ID: 959919452

View in Genome Browser
Species Human (GRCh38)
Location 3:111854921-111854943
Sequence AGCATTCTTGCCTCTCCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 280
Summary {0: 1, 1: 1, 2: 3, 3: 35, 4: 240}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959919452_959919459 14 Left 959919452 3:111854921-111854943 CCTTGGGGAGAGGCAAGAATGCT 0: 1
1: 1
2: 3
3: 35
4: 240
Right 959919459 3:111854958-111854980 ATGGGCAGGATTTATGGTCAAGG 0: 1
1: 3
2: 10
3: 25
4: 144
959919452_959919453 -5 Left 959919452 3:111854921-111854943 CCTTGGGGAGAGGCAAGAATGCT 0: 1
1: 1
2: 3
3: 35
4: 240
Right 959919453 3:111854939-111854961 ATGCTCTGTGAATCTGCCCATGG 0: 1
1: 0
2: 12
3: 36
4: 186
959919452_959919456 8 Left 959919452 3:111854921-111854943 CCTTGGGGAGAGGCAAGAATGCT 0: 1
1: 1
2: 3
3: 35
4: 240
Right 959919456 3:111854952-111854974 CTGCCCATGGGCAGGATTTATGG 0: 1
1: 1
2: 7
3: 24
4: 224
959919452_959919454 -4 Left 959919452 3:111854921-111854943 CCTTGGGGAGAGGCAAGAATGCT 0: 1
1: 1
2: 3
3: 35
4: 240
Right 959919454 3:111854940-111854962 TGCTCTGTGAATCTGCCCATGGG 0: 1
1: 0
2: 1
3: 25
4: 163
959919452_959919455 0 Left 959919452 3:111854921-111854943 CCTTGGGGAGAGGCAAGAATGCT 0: 1
1: 1
2: 3
3: 35
4: 240
Right 959919455 3:111854944-111854966 CTGTGAATCTGCCCATGGGCAGG 0: 1
1: 0
2: 2
3: 34
4: 220
959919452_959919460 29 Left 959919452 3:111854921-111854943 CCTTGGGGAGAGGCAAGAATGCT 0: 1
1: 1
2: 3
3: 35
4: 240
Right 959919460 3:111854973-111854995 GGTCAAGGTTGTTTTGACCCAGG 0: 1
1: 0
2: 1
3: 13
4: 121
959919452_959919461 30 Left 959919452 3:111854921-111854943 CCTTGGGGAGAGGCAAGAATGCT 0: 1
1: 1
2: 3
3: 35
4: 240
Right 959919461 3:111854974-111854996 GTCAAGGTTGTTTTGACCCAGGG 0: 2
1: 11
2: 21
3: 53
4: 233

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959919452 Original CRISPR AGCATTCTTGCCTCTCCCCA AGG (reversed) Intronic
900377031 1:2359546-2359568 AGCCATCTTGCCTCCACCCACGG - Intronic
900495518 1:2974309-2974331 GGCATTCTTCCCTCCACCCATGG + Intergenic
900715950 1:4144032-4144054 AGCACTCTGGCCTCTGCCCTTGG + Intergenic
901397239 1:8990177-8990199 GCCAGTCCTGCCTCTCCCCAGGG - Intergenic
903030258 1:20458968-20458990 AGCATTCTACCCTCTGGCCATGG - Intergenic
903055336 1:20632555-20632577 AGCATTCTTGCCTTTCCCTGGGG + Intergenic
903484994 1:23683005-23683027 AGCATTTTTGCCTTTCCCAGAGG - Intergenic
904121625 1:28202109-28202131 AGCTTTCTTCCCACTCCCAAGGG + Intronic
904354038 1:29926959-29926981 AGCAGTGTTGCCCCTCCCCCAGG - Intergenic
904767516 1:32861904-32861926 ACAATTCTTGTTTCTCCCCAGGG - Intergenic
905683710 1:39893553-39893575 AACATTCATGCCTGTACCCATGG + Intergenic
906038034 1:42765250-42765272 AGCCTTCTTTCCTCTCCCCCTGG + Intronic
