AAGGAGGAGGAGTAAGAGGAAGG - Intergenic
926907603 2:17820724-17820746 TTTGTGTTGGAGAAGGAGGAGGG + Intergenic
927080896 2:19629850-19629872 AGTGTGCAGGAGTGGGAGGAAGG - Intergenic
927537067 2:23871789-23871811 GTAGAGAAGGAGTAGGAGGTGGG - Intronic
929611277 2:43272568-43272590 CTTAAGTAGGAGTAAGAGAAGGG + Intronic
930208238 2:48609536-48609558 AATGAGTAGGAGACAGAGGAAGG - Intronic
930717781 2:54609004-54609026 GTTGAGTAGGCTGAGGAGGAAGG + Intronic
930945703 2:57072322-57072344 ATTGAGGAGAAGGAAGAGGAGGG - Intergenic
931084419 2:58813627-58813649 ATTGAATAAAAGTAGGAAGATGG + Intergenic
931134819 2:59386422-59386444 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
931513152 2:63022297-63022319 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
931669833 2:64637008-64637030 ATTAATTAGGGGTGGGAGGAAGG + Intronic
931781129 2:65580134-65580156 ATGGAGGGGGAGAAGGAGGATGG - Intergenic
932283284 2:70512923-70512945 AATCAGGAGGAGCAGGAGGAAGG + Intronic
932347493 2:71005171-71005193 GCTGGGTAGGATTAGGAGGAAGG - Intergenic
933370642 2:81411254-81411276 AATTAGTGGGAGGAGGAGGAGGG + Intergenic
933503824 2:83151872-83151894 ATAGAGTTGGAGGAAGAGGAAGG + Intergenic
934127251 2:88907893-88907915 ATTGAGTAGGCTGAGGAGGAGGG - Intergenic
934542811 2:95190180-95190202 AATGAGTAGGAGTTGGAGTAGGG - Intergenic
934765528 2:96878162-96878184 GTTGAGGAGGAAAAGGAGGATGG + Intronic
935735294 2:106101956-106101978 ATGGAGGAGGAGAAGGAGAAGGG - Intronic
936115507 2:109699646-109699668 GCTGAGAAGGAGGAGGAGGAGGG + Intergenic
936964131 2:118110435-118110457 GCTGAGGAGGAGGAGGAGGAGGG + Intronic
937490257 2:122359548-122359570 AAGGAGGAGGAGTAGGAGGATGG - Intergenic
937550156 2:123077971-123077993 ATTGAGTAGGCAAAGGAGAAGGG + Intergenic
938736611 2:134191731-134191753 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
939054835 2:137352160-137352182 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
939229438 2:139407648-139407670 ATGAAGTAGGAGTAAAAGGAAGG + Intergenic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940568417 2:155399242-155399264 AATGATCAGGAGTAGAAGGAGGG - Intergenic
940852205 2:158699156-158699178 GATGAGGAGGAGGAGGAGGAAGG + Intergenic
941352053 2:164449290-164449312 ATTGGGTGGGGGTAGGAGTAAGG - Intergenic
942478967 2:176361854-176361876 GTTGAGTAGGCTGAGGAGGAAGG + Intergenic
942524809 2:176841808-176841830 AGAGAGGAGGAGGAGGAGGAAGG - Intergenic
943619714 2:190135358-190135380 ATTGAATAGGTATAGGATGAAGG - Intronic
944269487 2:197765176-197765198 AGGGAGAAGGAGTAGGAAGAGGG + Intronic
944945002 2:204673692-204673714 ATACAGTAGGATGAGGAGGATGG - Intronic
945023770 2:205600419-205600441 ATTCAGTAGGATTAGGAACATGG - Intronic
945987532 2:216367315-216367337 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
946473310 2:219982970-219982992 ATAGAGTGGGAGTAGGAAGAGGG - Intergenic
947309735 2:228788113-228788135 ATTGAGTAGGCTGTGGAGGAGGG - Intergenic
947837735 2:233187812-233187834 AGGGAGGAGGAGCAGGAGGACGG - Intronic
948003546 2:234589095-234589117 ATATAGTGGGAGCAGGAGGAAGG + Intergenic
948923808 2:241081391-241081413 AAGGAGGAGGAGAAGGAGGAGGG - Intronic
1168873079 20:1147516-1147538 ATTGAGGAGGAGAAAGGGGATGG - Intronic
1169129125 20:3154825-3154847 AGTGAGTAAGAGGAGGAGTAGGG + Intronic
1170024268 20:11872005-11872027 AAAGAGGAGGAGGAGGAGGAGGG - Intergenic
1170142514 20:13139094-13139116 ATGGAGGAGGAGAAGGAGGGAGG - Intronic
