ID: 959919629

View in Genome Browser
Species Human (GRCh38)
Location 3:111856652-111856674
Sequence TGTGTAGTCAAGTGTATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 169}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959919626_959919629 16 Left 959919626 3:111856613-111856635 CCTTAGACCTGAAGGGAGAAAGG 0: 1
1: 1
2: 4
3: 46
4: 285
Right 959919629 3:111856652-111856674 TGTGTAGTCAAGTGTATTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 169
959919628_959919629 9 Left 959919628 3:111856620-111856642 CCTGAAGGGAGAAAGGTTGTCTC 0: 1
1: 0
2: 4
3: 25
4: 277
Right 959919629 3:111856652-111856674 TGTGTAGTCAAGTGTATTTCTGG 0: 1
1: 0
2: 1
3: 16
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959919629 Original CRISPR TGTGTAGTCAAGTGTATTTC TGG Intronic
905041336 1:34961593-34961615 TGTTTAGCAATGTGTATTTCAGG + Intergenic
906664580 1:47610765-47610787 TGTGTAGTAACTTCTATTTCTGG - Intergenic
909347394 1:74607195-74607217 TGTGTCTTCAAGTATATTTTTGG + Intronic
909700455 1:78515491-78515513 AGTGTAGTCAAATGTATATGTGG + Intronic
912015306 1:105027193-105027215 TGTGTAGAGAAATGTTTTTCAGG - Intergenic
913364092 1:118016407-118016429 TGTGTAAGCATGTGTATGTCTGG - Intronic
913473124 1:119210227-119210249 GGTGTAGTCTAGGGTATCTCTGG + Intergenic
914856438 1:151354952-151354974 TGTATAGTTAGGTGTATTTCTGG + Intergenic
916280223 1:163042703-163042725 TGTGTAGGTTAGTTTATTTCTGG + Intergenic
918060548 1:181057351-181057373 AATGTAGGCAAGTTTATTTCTGG + Exonic
923411300 1:233712684-233712706 TGTGTCTGCAAGGGTATTTCTGG + Intergenic
1063464845 10:6236458-6236480 TGGGGAGTCAAGGCTATTTCTGG - Intergenic
1066342482 10:34549641-34549663 TGTGTAATTGAGTGTATTTTAGG - Intronic
1066645448 10:37603013-37603035 TATGTAGTTAAGTGTTTTTGTGG + Intergenic
1068162933 10:53290645-53290667 TGTAGAGTCAAGTTTATATCTGG - Intergenic
1068296987 10:55083842-55083864 TGTTTGGTTAAGTTTATTTCTGG - Intronic
1068431797 10:56942625-56942647 TTAGGAGTCAAGTGAATTTCTGG + Intergenic
1068586528 10:58805902-58805924 GATGTAGTCAAGTGTATGTGAGG - Intronic
1068725141 10:60292496-60292518 AGTGTAATCATGTTTATTTCAGG + Intronic
1068800108 10:61131114-61131136 TATTTGGTGAAGTGTATTTCTGG + Intergenic
1072962944 10:99946258-99946280 TGTGTATTCAAAAGCATTTCTGG - Intronic
1074443289 10:113497428-113497450 TGAGTAGGCAAGGGTATTACAGG + Intergenic
1083268182 11:61556767-61556789 TGTGTAGTCAAAGGAATCTCTGG + Intronic
1086526959 11:87738923-87738945 TTTGTAATAAAGTTTATTTCTGG - Intergenic
1088134128 11:106533020-106533042 TCTGAAGTAAATTGTATTTCAGG + Intergenic
1089714454 11:120344388-120344410 TGTGTTAGCAAGTGTATTTGGGG - Intronic
1090691149 11:129183524-129183546 TTTGTTGTTAAGTTTATTTCTGG + Intronic
1093744578 12:22725465-22725487 TGTATAGACAAGTTTCTTTCAGG - Intergenic