906216488 1:44043935-44043957 AGCTTTCCTGCCTGCCCCCAGGG + Intergenic
906592011 1:47033850-47033872 AGCATGTATGCCCCTCCCCATGG - Intronic
906694578 1:47815412-47815434 AGCAGTCCTCCCTCTGCCCAAGG - Intronic
907415300 1:54310262-54310284 GGCTTTCTTCTCTCTCCCCAGGG + Intronic
908186215 1:61655259-61655281 GTCACTCTTCCCTCTCCCCATGG - Intergenic
909786271 1:79617765-79617787 AGCATTCTTGCTTTTCCCTGAGG - Intergenic
910080085 1:83331235-83331257 AATATTCTTGCCTCTATCCAGGG + Intergenic
912458752 1:109817520-109817542 AGCCTCCTTTCCTCTCCTCATGG + Intergenic
913371834 1:118108106-118108128 TGCATTCTGCTCTCTCCCCATGG + Intronic
913541126 1:119822214-119822236 AGCAGACTTGCCTCTCCTCCTGG - Intergenic
914894284 1:151654475-151654497 TGGTTTCCTGCCTCTCCCCAGGG + Intronic
915245708 1:154555099-154555121 TGCATTCTTGGTTCTCACCAAGG + Intronic
916961087 1:169890873-169890895 AGCATTGTTGCTTTTACCCATGG - Intronic
917673013 1:177291908-177291930 AACATTCTTAGCTATCCCCAAGG + Intergenic
920310396 1:205044877-205044899 AGCATCCAAGCCCCTCCCCAGGG + Intronic
920572151 1:207025191-207025213 AGCATTCCTTCCTCTCTGCAGGG - Intronic
920959387 1:210651209-210651231 AGAATTATTGCCTCTCCACAGGG + Intronic
921049749 1:211502527-211502549 AGCATTCTTGCCTTTCCCTGAGG - Intergenic
921287303 1:213620831-213620853 ACCATTACTGCCTCTCCCTAGGG + Intergenic
924378433 1:243438016-243438038 AGGTTTCTTGCCCCTCCCCCGGG + Intronic
1062830614 10:602952-602974 AGCACTCTTGCCTCCCCCAACGG - Intronic
1062880269 10:972798-972820 CGCATTCTTTCCCCTCTCCAAGG + Intergenic
1062975143 10:1677502-1677524 CCCATTGTTGCCCCTCCCCAGGG - Intronic
1063124770 10:3128533-3128555 AACATTCTGGCCTCAGCCCATGG - Intronic
1067087361 10:43249974-43249996 AGCACTGTGCCCTCTCCCCAGGG - Intronic
1067556339 10:47275984-47276006 AGCAATTTAGCTTCTCCCCATGG - Intergenic
1069578666 10:69549329-69549351 AGCATTCTTGCCTTTCCCTGAGG + Intergenic
1069915268 10:71783251-71783273 ACCATTCTTGCCTCTCCAGCTGG + Intronic
1070355155 10:75632657-75632679 AGCATGGTTCCCTCTCCACAAGG - Intronic
1071372237 10:84963747-84963769 AACAGTCTTGACTCTCCCCTAGG + Intergenic
1072237452 10:93465843-93465865 AGCCTCCTTGCATCCCCCCAGGG + Intronic
1073085785 10:100887798-100887820 AGCATTCTTGCCTCTTCCGGAGG - Intergenic
1073097002 10:100985964-100985986 AGCCTTCCTGCCCTTCCCCAAGG + Intronic
1074085602 10:110207442-110207464 GGCTTCCCTGCCTCTCCCCAAGG - Intergenic
1074850024 10:117432308-117432330 AGTCATCTGGCCTCTCCCCAAGG - Intergenic
1075031304 10:119026365-119026387 AGCCTTCTTGCCTCCCAACATGG - Intergenic
1075069205 10:119309389-119309411 AGCATGCTTCCCTCCCACCAAGG - Intronic
1077470059 11:2753440-2753462 AGCTTTCCTGGCTCTGCCCAGGG - Intronic