1170227690 20:14010330-14010352 ATTGAATAGGCTTAGGAGGATGG + Intronic
1171045453 20:21806069-21806091 AGTGAGGAGGAGCTGGAGGAAGG - Intergenic
1172027111 20:31956077-31956099 GTTGATCAGGAGTAGCAGGAGGG - Intergenic
1172077869 20:32313409-32313431 ATACAGTAGGGGTAGGAGGGAGG - Intronic
1172801862 20:37581485-37581507 ATTGAGGGGGCGTGGGAGGAGGG + Intergenic
1173344285 20:42184499-42184521 AAGGAGGAGGAGGAGGAGGAAGG - Intronic
1174736813 20:52972747-52972769 GTGGAGGAGGAGGAGGAGGAGGG + Exonic
1174898565 20:54475573-54475595 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1175053518 20:56177045-56177067 ATTGAATAGGATGAGGAGCAAGG - Intergenic
1175100624 20:56576247-56576269 GAGGAGTAGGAGGAGGAGGAGGG - Intergenic
1175169266 20:57068584-57068606 ACTGAGAATGAGTAGGAGCAAGG + Intergenic
1175328331 20:58145418-58145440 ATTGGGTAGAAGCAGGTGGAAGG - Intergenic
1175429383 20:58891271-58891293 AAGGAGGAGGAGGAGGAGGAGGG - Intronic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1176285318 21:5016245-5016267 CCTGAGGAGGAGGAGGAGGAGGG + Intergenic
1176845117 21:13870860-13870882 ATACAGCAGGAGTAGGAGCAAGG + Intergenic
1176847845 21:13890417-13890439 ATACAGAAGGAGTAGGAGCAAGG + Intergenic
1176849218 21:13900176-13900198 ATACAGAAGGAGTAGGAGCAAGG + Intergenic
1176995569 21:15551608-15551630 TTAGTGTAGGAGTAGGGGGAGGG - Intergenic
1177613322 21:23483174-23483196 GTTGAGAAGGCTTAGGAGGAGGG + Intergenic
1177722864 21:24929520-24929542 ATGGAGTGGGAATGGGAGGATGG - Intergenic
1177838505 21:26211609-26211631 GTGGAGTCGGGGTAGGAGGAGGG + Intergenic
1177908886 21:27005964-27005986 ACTGAGGAGGAGTGGGAGGGGGG - Intergenic
1178108351 21:29346938-29346960 AGTGAGAGGGAGAAGGAGGAAGG + Intronic
1178140206 21:29674403-29674425 AATGTGTAGGAGTAGTAGAATGG + Intronic
1178165696 21:29973603-29973625 ATTGAGAAGGAGGAAGGGGAGGG - Intergenic
1178375539 21:32064598-32064620 AGAGAGGAGGAGGAGGAGGAAGG + Intergenic
1178493707 21:33070370-33070392 GTGGAGGAGGAGGAGGAGGAGGG - Exonic
1179228373 21:39476711-39476733 ATTGAGAAGTAGTAGGAATACGG - Intronic
1179487799 21:41722119-41722141 GTTGAGGAGGAAAAGGAGGAGGG - Intergenic
1179520005 21:41936700-41936722 GTTGAGTAGGCTGAGGAGGAGGG - Intronic
1179871863 21:44247230-44247252 CCTGAGGAGGAGGAGGAGGAGGG - Intronic
1180059091 21:45375504-45375526 ATGGAGGAGGGGGAGGAGGAGGG + Intergenic
1181103473 22:20557237-20557259 ATAGGGTAGGAGTGTGAGGATGG - Intronic
1181829545 22:25548926-25548948 ATTGACCAGGAGGGGGAGGAGGG - Intergenic
1181886074 22:26023476-26023498 GTAGAGGAGGAGGAGGAGGAGGG - Intronic
1182755876 22:32678530-32678552 AAGGAGGAGGAGGAGGAGGAAGG - Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183056698 22:35311127-35311149 GGTGAGTGGGAGTGGGAGGAAGG + Intronic
1183256718 22:36767125-36767147 ACTGAGGAGGTGGAGGAGGAAGG - Intronic
1183731765 22:39622364-39622386 ATTGAGTAGGTGGAGGGGGAGGG + Intronic
1184065972 22:42120865-42120887 AGGGTGTGGGAGTAGGAGGAAGG - Intergenic
1184686064 22:46096890-46096912 CCTGAGTGGGGGTAGGAGGAAGG - Intronic
949758638 3:7443030-7443052 AAAGAGGAGGAGGAGGAGGATGG - Intronic
950130054 3:10536466-10536488 AAAGAGGAGGAGGAGGAGGAAGG - Intronic
950283302 3:11725192-11725214 AAGGAGGAGGAGAAGGAGGAGGG - Intergenic
950635783 3:14313506-14313528 ATTGAGGAGGAGAGGAAGGAAGG - Intergenic
950932169 3:16800905-16800927 AGTGAGGAAGAGAAGGAGGAAGG + Intergenic
951704344 3:25528527-25528549 CTGGAGGAGGAGTAGAAGGAAGG + Intronic