1095744535 12:45642989-45643011 TGTGCAGTTAGGTTTATTTCTGG + Intergenic
1095881664 12:47143891-47143913 TGCCTAGTAAAGTTTATTTCTGG - Intronic
1098596386 12:72276765-72276787 TGTGTAGACATGTGGATTTTAGG - Intronic
1102320986 12:111933970-111933992 TGTGAAGTCAACTGGCTTTCTGG - Exonic
1103136824 12:118514672-118514694 TGGGTCTGCAAGTGTATTTCTGG - Intergenic
1104537292 12:129629883-129629905 TGTGTAGTCAAATGTGGATCTGG + Intronic
1104547542 12:129725953-129725975 TGAGAAGGCAAGTGTATGTCTGG - Intronic
1106699705 13:32216324-32216346 AGTGTAGCAAAGTGTATGTCTGG - Intronic
1107388463 13:39938769-39938791 TTTGGAGTCATGTGTATTTGGGG - Intergenic
1108450364 13:50556534-50556556 TATGTAGTCAAGTTTATGACCGG + Intronic
1108753821 13:53476020-53476042 TGTGTATTGAAGTATATTTAGGG - Intergenic
1109267770 13:60220891-60220913 TGTGTAGCCATTTCTATTTCTGG - Intergenic
1109362952 13:61320486-61320508 TAAGTAGTCAAGTGTTTTTCGGG + Intergenic
1109554940 13:63960812-63960834 TGTTTAGTCACTGGTATTTCAGG + Intergenic
1109714148 13:66199239-66199261 TATGTGGACAAGTGTATTTTTGG - Intergenic
1113369058 13:109706058-109706080 CGTGTTCTCAAGTGCATTTCAGG - Intergenic
1114915791 14:27263634-27263656 TGTCTAGTCAACTGTCTTCCTGG - Intergenic
1117645432 14:57846583-57846605 TCTGTATACAAGTGAATTTCAGG - Intronic
1122088968 14:99325632-99325654 TGTGTGGGCAAGGGTATTTCCGG - Intergenic
1202845686 14_GL000009v2_random:171837-171859 AGTGTAGTCAAGTGTAATTTAGG - Intergenic
1202915082 14_GL000194v1_random:162105-162127 AGTGTACTCAAGTGTAATTTAGG - Intergenic
1202877597 14_KI270722v1_random:20613-20635 AGTGTAGTCAAGTGTAATTTAGG + Intergenic
1127833505 15:62771349-62771371 TGTGTAGACAAGTGTCCTTGGGG + Intronic
1128116139 15:65107055-65107077 TGTCAAGTTAAGTTTATTTCAGG + Intronic
1128954799 15:71928434-71928456 TGTGTATTCATATGAATTTCAGG + Intronic
1130294771 15:82638068-82638090 TGTGTTGTCATGTGTTATTCTGG + Intronic
1131464002 15:92639998-92640020 TGTGTATTTGGGTGTATTTCTGG - Intronic
1131592317 15:93762821-93762843 TGGGTAGACAAGTGCACTTCTGG - Intergenic
1137640989 16:50028758-50028780 TGTGTAATATAGTGCATTTCTGG + Intronic
1138850656 16:60625853-60625875 TGTATAGTAAATTGTATTTAAGG - Intergenic
1139197448 16:64937001-64937023 TATGTAGTCATGTGCATTGCTGG + Intergenic
1139342806 16:66280053-66280075 TGTATACTTAAGTGTATTTTTGG - Intergenic
1143887662 17:10076862-10076884 TGTTTAGTCAAGTCCATTGCAGG - Intronic
1144166458 17:12615940-12615962 TGTGTGGTCAGGTGTACTGCTGG + Intergenic
1146240628 17:31219708-31219730 TGGGGAGTCAAGTTTCTTTCTGG - Intronic
1147718044 17:42521297-42521319 TGTGTAGTGTAGTGATTTTCTGG + Exonic
1150830690 17:68516869-68516891 TTTGAAGTCAAGTGCATTCCTGG + Intronic
1153118290 18:1687813-1687835 CCTGTATTCAAGTGTTTTTCAGG + Intergenic
1158022685 18:52861825-52861847 CCTGTATTCAAGAGTATTTCAGG + Intronic