1078349797 11:10583213-10583235 AGCAATCTTGTCTATCCCCGTGG - Intronic
1078795624 11:14589628-14589650 AGCATTCTTACCTTTCCCTGAGG - Intronic
1078904786 11:15673590-15673612 AGGATTCCTGGCTCTCCACATGG + Intergenic
1081118804 11:39238204-39238226 AGGATTCTTGCCTGTCCTCACGG - Intergenic
1081196070 11:40162216-40162238 AGCTTTGTTGTCTCTCCACAGGG + Intronic
1082241209 11:49872962-49872984 ACCATTTTTGCCTCTCTCAATGG + Intergenic
1084597634 11:70126541-70126563 AGCATTCATGCCTCACCTCCCGG - Intronic
1087618910 11:100520239-100520261 AGCATCCTTGCCTCTTCCTGAGG - Intergenic
1089096991 11:115927458-115927480 GGCATTCAAGCCCCTCCCCAAGG - Intergenic
1089576957 11:119451625-119451647 AGCAGACTTCCCTCTGCCCAAGG + Intergenic
1090641512 11:128733238-128733260 AGCATTCTTTACACTCCCCAAGG - Intronic
1091108341 11:132943329-132943351 AGCTTTCTTGACGCTCCCCTGGG + Exonic
1092455542 12:8639508-8639530 AGCATTCTTGCCTTTCCCTGAGG + Intronic
1096655715 12:53090286-53090308 GGCTTTCTTGCCTCTTCCCAGGG - Intergenic
1096890008 12:54760228-54760250 AGCATTCCTGCCTCAACTCATGG - Intergenic
1097750435 12:63346690-63346712 AACATTCTTGTCTAACCCCAAGG + Intergenic
1098152159 12:67557906-67557928 ACCCTTGCTGCCTCTCCCCAAGG + Intergenic
1098821373 12:75234476-75234498 AGTATTATTTCCTGTCCCCATGG - Intergenic
1098877973 12:75886708-75886730 AGCATTATTGTCTCTCTCCGAGG + Intergenic
1099689623 12:85936532-85936554 AATATTTTTGCCTCTCCCCCTGG - Intergenic
1102735533 12:115155956-115155978 AGCTTCCGTGCCTCTCCCCACGG + Intergenic
1102899151 12:116622808-116622830 GGCTTCCGTGCCTCTCCCCATGG + Intergenic
1105330473 13:19411141-19411163 TGAACTCTTGCCTCCCCCCAGGG + Intergenic
1105918552 13:24939927-24939949 TGAACTCTTGCCTCCCCCCAGGG + Intergenic
1106393703 13:29360091-29360113 AGCATCCCAGCCTTTCCCCAGGG + Intronic
1107482031 13:40793137-40793159 TGAACTCTTGCCTCCCCCCAGGG + Exonic
1108832880 13:54500533-54500555 AGGATTCATGCCTTCCCCCATGG + Intergenic
1110775987 13:79408489-79408511 AGCATTCTTGCCTGTCTGGAGGG - Intergenic
1110800171 13:79684958-79684980 TGGATTCTTGCCTCTGCCCTTGG + Intergenic
1112953291 13:105029432-105029454 AGCTCTCTTGCCTATCGCCATGG - Intergenic
1117109206 14:52431276-52431298 AGCATTCTGCCATCTCCTCATGG - Exonic
1117976483 14:61302275-61302297 AGCATTCTTGCCTTTCCCAGAGG + Intronic
1120349286 14:83331654-83331676 AGCATTCTTGCCTGTCTGGAGGG - Intergenic
1121280200 14:92692405-92692427 GGCATTTGTCCCTCTCCCCATGG + Intergenic
1121415304 14:93775147-93775169 TGCATTCTTGCCACTCACAAGGG - Intronic
1121784779 14:96649291-96649313 AGCATACTTGCATCACCCTAAGG - Intergenic
1121933642 14:97996384-97996406 AGCATTCTTTCCTTTTCCAATGG + Intergenic
1122172584 14:99889256-99889278 AGCAATCCTGCCTCTCCCCGGGG - Intronic