951987702 3:28639253-28639275 ATTGAGTAGGCTGAGGAGGAGGG + Intergenic
952152223 3:30605950-30605972 ATTCAGTAGGTCTAGGAGGCAGG - Intergenic
952661985 3:35862763-35862785 AATGAGGATGAGTAGAAGGAAGG + Intergenic
952700094 3:36318536-36318558 ATGGAGGAGGAGGAGGAGGAAGG - Intergenic
953230250 3:41058328-41058350 GTGGAGGAGGAGGAGGAGGAGGG + Intergenic
953879308 3:46683420-46683442 ATGGAGTAGGAGGTGGAGGGTGG - Intronic
953891318 3:46753604-46753626 ATTGAGAAGGAGTGGGAAGTTGG + Intronic
953896800 3:46809272-46809294 ATTGAGAAGGAGTGGGAAGTTGG + Intronic
953899280 3:46830182-46830204 ATTGAGAAGGAGTGGGAGGTTGG + Intronic
954783862 3:53079240-53079262 AATGAGAAGGAGGAAGAGGAAGG + Intronic
954973798 3:54674368-54674390 AGTGAGAAGGGGAAGGAGGATGG + Intronic
955242716 3:57193564-57193586 GTTGGGTGGGAGTAGGGGGATGG - Intergenic
955406631 3:58629850-58629872 AGAGAGGAGGAGAAGGAGGATGG + Intergenic
956015916 3:64882393-64882415 ATTCAGAAGGAGTGGGAGGAAGG - Intergenic
956049761 3:65235373-65235395 ATGGAGTAGGAGGTGGAGGATGG - Intergenic
956281023 3:67556873-67556895 ATTGAGCAGGAATAGAAGAATGG + Intronic
956665157 3:71635462-71635484 ATTGGGAAGCAGTGGGAGGAGGG - Intergenic
956699168 3:71943742-71943764 GTTGAGTAGGTTGAGGAGGAGGG + Intergenic
956989308 3:74745077-74745099 AAAGAGGAGGAGGAGGAGGAAGG - Intergenic
957553558 3:81736960-81736982 ATGGAGTAGTAGAAGCAGGAAGG + Intronic
958114345 3:89196026-89196048 AATGACTGGGAGAAGGAGGAAGG - Intronic
959149049 3:102586492-102586514 ATTCAAGATGAGTAGGAGGAAGG + Intergenic
959149220 3:102588628-102588650 ATTTAAGATGAGTAGGAGGAAGG + Intergenic
959234016 3:103694370-103694392 ATTGAGCAGGAGAATTAGGAAGG + Intergenic
959572070 3:107895408-107895430 ATTGAGGAGGAGTGGGTTGAGGG + Intergenic
959597004 3:108139711-108139733 GTTGAGTAGGCGGAAGAGGAGGG - Intergenic
959918131 3:111841328-111841350 ATTGAGTAGGAGTAGGAGGAGGG + Intronic
960251436 3:115459946-115459968 AATAAGGTGGAGTAGGAGGAGGG - Intergenic
960836438 3:121911456-121911478 ATGGAGGAGGAGGAGGAGGGAGG - Intronic
961513211 3:127416499-127416521 AATGAGAAGGGGGAGGAGGAGGG + Intergenic
961952894 3:130769358-130769380 ATGGAGATGGAGTAGAAGGATGG + Intergenic
961966854 3:130914054-130914076 ACTAAGGAGGAGGAGGAGGAGGG - Intronic
962371177 3:134822006-134822028 GTTGAAAAGGAGGAGGAGGAAGG + Intronic
962564335 3:136642110-136642132 ATTGACTAGGAGTAGGGAGGGGG - Intronic
962783520 3:138744467-138744489 ACTGAGTAGGCTGAGGAGGAGGG + Intronic
962966877 3:140363885-140363907 AATGAGGAGCAGTAGGAGGCAGG + Intronic
963600949 3:147378431-147378453 AAAGAGGAGGAGGAGGAGGATGG + Intergenic
964311355 3:155396623-155396645 ACTGAGAAGGAGGAAGAGGAGGG + Intronic
964892710 3:161556115-161556137 ATTGATTAGCAGTATGAGAAGGG - Intergenic
964985070 3:162727231-162727253 ATTGAATAGGGGGAGGGGGAGGG - Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966559173 3:181300003-181300025 AATGAGAAGGAGGAGGAGAAGGG + Intergenic
967311437 3:188110095-188110117 ATTGAGTGGCAGTAGGGGAAGGG + Intergenic
968344954 3:197995091-197995113 ATTGAGCAGGAGGAAGAGGAGGG - Intronic
968811051 4:2799811-2799833 CTTGAGGGGGAGCAGGAGGAGGG + Intronic
968901227 4:3432826-3432848 AGTGAGTGGGAGAAGGAGGTGGG + Intronic
968914187 4:3490002-3490024 AATGAGCAGGAGGAGAAGGAAGG - Intronic
969235930 4:5865065-5865087 ATGGAGGAGGAGGAGGAGGCTGG - Intronic
969643184 4:8411412-8411434 ACTGAGGAGAAGTAGGAGGTGGG + Intronic