1159005965 18:63012076-63012098 TGTGTAGTTTAGTCTATTTCTGG + Intergenic
1161099130 19:2412008-2412030 TTTGTGGTTAACTGTATTTCAGG + Intronic
1165365251 19:35361396-35361418 TGTGTGGGGAAGTGGATTTCAGG + Intergenic
1202673084 1_KI270710v1_random:12331-12353 AGTGTAGTCAAGTGTAATTTAGG - Intergenic
926809788 2:16746080-16746102 TGTGTGGTCAAGGGAAGTTCTGG - Intergenic
927412897 2:22846789-22846811 TATGAAGCCAAGTGTATTTGGGG - Intergenic
927625910 2:24718492-24718514 TTTGTAGTCAAGTATCTTTATGG - Intronic
928319511 2:30271915-30271937 TGTGTTTGCAAGGGTATTTCTGG + Intronic
928684744 2:33737029-33737051 AGTGTAGTCAAGTGTCTTTCTGG + Intergenic
929500565 2:42487981-42488003 TGTGTATTACACTGTATTTCTGG + Intronic
931133536 2:59368882-59368904 TGTTTATTCATGTGTATTTTGGG + Intergenic
934584540 2:95479234-95479256 TGTGTAGTCATGTGTTTATGTGG - Intergenic
934594912 2:95597481-95597503 TGTGTAGTCATGTGTTTATGTGG + Intronic
935518382 2:104074042-104074064 TGTATAATAAAGTATATTTCTGG + Intergenic
935836363 2:107059278-107059300 TGTGTATTTAGGTTTATTTCTGG + Intergenic
945315323 2:208364537-208364559 TGTGTACACAAGTTTATTTCTGG + Intronic
945685266 2:212961287-212961309 TCTTTAGTTAGGTGTATTTCAGG - Intergenic
945726769 2:213479475-213479497 TGTGTTTACTAGTGTATTTCAGG + Intronic
947198055 2:227588509-227588531 TGTTTTGTCAAATGTATTTTGGG - Intergenic
947379109 2:229527834-229527856 TATGTATTCACGAGTATTTCTGG + Intronic
948270989 2:236673004-236673026 TGTGTATGCATGTGTATTTGTGG + Intergenic
1169763658 20:9125066-9125088 GATGGAGTCAAGCGTATTTCAGG - Intronic
1171329725 20:24326771-24326793 TGTGTCTGCAAGTGTGTTTCTGG - Intergenic
1172057683 20:32165722-32165744 TGTTTATTCAGGTGTATTTCTGG + Exonic
1173794303 20:45848250-45848272 GGTTTAGTCATGTGTGTTTCTGG - Intronic
1176209437 20:63910979-63911001 TTTGTATTCAAATGTATATCTGG + Intronic
1176634435 21:9176751-9176773 AGTGTACTCAAGTGTAATTTAGG - Intergenic
1179991463 21:44950277-44950299 TGTGAAGTCAAGGGTATGACAGG + Intronic
1180390289 22:12224757-12224779 AGTGTACTCAAGTGTAATTTAGG - Intergenic
1180415646 22:12709710-12709732 AGTGTACTCAAGTGTAATTTAGG + Intergenic
1182251821 22:29006649-29006671 TGTGTAGTGATGGGAATTTCAGG + Intronic
1184005063 22:41701721-41701743 TTTGTAGTCAAGTGCTGTTCAGG + Intronic
949241853 3:1882575-1882597 TGTGTAGGCAAATGTGTCTCAGG - Intergenic
952697754 3:36289648-36289670 TTTGAGGTCAAGTGTATTGCAGG + Intergenic
954569018 3:51625081-51625103 TATGTAGTCAAGTGTCTTTGGGG - Intronic
958702591 3:97613617-97613639 AGTGTAGTCAAGTGTGTGTGTGG + Intronic
959919629 3:111856652-111856674 TGTGTAGTCAAGTGTATTTCTGG + Intronic
960902598 3:122567000-122567022 TCTCTAGCCAAGTGGATTTCTGG + Intronic
963429110 3:145174413-145174435 TGTGTAGTAATTTGTATTCCAGG + Intergenic
964129395 3:153269827-153269849 TCTGAGGTCAAGTATATTTCCGG - Intergenic