1124399020 15:29332559-29332581 AGCATGCTTGCTTCTTACCACGG - Intronic
1125181645 15:36886183-36886205 AGCATTCTAAACTCTTCCCAGGG - Intergenic
1125249026 15:37678146-37678168 ACTATTCCTGCCTCCCCCCATGG - Intergenic
1128835743 15:70807769-70807791 AGCATCCAAGACTCTCCCCAGGG - Intergenic
1132861216 16:2072710-2072732 AGCCTTCTTGCCTCCCTCCCAGG - Intronic
1133557121 16:6916132-6916154 ATCATTCTTGCCTCTCCTGGAGG - Intronic
1133816251 16:9199531-9199553 AGCCTTCCTGCCTCTGCCCCAGG + Intergenic
1135154707 16:20042384-20042406 AAGATTCTAGCTTCTCCCCATGG + Intronic
1135284818 16:21184471-21184493 AGCATTCTTGCCTGTCCTGAAGG + Intergenic
1135854294 16:25992724-25992746 AGCATTGTTGGCTTTCTCCAGGG + Intronic
1135888634 16:26336930-26336952 AGCTTTCTTGTCTTTCCCCCAGG + Intergenic
1137669723 16:50272092-50272114 CCCATTCTTGCCTCCTCCCAGGG + Intronic
1138892369 16:61159755-61159777 AATATTCGTGCCTCTCCCAATGG + Intergenic
1138903758 16:61305129-61305151 ACCATACTTGACTCTCTCCATGG - Intergenic
1139515195 16:67448732-67448754 AAAAGTCCTGCCTCTCCCCAAGG + Intronic
1139581682 16:67877590-67877612 AGCAGTCTTCGCTCTCCTCAGGG - Exonic
1139836608 16:69843895-69843917 AGCATTATTCCCCCTCCCTAGGG - Intronic
1140639777 16:76958517-76958539 AGCAATATCGCCTCTGCCCAAGG + Intergenic
1140910664 16:79448875-79448897 ACCATCCCTGCCTCCCCCCAAGG - Intergenic
1141075784 16:81005871-81005893 AGCATTCTTGCCAATGCACATGG + Intronic
1141266830 16:82505571-82505593 AGCCATCCTGCCACTCCCCAAGG + Intergenic
1141720424 16:85752396-85752418 GGCTTTCTAGCCCCTCCCCAGGG - Intergenic
1142202701 16:88768673-88768695 TCCATCCTGGCCTCTCCCCAGGG - Intronic
1142266944 16:89068306-89068328 AGCATTGCTGCAGCTCCCCAAGG + Intergenic
1142384806 16:89756924-89756946 AGCATTCTTGCCTTTCCCTGAGG - Intronic
1143758466 17:9083877-9083899 AGCATATCTGTCTCTCCCCAAGG - Intronic
1144020254 17:11234669-11234691 GCCATTCTTGCCTCTTCCCAGGG + Intergenic
1145304528 17:21666110-21666132 AGCCCTCTGGCCTGTCCCCAGGG + Intergenic
1146823298 17:36001605-36001627 AGCATTCTGACCTCTGCCCTGGG - Exonic
1146919796 17:36702995-36703017 AGGATACTTGCCTCTCGCCCTGG + Intergenic
1147138907 17:38450865-38450887 AGCCTTCAAGCCCCTCCCCAGGG + Intronic
1148804118 17:50255690-50255712 AGCATTCTTGCCTTTCCCCAGGG - Intergenic
1148842749 17:50509132-50509154 TTCATTCTTTCCTCTTCCCAAGG - Intronic
1151244428 17:72783644-72783666 GGCATTCTTCCCTGCCCCCACGG - Intronic
1151691427 17:75688429-75688451 AGCATTCTTGCCTGTGGCCTCGG + Intronic
1203169712 17_GL000205v2_random:136497-136519 ATCCTTCCTGCATCTCCCCAAGG + Intergenic
1153435833 18:5067045-5067067 AGCATTCTTGCCTTTCCCGGAGG + Intergenic
1153543212 18:6179533-6179555 AGCATTCTTGCCCCACAGCAGGG - Intronic