970099156 4:12501382-12501404 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
970432653 4:16002918-16002940 ATTGAAAAGGAGGAAGAGGAGGG + Intronic
970748206 4:19325694-19325716 ATTGACTAGGAATGGGAGGATGG - Intergenic
971418827 4:26457181-26457203 ACTGAGTAGGAGGTGGAGGGTGG - Intergenic
971574540 4:28256593-28256615 AGGGAGGAGGAGGAGGAGGAGGG - Intergenic
971605428 4:28651883-28651905 AGTGAGGAGGAGTGGGATGAGGG + Intergenic
971754740 4:30692891-30692913 GATGAGGAGGAGGAGGAGGAGGG - Intergenic
972887313 4:43508703-43508725 AGTTAGTGGGAGTTGGAGGAGGG - Intergenic
973803289 4:54499422-54499444 ATTAACTAGAAGGAGGAGGAGGG - Intergenic
973929990 4:55782379-55782401 GTTGAGTAGGCTGAGGAGGAGGG - Intergenic
973966670 4:56170088-56170110 ATGGAGGAGGAAGAGGAGGAAGG - Intergenic
974074169 4:57153900-57153922 AGAGAGAAGGAGGAGGAGGAGGG + Intergenic
974753773 4:66176784-66176806 AATGAGAAGGAGAAGGAGAAGGG + Intergenic
975663048 4:76706530-76706552 GCTGAGGAGGAGTAAGAGGATGG + Intronic
976695800 4:87918705-87918727 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
976757791 4:88516749-88516771 ATTGAGAAGGAGGAGGAGTGGGG + Intergenic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
978598576 4:110404519-110404541 GCTGAGTAGGAGGAAGAGGAGGG + Intronic
978702307 4:111662589-111662611 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
979286838 4:118935913-118935935 GTTGCGTAGGAGGAAGAGGAGGG + Intronic
980114102 4:128662869-128662891 TTTGAGAAGGAGCAGCAGGAGGG - Intergenic
980669683 4:135988022-135988044 ATGAAGTAGTAGTAGGAGAAAGG - Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
981342310 4:143635523-143635545 ATTGAGGATGAGGAGGAGCAGGG - Intronic
981421913 4:144560628-144560650 GCTGAGAAGGAGGAGGAGGAGGG + Intergenic
981579517 4:146237802-146237824 ATGGAGTAGGGGCAGGAGAAAGG + Intergenic
982196939 4:152925876-152925898 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
982321839 4:154084968-154084990 ATTCAGCAGGAGCAGGATGAAGG + Intergenic
983692424 4:170487077-170487099 GTTGAGTAGGCTGAGGAGGAGGG + Intergenic
983913872 4:173269722-173269744 GTTGAGGAGGAGGAGGAGGAGGG - Intronic
984559518 4:181252109-181252131 ATTGAGTTGGAGTTAGAGGGAGG - Intergenic
985031392 4:185794260-185794282 ATGGAGAAGGAGGAGGAGGGAGG + Intronic
985085884 4:186312025-186312047 AAAGAGGAGGAGGAGGAGGAAGG - Intergenic
985117364 4:186605302-186605324 AGTGAGAAGGGGGAGGAGGAGGG + Intronic
986497954 5:8365519-8365541 ATTTAGTTTGGGTAGGAGGAGGG - Intergenic
986879105 5:12147877-12147899 AAGGAGGAGGAGGAGGAGGATGG - Intergenic
987106630 5:14646120-14646142 ATAGAGGAGGAGTTGGAGGTGGG + Intergenic
987191279 5:15480877-15480899 GTTGAGGAGGAGGATGAGGATGG + Intergenic
989043342 5:37250524-37250546 ATAGAGGAGGAGGAAGAGGAGGG - Intergenic
989464497 5:41739253-41739275 AGTGAACAGGAGTAGAAGGAAGG - Intronic
990327313 5:54691186-54691208 ATTCAGTAGGGGCATGAGGATGG + Intergenic
990601826 5:57366770-57366792 CTTGAGCAGGAAGAGGAGGAAGG + Intergenic
991185097 5:63797077-63797099 AATGAGGAGGAGGAGGAGGATGG + Intergenic
991398488 5:66229125-66229147 GTTGAGAAGGAGGAGGAGGAGGG + Intergenic
991621862 5:68552890-68552912 ATTGAATAGGCTGAGGAGGAGGG + Intergenic
991917945 5:71623927-71623949 TTTGAGTAGGGGAAGAAGGATGG - Intronic
992214909 5:74516431-74516453 AAAGAGGAGGAGGAGGAGGATGG - Intergenic
992349716 5:75916396-75916418 GTGGAGGAGGAGGAGGAGGAAGG - Intergenic
992794122 5:80240270-80240292 GTTGAGAAGCAGTGGGAGGAAGG - Intronic