964202695 3:154135739-154135761 TGTGTAGTCAGCTGAACTTCAGG + Intronic
964581370 3:158242577-158242599 TGCTGAGTCAAATGTATTTCTGG + Intronic
964829153 3:160864005-160864027 TGTTTTGTCAAGAGTCTTTCAGG - Intronic
966265298 3:178034209-178034231 TGTATATTCAAAGGTATTTCTGG + Intergenic
966655432 3:182352058-182352080 TTTCTAGTCAAGTTTACTTCTGG - Intergenic
967032608 3:185621994-185622016 TGTGTAGTTAAGGCTATTTCAGG + Intronic
974442208 4:61933879-61933901 TGTTTATTCAACTTTATTTCTGG + Intronic
974968565 4:68796587-68796609 TGTGTAATCAAGTGTAATCAAGG + Intergenic
975425697 4:74224540-74224562 AGTGCAGTCAAGAGGATTTCTGG - Intronic
976556815 4:86460206-86460228 TATGTAGTTAAGTTTATTTGGGG - Intronic
977340983 4:95757427-95757449 TCTGTTGTCAAGTGTATACCTGG - Intergenic
977678793 4:99775934-99775956 TGTGTACTTCAGTGTATTTTTGG - Intergenic
979087030 4:116426166-116426188 TGTGTAGTCAGTTTAATTTCTGG - Intergenic
983092945 4:163526808-163526830 TGTGTAGTCATGTATATATGCGG - Exonic
983474605 4:168198229-168198251 TGTGTACTTAAGTGTGTTTTTGG - Intergenic
984378574 4:178962603-178962625 TTTGCAGTCAAGTGTTTCTCAGG - Intergenic
986340337 5:6783890-6783912 TGTGTCTGCAAGGGTATTTCTGG + Intergenic
987499829 5:18695064-18695086 TATGTAGCCAATTTTATTTCAGG - Intergenic
987788782 5:22536836-22536858 TGTGCAGTCAAGTGGATTCAGGG - Intronic
987942504 5:24559347-24559369 TGTGTAAACAAATGTATATCTGG + Intronic
988402600 5:30780993-30781015 TGTTAGGTCAAATGTATTTCTGG - Intergenic
990091171 5:52050979-52051001 TGTTTAGTCAAGCGTAAGTCTGG - Intronic
993725170 5:91358883-91358905 TGTATAATCAAATATATTTCTGG + Intergenic
994152262 5:96461323-96461345 TGTGTAGACAAGTTTTTATCTGG + Intergenic
994329792 5:98491304-98491326 TGTGTGTGCATGTGTATTTCTGG + Intergenic
995143924 5:108765005-108765027 TGTGAAGACAAGCATATTTCAGG + Intronic
995761630 5:115568055-115568077 TTTGTAATCAAATGTTTTTCTGG - Intergenic
998347966 5:141481129-141481151 TGTGAAGTAAAGTGTTATTCTGG + Intronic
1000465210 5:161567423-161567445 TGTGTAGCCAGGTATTTTTCAGG + Intronic
1001025330 5:168219389-168219411 TGTGCAATCAAGTGTGTTGCTGG - Intronic
1003619166 6:7682626-7682648 TGTGTAGTCAAGAGTGTTGATGG + Intergenic
1005472470 6:26175097-26175119 TCTGTAGTCAAGTGCATATAAGG + Intergenic
1010177431 6:73045502-73045524 TGGATAGTCAAGTGTGTTTTGGG + Intronic
1012128105 6:95455577-95455599 TAAGTAGTCAGGTTTATTTCTGG - Intergenic
1012938722 6:105395361-105395383 TGTGTAGTCAAGGGTAACCCAGG - Intronic
1014347955 6:120299468-120299490 TGTGTAGTTATGTGCATTTTGGG - Intergenic
1016549802 6:145266643-145266665 TGTGTATTCATGTGTATGTGTGG - Intergenic
1017270997 6:152505117-152505139 TTGGAAGTCATGTGTATTTCTGG + Intronic
1018369336 6:163153522-163153544 TGTGTAGTCACGTGAATTCTTGG + Intronic
1020982634 7:15090495-15090517 TCTGTAGTCAAGTGCATTCTAGG - Intergenic