1153789299 18:8563312-8563334 AGCAGGCCAGCCTCTCCCCATGG + Intergenic
1155551532 18:26970844-26970866 AGAAATCTGGCCTCTACCCATGG + Intronic
1157513295 18:48294075-48294097 AGCTTGCTTGCCCTTCCCCAGGG - Intronic
1159322087 18:66865899-66865921 ATCATTCTTTACTCTTCCCAGGG - Intergenic
1159495759 18:69201716-69201738 AGCATTCTTTGCTCTGCCTATGG + Intergenic
1159999574 18:75003948-75003970 AGCATTCTTACAGGTCCCCAGGG - Intronic
1160341604 18:78094114-78094136 AGGATTCTCGCCTTTGCCCAGGG + Intergenic
1164418045 19:28062545-28062567 GGCATTCTTACCTGTCCTCATGG - Intergenic
1165351385 19:35277753-35277775 AGCGTTCTTTCCTGTCCCCACGG + Intronic
1165784937 19:38455790-38455812 TGAATGCTGGCCTCTCCCCAGGG + Intronic
1168454420 19:56495258-56495280 AGCATTCTTGCCTTTCCCTGAGG + Intergenic
925794408 2:7526892-7526914 AGGACTCCTGCCTCTTCCCAGGG + Intergenic
925998106 2:9308288-9308310 CTCATTCTTGCCCCTGCCCACGG - Intronic
926911903 2:17859315-17859337 AGCATTCTTGCCTTTCCCTGAGG + Intergenic
927558403 2:24051398-24051420 ATGATTCTTCCCTCTCCCCCAGG + Intronic
927841872 2:26449975-26449997 TGCCTTCTTCCTTCTCCCCAGGG + Exonic
931092075 2:58896923-58896945 ATCAGTCCTGCCTCTCCACATGG + Intergenic
931335471 2:61337782-61337804 AGCATTCTTGACTCTGCCTTTGG + Intronic
932153954 2:69398582-69398604 AGCATTCTTGCCTTTTCCAGAGG + Intronic
934759048 2:96843413-96843435 AGCACCCTTCCCTATCCCCAAGG + Intronic
936987755 2:118327759-118327781 AGCATTATTCCCTATTCCCATGG - Intergenic
937436452 2:121885700-121885722 CTCACTCTTCCCTCTCCCCATGG - Intergenic
937965091 2:127500039-127500061 AGAATTTTTGCCTGTCCCCAAGG - Intronic
938669617 2:133574353-133574375 AGCATCCCTGCCTCTTCCCTGGG - Intergenic
939140342 2:138346661-138346683 AGCTTTCTAGCCATTCCCCAAGG + Intergenic
939715407 2:145578030-145578052 AGCATTTTTGCCACCCCCAAAGG + Intergenic
940817839 2:158315896-158315918 TGCACTCTGGCCTTTCCCCATGG + Intronic
941320211 2:164045473-164045495 AGCATTCTTGCCTCTGAAAATGG - Intergenic
941994806 2:171592223-171592245 ATCCTTTTTGTCTCTCCCCAGGG - Intergenic
944079341 2:195769523-195769545 AGCATTATTGCCTTTCCCTGAGG + Intronic
944302276 2:198137577-198137599 AGGATTCTTGCCTCTCCTCCAGG + Intronic
945157785 2:206857790-206857812 AGCATTTTTGTCCATCCCCAGGG - Intergenic
945446200 2:209941313-209941335 AGCATGATTTCGTCTCCCCATGG - Exonic
945492799 2:210476271-210476293 TGCATCCCTGCCTCTCCCCACGG - Intronic
946006318 2:216527829-216527851 AGCATTCTTGCCTTTCCCTAAGG - Intronic
947831085 2:233142319-233142341 AACGTTCTTTCCTCTCCTCAAGG - Intronic
948186558 2:236026047-236026069 AGCATTCATACCTGTCCACAGGG + Intronic
948280943 2:236747671-236747693 AGCACTCAGGCCTGTCCCCAGGG - Intergenic