993506182 5:88711540-88711562 ATTGAGCAAGAGTAAGAGTATGG + Intergenic
993748406 5:91631242-91631264 ATAGAGGAGGGGTAGGAGCAGGG + Intergenic
994301206 5:98150023-98150045 GAAGAGGAGGAGTAGGAGGAGGG - Intergenic
994850273 5:105046317-105046339 GTCGAGGAGGAGGAGGAGGAGGG - Intergenic
995069168 5:107898385-107898407 ATTGAGTAGGCTTACAAGGAGGG - Intronic
995404312 5:111776988-111777010 GATGAGGAGGAGGAGGAGGAAGG + Intronic
996671872 5:126127505-126127527 ATGGGGAAGGAGTCGGAGGAGGG - Intergenic
996909547 5:128639575-128639597 GTTGAGTAGGAGGAGTGGGATGG - Intronic
997551882 5:134760414-134760436 TTTGAGAAGTAGTAGGAGGTAGG + Intronic
998342547 5:141431109-141431131 ATGGAGTAGAAGTAGAAGTAAGG + Exonic
998838588 5:146228911-146228933 ATTGAGTAGAAGTAAGAGCAGGG - Intronic
999432636 5:151537276-151537298 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
1000142482 5:158418998-158419020 ACTGAGTAGCAGAAGGAAGAGGG + Intergenic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001343045 5:170864612-170864634 ATTGAGAAGAAGTAAGAGGTAGG + Intronic
1001670393 5:173468697-173468719 ATTCAGCGGGAGGAGGAGGAAGG + Intergenic
1001820811 5:174708807-174708829 TTTGAGGAGGAGGAGGAGGCGGG - Intergenic
1001887227 5:175303958-175303980 AATGAGTAGCGGAAGGAGGAAGG - Intergenic
1002555089 5:180030976-180030998 ATTGAGTAGGCTTAGGGGGTAGG - Intronic
1002842458 6:917973-917995 ATAGAGTAGCAGTTGGAGGGAGG + Intergenic
1003105395 6:3211326-3211348 AGGGAGCAGGAGGAGGAGGATGG - Intergenic
1003145069 6:3503481-3503503 ATTGGGAAGGTGGAGGAGGAGGG + Intergenic
1003517014 6:6825994-6826016 ATTGAGTCGGGGGAGAAGGAAGG + Intergenic
1003597741 6:7489205-7489227 AATGAGTAGGGGTTTGAGGATGG - Intergenic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1004086741 6:12457086-12457108 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1004454842 6:15782874-15782896 ATTGAGTAGGCTGAGGAGGAGGG + Intergenic
1004527173 6:16419843-16419865 GTTGGGTTGGAGTAGAAGGATGG - Intronic
1004619539 6:17320919-17320941 AGTGAGGATGAGGAGGAGGAGGG + Intergenic
1005231776 6:23710006-23710028 ATTGAGAAGTAGTGGAAGGATGG + Intergenic
1005307276 6:24525805-24525827 AGAAAGTAGGAATAGGAGGAGGG + Intronic
1005504615 6:26458677-26458699 GCTGAGGAGGAGGAGGAGGAGGG - Exonic
1005768946 6:29045271-29045293 GTAGAGGAGGAGAAGGAGGAGGG + Intergenic
1006817448 6:36862061-36862083 AGTGACTAAGAGGAGGAGGAAGG - Intronic
1007265850 6:40595340-40595362 GATGAGTAGGTCTAGGAGGATGG + Intergenic
1007342773 6:41202043-41202065 ATTGAGCAGGAGGAAGTGGAGGG - Intergenic
1007905044 6:45451211-45451233 ATCGAGTGGGAGGAGGTGGAGGG + Intronic
1009056785 6:58345908-58345930 ACTGAGGAGGAGAAAGAGGAGGG - Intergenic
1011297928 6:85843585-85843607 ATTGAGTAGGAGTGGTGAGAGGG + Intergenic
1011484802 6:87830171-87830193 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1011550757 6:88529277-88529299 ATTGAGAAGGGGCAGGATGAAGG - Intergenic
1011865899 6:91826561-91826583 GTTGAGTAGAGGAAGGAGGAAGG - Intergenic
1012296364 6:97529905-97529927 ATTGAATAGTTATAGGAGGAGGG + Intergenic
1013313984 6:108923926-108923948 AATGAGAAGGGGAAGGAGGAGGG - Intronic
1013901155 6:115157142-115157164 GTTGAGTAGGCTGAGGAGGAGGG - Intergenic
1014331487 6:120071209-120071231 ATGGAGTAGGAGAAGCAAGATGG - Intergenic
1014775892 6:125509520-125509542 GTTGAGTAGTATTAGGAGGATGG + Intergenic
1014913316 6:127118621-127118643 ATAGGGGAGGAGGAGGAGGAGGG - Exonic
