ID: 959922149 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:111880219-111880241 |
| Sequence | GGAAAGCACTGTCAATGCTA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 257 | |||
| Summary | {0: 2, 1: 2, 2: 22, 3: 49, 4: 182} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 959922149_959922155 | 12 | Left | 959922149 | 3:111880219-111880241 | CCATAGCATTGACAGTGCTTTCC | 0: 2 1: 2 2: 22 3: 49 4: 182 |
||
| Right | 959922155 | 3:111880254-111880276 | AATGAGCCTGAAAGGTCGTTAGG | 0: 1 1: 0 2: 1 3: 8 4: 76 |
||||
| 959922149_959922153 | 4 | Left | 959922149 | 3:111880219-111880241 | CCATAGCATTGACAGTGCTTTCC | 0: 2 1: 2 2: 22 3: 49 4: 182 |
||
| Right | 959922153 | 3:111880246-111880268 | GGTACCATAATGAGCCTGAAAGG | 0: 1 1: 0 2: 0 3: 2 4: 66 |
||||
| 959922149_959922157 | 29 | Left | 959922149 | 3:111880219-111880241 | CCATAGCATTGACAGTGCTTTCC | 0: 2 1: 2 2: 22 3: 49 4: 182 |
||
| Right | 959922157 | 3:111880271-111880293 | GTTAGGACCCCCTGATCTAAAGG | 0: 1 1: 0 2: 2 3: 34 4: 189 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 959922149 | Original CRISPR | GGAAAGCACTGTCAATGCTA TGG (reversed) | Intronic | ||