948434091 2:237940952-237940974 AGCATTCTTGCCCTTCCCTAGGG - Intergenic
948502333 2:238404864-238404886 TGCATTCCTGCCCCTCCCCCAGG + Intergenic
1169068367 20:2707135-2707157 ACCATTCTTCCCTCTGCCCTGGG - Intronic
1169310639 20:4535900-4535922 AACATTGTTCCCTCTCCCCATGG - Intergenic
1171489954 20:25509892-25509914 AGCCTTTGTTCCTCTCCCCAGGG + Intronic
1172307047 20:33888280-33888302 ATCTTTCTTGCCTCTTCCTAGGG + Intergenic
1173335215 20:42106987-42107009 AGCATTCAGCCCTATCCCCAAGG + Intronic
1173742172 20:45408512-45408534 AGAATTTTTGCCGCTCCCGAAGG - Exonic
1174305640 20:49612475-49612497 TGCATTTTTGCCCCACCCCAGGG - Intergenic
1175690575 20:61062981-61063003 GACATTCTTGCCTTTCCCCAAGG - Intergenic
1176177873 20:63737246-63737268 AGCTGTCTTGCCCCTCCTCACGG + Intronic
1176655847 21:9588537-9588559 AGCCCTCTGGCCTGTCCCCAGGG + Intergenic
1177082473 21:16657666-16657688 AGCATTCTTTTTTCTCCGCATGG - Intergenic
1178514676 21:33236531-33236553 AGCACTCCAGCCTCGCCCCATGG - Intronic
1180564416 22:16650697-16650719 TGAACTCTTGCCTCCCCCCAGGG - Intergenic
1180618722 22:17145896-17145918 AGCTGGCTTGCCCCTCCCCAAGG - Intronic
1182325652 22:29510805-29510827 TGCATCCTCGCCTGTCCCCAGGG - Intronic
1183336805 22:37253304-37253326 AGCATTTTCCCCTCTCCCCACGG + Intergenic
1184991649 22:48174350-48174372 AGCATTCCTGGCTCTGCCTAGGG - Intergenic
951367718 3:21804966-21804988 ATCAATCTTGCTTCTGCCCAGGG - Intronic
951401805 3:22241677-22241699 AGCATTCTTGCCTCCTCTCCAGG - Intronic
951542122 3:23791560-23791582 AGAATTCTTGCCACTCCCAGAGG - Intergenic
952705087 3:36369174-36369196 AGCACTCTTGCCTTTCCCTGGGG + Intergenic
952917587 3:38260815-38260837 AGCCTCCTTTCCTCTGCCCAAGG + Intergenic
953151662 3:40330624-40330646 AGCATTCATGCATCTTGCCATGG - Intergenic
953302616 3:41794004-41794026 AGATTACTGGCCTCTCCCCAGGG + Intronic
953795998 3:45986452-45986474 AGGATTCCTGCCTCTGCCCGAGG + Intronic
956167096 3:66405277-66405299 TGCTTTCTGTCCTCTCCCCAGGG - Exonic
959582664 3:107997808-107997830 AGCATTTCTGCTTCTCCCCATGG + Intergenic
959919452 3:111854921-111854943 AGCATTCTTGCCTCTCCCCAAGG - Intronic
960025313 3:113002591-113002613 AGCATTCTTGCCTTTCCCTGAGG - Exonic
960460650 3:117930687-117930709 AGCCTTCTTGCATCTCCGAAAGG + Intergenic
961349701 3:126292053-126292075 AGCATTCATTCCAGTCCCCAAGG + Intergenic
961851374 3:129822653-129822675 AGCATTCTTGCCTCTTTACCTGG - Intronic
962147804 3:132858819-132858841 AGCGTTCTTGCCTTTCCCTGAGG + Intergenic
963870739 3:150410585-150410607 AGCATTCTGGCCGGTGCCCACGG - Exonic
965472902 3:169117218-169117240 ACCTTTATTGCCTCTCCCCTTGG + Intronic
967409997 3:189157656-189157678 AGCATCCTTGACCCTCCCGAAGG + Intronic
967601547 3:191396022-191396044 AATATTCTTACCTCTCGCCATGG - Intronic