1021591367 7:22266871-22266893 TGTGCAGTTGAGTGTATCTCAGG - Intronic
1021654595 7:22862674-22862696 TGTATACTAAAGTGTCTTTCAGG + Intergenic
1024052144 7:45632125-45632147 TATGTAGTTGAATGTATTTCTGG + Intronic
1024062191 7:45707393-45707415 TATGTAGCCAATTGTATTTAAGG - Intronic
1024236017 7:47399508-47399530 GTTGTAGTCAGTTGTATTTCTGG - Intronic
1024785197 7:52899451-52899473 TGTGTAGTCAATTTTCTTGCAGG - Intergenic
1024845949 7:53642589-53642611 TGTGTCGTGAAGTTTATTGCGGG - Intergenic
1027561112 7:79731637-79731659 TGTGCAGTAAAGAGTATTTTGGG + Intergenic
1028394662 7:90354785-90354807 TGTTTACTGAAGTGTTTTTCTGG + Intronic
1031822458 7:126521299-126521321 TGTTCAGTCAAGTGTATCTTGGG - Intronic
1032253658 7:130279707-130279729 TGTGTGGTCAAGTAAGTTTCAGG + Intronic
1039016252 8:33152620-33152642 TGTGTATGCATGTGTATTTCAGG - Intergenic
1045140862 8:99280812-99280834 TGTGTTGTCAGGTATATTTCAGG - Intronic
1045779521 8:105847527-105847549 TGTGCAGTCAACCCTATTTCAGG - Intergenic
1047123052 8:121927909-121927931 TGTGTAGTCACATGTCTTTGGGG - Intergenic
1052406175 9:28064204-28064226 TGTTTAGGACAGTGTATTTCAGG + Intronic
1052633049 9:31065266-31065288 TGGATAGTCAAGTGTATTTTGGG - Intergenic
1055183032 9:73413121-73413143 TGTGTAAACCAGTGTATTGCTGG - Intergenic
1055231501 9:74072422-74072444 TATGTAGTTAAGTGTGTTTGTGG + Intergenic
1055560574 9:77517548-77517570 TGTGTATGTATGTGTATTTCTGG + Intronic
1056861300 9:90185502-90185524 TGTGTGTGCAAGTCTATTTCTGG + Intergenic
1057528184 9:95820860-95820882 TCTGTAGTAAAGTGTATCTGTGG - Intergenic
1059018650 9:110549429-110549451 TGTATCTTCATGTGTATTTCTGG + Intronic
1061372413 9:130205006-130205028 TTTGTACTCATGTGTATGTCGGG - Intronic
1062603332 9:137330038-137330060 TGTGTAGTCCCGTGTAGCTCCGG - Intronic
1062603349 9:137330167-137330189 TGTGTAGTCCCGTGTAGCTCCGG - Intronic
1062603367 9:137330316-137330338 TGTGTAGTCCCGTGTAGCTCCGG - Intronic
1203757272 Un_GL000218v1:144391-144413 AGTGTACTCAAGTGTAATTTAGG - Intergenic
1203650881 Un_KI270751v1:120620-120642 AGTGTACTCAAGTGTAATTTAGG - Intergenic
1185974542 X:4704888-4704910 TGTGTATTTGGGTGTATTTCTGG - Intergenic
1187021834 X:15391419-15391441 TTTGTAATCAAATGCATTTCTGG + Intronic
1187524796 X:20044700-20044722 AGTTTATTCAAGTTTATTTCAGG + Intronic
1189611142 X:42737337-42737359 TGTGTATTCATGTGTATGACAGG + Intergenic
1190727615 X:53200332-53200354 TGTGTATTTAAGTATGTTTCTGG - Intronic
1191651808 X:63547018-63547040 TGTGCAGGCATGTGTCTTTCTGG - Intergenic
1193528653 X:82625877-82625899 TGTTTAGTTAAGTTTATTTCTGG - Intergenic
1194082165 X:89482368-89482390 TGTATAGTTAAGTGTGTTTTTGG - Intergenic
1195002331 X:100653960-100653982 TGTGTATTTAACTGTATTTAAGG + Intronic
1200434834 Y:3138559-3138581 TGTATAGTTAAGTGTGTTTTTGG - Intergenic
1201170850 Y:11262006-11262028 AGTGTAGTCAAGTGTAATTTAGG - Intergenic