ID: 959919939

View in Genome Browser
Species Human (GRCh38)
Location 3:111859327-111859349
Sequence GGCTTTCACGGCTGCTGGAA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959919939_959919943 -4 Left 959919939 3:111859327-111859349 CCCTTCCAGCAGCCGTGAAAGCC 0: 1
1: 0
2: 0
3: 14
4: 131
Right 959919943 3:111859346-111859368 AGCCCCAACAGCAAACTGCCTGG 0: 1
1: 0
2: 2
3: 18
4: 129
959919939_959919948 2 Left 959919939 3:111859327-111859349 CCCTTCCAGCAGCCGTGAAAGCC 0: 1
1: 0
2: 0
3: 14
4: 131
Right 959919948 3:111859352-111859374 AACAGCAAACTGCCTGGGAGCGG 0: 1
1: 0
2: 3
3: 22
4: 317
959919939_959919949 3 Left 959919939 3:111859327-111859349 CCCTTCCAGCAGCCGTGAAAGCC 0: 1
1: 0
2: 0
3: 14
4: 131
Right 959919949 3:111859353-111859375 ACAGCAAACTGCCTGGGAGCGGG 0: 1
1: 0
2: 2
3: 39
4: 302
959919939_959919951 8 Left 959919939 3:111859327-111859349 CCCTTCCAGCAGCCGTGAAAGCC 0: 1
1: 0
2: 0
3: 14
4: 131
Right 959919951 3:111859358-111859380 AAACTGCCTGGGAGCGGGGCAGG 0: 1
1: 0
2: 2
3: 36
4: 264
959919939_959919944 -3 Left 959919939 3:111859327-111859349 CCCTTCCAGCAGCCGTGAAAGCC 0: 1
1: 0
2: 0
3: 14
4: 131
Right 959919944 3:111859347-111859369 GCCCCAACAGCAAACTGCCTGGG 0: 1
1: 0
2: 3
3: 4
4: 117
959919939_959919950 4 Left 959919939 3:111859327-111859349 CCCTTCCAGCAGCCGTGAAAGCC 0: 1
1: 0
2: 0
3: 14
4: 131
Right 959919950 3:111859354-111859376 CAGCAAACTGCCTGGGAGCGGGG 0: 1
1: 0
2: 1
3: 25
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959919939 Original CRISPR GGCTTTCACGGCTGCTGGAA GGG (reversed) Exonic