967791793 3:193557802-193557824 AGCATTTTTGGCTCTTTCCAAGG - Intronic
968569748 4:1333409-1333431 AGCTTCCTTGCCTGTCCCCCTGG + Intronic
968845828 4:3041115-3041137 GGCATTCCTGCATCTCCCGATGG + Intergenic
969671099 4:8590851-8590873 AGTCTACTGGCCTCTCCCCAGGG + Intronic
969851269 4:9958708-9958730 GGGATTCTTGCCTCTCTCCTGGG - Intronic
971751514 4:30655757-30655779 AGCCTTCTTCCCTCTCTCCTAGG + Intergenic
973930654 4:55790348-55790370 AGCATTCCTGCCTTTCCCTGAGG + Intergenic
982220410 4:153119793-153119815 AACATTCTTGCCTGTTCCAAAGG - Intergenic
982304494 4:153915994-153916016 AGCAATCTTGCCTCTGCTTAGGG + Intergenic
983248567 4:165318299-165318321 AGGATTCCTACATCTCCCCATGG + Intronic
985873261 5:2575719-2575741 AGCATTCTTTACTCTTCCCATGG - Intergenic
987770351 5:22294480-22294502 AGCATTCATGCCTTTCCCTGAGG - Intronic
990839453 5:60060558-60060580 AGCATGCTTGCCTTTCCCTGAGG + Intronic
990872107 5:60443500-60443522 AGCATTCTTTTCTCTACCCTGGG - Intronic
991605240 5:68394585-68394607 AGCATTCTTGGGTGTCCCCCAGG + Intergenic
992148139 5:73873602-73873624 GGCATTCTAGCATCTACCCAGGG - Intronic
992186568 5:74250249-74250271 AGCACCCTTGTGTCTCCCCATGG - Intergenic
993232619 5:85256289-85256311 AGCATTTCTGCCTGTCACCAGGG + Intergenic
995468861 5:112479139-112479161 AGCATTCTTCTCTCTCCCACTGG + Intergenic
997585395 5:135040349-135040371 TGCCTTCTTCCCTCTCCTCAGGG + Intronic
997849520 5:137318512-137318534 AGCACTCTTACCTCTTCTCAAGG - Intronic
998562426 5:143183946-143183968 TGCCTTCTTTCCTCTCCTCATGG + Intronic
1000322506 5:160146031-160146053 AGGATTCTTGCATCTCTCTAAGG - Intergenic
1000654441 5:163859342-163859364 AGCACTCTTGCTTCTCCCTGAGG - Intergenic
1002786516 6:404401-404423 AGACTTCTTGCCTGTCTCCAGGG - Intronic
1003850260 6:10215308-10215330 AGCTTTCCTGCTTCTCACCAGGG + Intergenic
1005589363 6:27309288-27309310 AGAAATGCTGCCTCTCCCCAAGG + Exonic
1007369047 6:41414131-41414153 AGCTTACTTGCCTCCCCCCTGGG + Intergenic
1007836257 6:44676333-44676355 TGCATTCATGCTTCTCTCCAGGG - Intergenic
1008054573 6:46933103-46933125 CACATTCTTCCTTCTCCCCAAGG - Intronic
1010647408 6:78407322-78407344 AGCATTCTTGCCTCTTCTGGAGG - Intergenic
1014670977 6:124303471-124303493 AGCATTCTTGCCTGTTCTCAAGG - Intronic
1017403153 6:154087660-154087682 AGCATCCTTGCCATTCACCATGG + Intronic
1017829794 6:158115840-158115862 AGCATTCTTGGGTGGCCCCAGGG - Intronic
1017979716 6:159390195-159390217 AGAAGGCTTGCCTCTCCCCCTGG + Intergenic
1018312972 6:162529733-162529755 AGCATTCTTGCCTTTCCCTAGGG - Intronic
1018784963 6:167100898-167100920 AGCACTCTTGCCTTTCCCTGGGG - Intergenic
1018852024 6:167647643-167647665 AGCATGCTTTCCTCTGCCCCTGG - Intergenic
1018950217 6:168374175-168374197 AGGATTCTTGGCTCAACCCAGGG + Intergenic