1015261370 6:131241280-131241302 ATGGAGAAGGAGAAGGAGGAGGG + Intronic
1016304914 6:142673689-142673711 ATTGAGTAGGGGAGGCAGGAGGG + Intergenic
1018366573 6:163126571-163126593 ATTGAGTATGTGTAAAAGGAAGG - Intronic
1018924285 6:168195531-168195553 ATGGAGCAGGGGGAGGAGGAGGG - Intergenic
1019171748 6:170136790-170136812 GTTGAGTAGCAGGTGGAGGACGG - Intergenic
1019529067 7:1494674-1494696 ATTGTGGAGGAGGAGCAGGATGG + Intronic
1020155486 7:5720266-5720288 GTTGAGTAGGCTGAGGAGGAGGG - Intronic
1020410710 7:7888864-7888886 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1020774301 7:12433539-12433561 ATTGAGTCGGGGTAGGTGGGAGG + Intergenic
1020917531 7:14214929-14214951 ATGGAGTGGGAGAAGGAGGGAGG - Intronic
1023048610 7:36232551-36232573 ATGCATTAGGAGTAGGGGGAGGG - Intronic
1023114619 7:36850163-36850185 ATTGAGTAGGCTGAAGAGGAGGG - Intergenic
1023115708 7:36859956-36859978 ATTGAGTAGGATGAGGGAGAAGG - Intronic
1024353974 7:48395606-48395628 GCTGAGGAGGAGGAGGAGGAAGG - Intronic
1025058040 7:55780956-55780978 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1025228135 7:57181183-57181205 AATGAGGAGGAGGAGGAAGAGGG - Intergenic
1026158963 7:67852272-67852294 AGTGAGGAGGAGCAGAAGGATGG + Intergenic
1028285918 7:88998734-88998756 ATGGAGTAGGGATAGGAGGTGGG + Intronic
1029167473 7:98603092-98603114 AGAGAGGAGGAGGAGGAGGAAGG + Intergenic
1029925156 7:104308177-104308199 AATGAGTAGGAGAAGGATTATGG + Intergenic
1030002714 7:105082574-105082596 GTTGAGTAGGCTGAGGAGGAAGG + Intronic
1030207481 7:106964989-106965011 ATTAAGTAGGGGAAGGAAGAAGG - Intergenic
1031365143 7:120891872-120891894 ATTGAGTAGGGTGAGAAGGAAGG + Intergenic
1031555029 7:123164106-123164128 AGTCAGGAGGATTAGGAGGAAGG + Intronic
1031766714 7:125787266-125787288 ATGGAGGAGGAGTGAGAGGAAGG + Intergenic
1031889648 7:127279179-127279201 ACTGAGGAGGAGGAGGAAGACGG - Intergenic
1032466830 7:132151390-132151412 AAGGAGGAGGAGGAGGAGGAAGG + Intronic
1032510929 7:132471713-132471735 TTGGAGTGGGAGGAGGAGGAGGG + Intronic
1032934293 7:136711230-136711252 AAGGAGTGGGAGGAGGAGGAGGG + Intergenic
1033023781 7:137753530-137753552 ACAGAGTGGGAGCAGGAGGAGGG + Intronic
1033610014 7:142956128-142956150 ATTTAGTGTGAGTGGGAGGAGGG - Intronic
1033740601 7:144272546-144272568 ATTGTGGGGGTGTAGGAGGAGGG + Intergenic
1033753306 7:144377067-144377089 ATTGTGGGGGTGTAGGAGGAGGG - Intronic
1033889594 7:145994978-145995000 AAAGAGAAGGAGGAGGAGGAGGG - Intergenic
1034978920 7:155463489-155463511 AAAGAGAAGGAGGAGGAGGAAGG - Exonic
1035722057 8:1799318-1799340 TTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1035958333 8:4108106-4108128 ACGGAGGAGGAGGAGGAGGAGGG + Intronic
1036236228 8:7041969-7041991 TATGAGGAGGAGGAGGAGGAGGG - Intergenic
1036538695 8:9680024-9680046 ATTAAGGAAGAGAAGGAGGAGGG + Intronic
1037066284 8:14582025-14582047 GTTGAGTAGGCTGAGGAGGAGGG - Intronic
1037071102 8:14650223-14650245 ATGGATCAGGAGTAGGAGAAAGG + Intronic
1037841849 8:22250519-22250541 AATGAGCAGGTGGAGGAGGACGG + Exonic
1038039037 8:23708576-23708598 AAGGAGGAGGAGGAGGAGGAGGG - Intergenic
1038054054 8:23841420-23841442 ATTTAGAAAGAGTTGGAGGAGGG - Intergenic
1039063980 8:33593752-33593774 ATTGAGTAGAGGTTAGAGGAAGG + Intronic
1040079746 8:43274824-43274846 AATGAGAATGAGGAGGAGGAGGG - Intergenic
1041000602 8:53446669-53446691 ATGGAGTAGGGGGAGGGGGAGGG + Intergenic