1020421180 7:8007073-8007095 AGCAGCCATGCCCCTCCCCATGG - Intronic
1021218040 7:17940769-17940791 GGCATTTTCTCCTCTCCCCAGGG - Intergenic
1022482273 7:30752055-30752077 AGCATTCCAGCCTCATCCCATGG - Intronic
1026881342 7:73908524-73908546 ATCCTTCTGGCCTCTCCGCAAGG + Intergenic
1027297855 7:76796513-76796535 AGTATTCTTGCCTCTATCCAGGG + Intergenic
1030590581 7:111476733-111476755 AGCCTGCTTTCCTCTGCCCATGG + Intronic
1032223402 7:130011055-130011077 AGCATTCTTGCCTGGCACCGAGG + Intergenic
1032540827 7:132701603-132701625 AGGTTTATTGCCTTTCCCCAGGG - Intronic
1033292770 7:140101940-140101962 ATAATACTTGCCTCTTCCCATGG + Exonic
1033975426 7:147094714-147094736 AGCCTTCCAGCCTCTGCCCATGG + Intronic
1035817794 8:2560039-2560061 ACCATTTTTGCCTCCCCCCAGGG - Intergenic
1036092218 8:5679237-5679259 ACGATTCTTGCCTCTGCCCCTGG - Intergenic
1036199322 8:6754143-6754165 AACATTCTTACCTGTCCACAGGG + Intronic
1036507415 8:9368060-9368082 AGCATTCTTGCCTCTTCTGGAGG - Intergenic
1039443548 8:37612347-37612369 AGCCTTCCTCCTTCTCCCCATGG - Intergenic
1040035158 8:42862922-42862944 AGCATTCTTGCACCTGCCCCAGG - Intronic
1041621129 8:59970672-59970694 AGCATTCTTGCCTTTCCCTGAGG + Intergenic
1042745302 8:72100339-72100361 TGCATTGTTACCTCTCACCAGGG - Intronic
1042863236 8:73334361-73334383 AGCATTCTTGCTTTTCCCTGAGG + Intergenic
1043918245 8:85950096-85950118 ATAATTCTTGCCTCTCACCCAGG - Intergenic
1044703937 8:94990309-94990331 AGAATGGTTGCTTCTCCCCAAGG - Intronic
1048475482 8:134738799-134738821 ACCATGCTTGGCTCTCCCCCTGG - Intergenic
1049150367 8:141031306-141031328 GGCATTCTTGTATCACCCCATGG + Intergenic
1049328445 8:142037054-142037076 AGCATTCCTGTCTCTGCCCCTGG - Intergenic
1050682296 9:8126211-8126233 ATCATTCTAGCCTCTACCAAGGG + Intergenic
1052782345 9:32794485-32794507 AGCATTCTTAGCCCTACCCAAGG + Intergenic
1057174860 9:92988736-92988758 AACATTCTTGCCTTTCCCTGAGG + Intronic
1059417815 9:114172862-114172884 GAAATTCTTTCCTCTCCCCAGGG + Intronic
1059827574 9:118049002-118049024 ATCATTCTAGCCTCTTCCCTTGG + Intergenic
1061884067 9:133582805-133582827 AGCACTCATGTCTCTACCCAAGG - Intronic
1062284193 9:135765871-135765893 AGCATTATAGACTATCCCCAGGG + Intronic
1203633564 Un_KI270750v1:91998-92020 AGCCCTCTGGCCTGTCCCCAGGG + Intergenic
1185870269 X:3658837-3658859 AGCATCCTTCCCTGTCCTCAGGG - Intronic
1186363207 X:8864014-8864036 AGCCTTCTTGCCTTTCCCTGAGG - Intergenic
1194874042 X:99164296-99164318 GGGTTTCTTGCCTCTCCCCCAGG + Intergenic
1195553667 X:106197126-106197148 ATCATTCTTTCCTCTCCCCATGG + Intronic
1198682275 X:139195337-139195359 TGTATGCTTGCCTCTCCCCTTGG - Intronic
1202600847 Y:26591669-26591691 TGAAATCTTGCCTCCCCCCAGGG - Intergenic