1041291170 8:56310133-56310155 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1041291181 8:56310165-56310187 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1041401681 8:57451744-57451766 AATGAGTAGGACTGGGAGGTAGG - Intergenic
1041776292 8:61526827-61526849 GTTGATTAGGAGTGGGAGGTGGG + Intronic
1041831536 8:62160688-62160710 AAGAAGTAGGAGGAGGAGGAAGG + Intergenic
1042833155 8:73053434-73053456 ATGGGGAAGGAGGAGGAGGAGGG - Intergenic
1042893653 8:73642178-73642200 ATAGAGAAGCAGTAGGAGAAAGG - Intronic
1042942189 8:74118755-74118777 AAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1042987958 8:74604454-74604476 GTGGAGGAGGAGGAGGAGGAAGG + Intronic
1043410716 8:79991119-79991141 ATTGAGTGGATGCAGGAGGAAGG + Intronic
1043499505 8:80838670-80838692 CTGGAGGAGGAGGAGGAGGAGGG + Intronic
1043557600 8:81450584-81450606 ATTGTGGGGGAGTAGGAGGGAGG - Intergenic
1044392356 8:91666320-91666342 ATAGAGAATGAGTAGAAGGAGGG - Intergenic
1044972143 8:97630112-97630134 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1045149629 8:99389653-99389675 ACTGAGGAGGAGGAAGAGGAGGG + Intronic
1045820722 8:106334868-106334890 ATTTATTAGCAGTAGTAGGATGG - Intronic
1046053716 8:109054831-109054853 AAGGAGCAGGAGGAGGAGGAAGG - Intergenic
1046421167 8:113984717-113984739 ATTGAGCAGGAGGAGCAGGAGGG + Intergenic
1046832893 8:118765748-118765770 ATTGAGTTGGAGAAAGAAGAGGG + Intergenic
1047760529 8:127950772-127950794 AGTGAGGAGGTGTAGGAGGGAGG + Intergenic
1047958990 8:129997119-129997141 AAGGAGGAGGAGGAGGAGGAGGG + Intronic
1048102011 8:131362549-131362571 AGTGGGTAGGAGCAGGATGAGGG + Intergenic
1048602411 8:135932161-135932183 TGTAAGTAGTAGTAGGAGGAGGG + Intergenic
1048633874 8:136274515-136274537 GATGAGTAGGAGTAGGGGGTTGG + Intergenic
1048767402 8:137859932-137859954 AAGGAGGAGGAGCAGGAGGAGGG + Intergenic
1048836489 8:138523899-138523921 ATTTAAAAGGAGTGGGAGGATGG + Intergenic
1049037380 8:140087067-140087089 ATTTCAGAGGAGTAGGAGGATGG - Intronic
1049811298 8:144574182-144574204 GATGAGGAGGAGGAGGAGGAGGG + Intronic
1050000244 9:1069931-1069953 ATTGAGTAGGCTTAGGAGGAAGG + Intergenic
1050475906 9:6040909-6040931 AGTAAGGAGGAGGAGGAGGAAGG - Intergenic
1050831361 9:10018198-10018220 AGAGAGAAGGAGTAGGAGGAAGG + Intronic
1051238155 9:15023637-15023659 CTTGAGTAGGGAAAGGAGGATGG - Intergenic
1051666978 9:19474823-19474845 ATTGATAAGGAGGAGGAGGAGGG - Intergenic
1052170373 9:25388131-25388153 ATTGCGTAGGCTGAGGAGGAAGG + Intergenic
1052239004 9:26249570-26249592 ATAGAGTGGGAGTAGTGGGAGGG - Intergenic
1052325384 9:27212185-27212207 TTTGAGGAGGAGTAGAAGGCAGG + Intronic
1053173032 9:35904600-35904622 TGTGAGGAGGAGGAGGAGGAAGG - Intergenic
1053352708 9:37424136-37424158 ACTGAGCAGGAGAAGGTGGAAGG + Intronic
1053480548 9:38413437-38413459 AGTCAGTGGGAGGAGGAGGAAGG - Intronic
1055207846 9:73754067-73754089 ATAGTGTAGAAGCAGGAGGAGGG - Intergenic
1056040517 9:82660698-82660720 AAGGAGGAGGAGGAGGAGGAAGG + Intergenic
1056253210 9:84771971-84771993 ATAGAGTAGCAGAAGGAGCAGGG + Intronic
1056975256 9:91247045-91247067 ATTGAGTGTGAGTAGGCTGAAGG - Intronic
1057396046 9:94681449-94681471 GATGAGAAGGAGGAGGAGGATGG - Intergenic
1057546864 9:96025522-96025544 GATGACTAGGAGTAGCAGGAAGG + Intergenic
1058444577 9:105043431-105043453 AAGGAGGAGGAGGAGGAGGAGGG + Intergenic
1058875284 9:109238770-109238792 ATTGAGCAGGAGTTAGGGGAAGG + Intronic
1059147448 9:111913313-111913335 ATTTACTAGAAGTAGGAGGAAGG + Intronic
1059219961 9:112606111-112606133 ATTGATTAGGTGTAGCAGAAAGG + Intronic
1059228512 9:112695747-112695769 GAAGAGGAGGAGTAGGAGGAAGG + Intronic
1059431205 9:114251406-114251428 AGGGAGGAGGAGGAGGAGGAAGG - Intronic
1061435643 9:130559706-130559728 GTTGAGTAGGCTAAGGAGGAGGG + Intergenic
1061726511 9:132584854-132584876 ATGGAGAAGGGGGAGGAGGAAGG + Intronic
1062092580 9:134686221-134686243 AAGGAGAAGGAGAAGGAGGAAGG - Intronic
1062319901 9:135985810-135985832 ATTCAGGAGGAGCAGGAGGAAGG - Intergenic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638406 9:137503569-137503591 AAGGAGAAGGAGAAGGAGGAGGG + Intronic
1185550763 X:981100-981122 ATGGAGGAGGACGAGGAGGAGGG + Intergenic
1185688218 X:1948093-1948115 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185688507 X:2133632-2133654 AAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1185937874 X:4279541-4279563 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic
1186027814 X:5333110-5333132 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1186034478 X:5406171-5406193 AAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1186095834 X:6100897-6100919 ATTGAGAAGGATGAGGAGAAAGG - Intronic
1186124716 X:6400918-6400940 AAGGAGGAGGAGGAGGAGGAAGG - Intergenic
1186299835 X:8188194-8188216 AAGGAGAAGGAGTAGGAAGATGG + Intergenic
1187043885 X:15626115-15626137 ATAGAGTAGGATTAGGCAGAGGG - Intergenic
1187371972 X:18716854-18716876 ATTGAGGAGGAAAATGAGGACGG - Intronic
1187479669 X:19643679-19643701 ATTCAGTAGGAATATGAGAAAGG - Intronic
1188947544 X:36325610-36325632 ATTGAGTAGGGGGAGAAGGTGGG + Intronic
1189725701 X:43966339-43966361 AAAGAGGAGGAGGAGGAGGAAGG + Intronic
1190239254 X:48644598-48644620 AATAAGTAGGAGAAGGAGAAGGG - Intergenic
1191104202 X:56762334-56762356 AGAGAGGAGGAGGAGGAGGAGGG - Intergenic
1192433792 X:71129866-71129888 ATTTAGGAGGTGTGGGAGGAAGG - Intronic
1193102136 X:77626279-77626301 TTGGGGTAAGAGTAGGAGGAGGG + Intronic
1194650367 X:96507169-96507191 GTTGAGTAGGCTGAGGAGGAGGG + Intergenic
1195197291 X:102511718-102511740 ACTGAGTGGGAGTAGGTGAAAGG - Intergenic
1195320512 X:103718062-103718084 AGTGATTAGGAGTAGGAGATTGG - Intronic
1195698342 X:107683268-107683290 ATTTAGTGGGGGAAGGAGGAGGG - Intergenic
1195873635 X:109514580-109514602 ACTGAGGAGGAGGAAGAGGAAGG + Intergenic
1196050325 X:111297596-111297618 ACTGTGGAGGAGAAGGAGGAAGG + Exonic
1196074837 X:111564401-111564423 ATGGAGAAAGAGTAGAAGGATGG - Intergenic
1196810508 X:119625474-119625496 GGTGATTAGGAGTAGCAGGAAGG + Intronic
1197705050 X:129628921-129628943 AGAGAGCAGGAGTAGGAGGATGG + Intergenic
1197767504 X:130068729-130068751 ATGGAGGAGGCTTAGGAGGATGG + Intronic
1197887115 X:131230132-131230154 AATGAGTGGGAGTAGGAGATGGG + Intergenic
1198133977 X:133728338-133728360 AATGAGAAGGAGAAGGAGAAAGG + Intronic
1199077605 X:143542317-143542339 GTTGAATAGGAGTAGGAAAATGG - Intergenic
1199729877 X:150621424-150621446 ATTGTGTAGGATTAGCTGGAAGG - Intronic
1199736618 X:150692357-150692379 AGTGAGGAGGGCTAGGAGGAAGG - Intergenic
1200809476 Y:7467942-7467964 ATTGAGGAGGTTGAGGAGGAAGG + Intergenic
1201461744 Y:14233036-14233058 AATGAGGAGGAGGAGGGGGAGGG - Intergenic
1201502842 Y:14664015-14664037 ATTGAGAAGGATGAGGAGAAAGG + Intronic
1201721396 Y:17101688-17101710 ATTGAGAAGGAAGAAGAGGAGGG - Intergenic
1201775838 Y:17664727-17664749 ATTGAATAGGAGTGGTAAGAGGG + Intergenic
1201825718 Y:18241265-18241287 ATTGAATAGGAGTGGTAAGAGGG - Intergenic