HTGT WGE

Individual CRISPR Summary

ID: 959922154

 View in Genome Browser
Species Human (GRCh38)
Location 3:111880250-111880272
Sequence ACGACCTTTCAGGCTCATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 63}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959922154_959922157 -2 Left 959922154 3:111880250-111880272 CCATAATGAGCCTGAAAGGTCGT 0: 1
1: 0
2: 0
3: 7
4: 63
Right 959922157 3:111880271-111880293 GTTAGGACCCCCTGATCTAAAGG 0: 1
1: 0
2: 2
3: 34
4: 189
959922154_959922164 21 Left 959922154 3:111880250-111880272 CCATAATGAGCCTGAAAGGTCGT 0: 1
1: 0
2: 0
3: 7
4: 63
Right 959922164 3:111880294-111880316 CAGAATTAGAGATATGTTTGGGG 0: 1
1: 1
2: 4
3: 37
4: 314
959922154_959922165 22 Left 959922154 3:111880250-111880272 CCATAATGAGCCTGAAAGGTCGT 0: 1
1: 0
2: 0
3: 7
4: 63
Right 959922165 3:111880295-111880317 AGAATTAGAGATATGTTTGGGGG 0: 1
1: 1
2: 3
3: 38
4: 315
959922154_959922163 20 Left 959922154 3:111880250-111880272 CCATAATGAGCCTGAAAGGTCGT 0: 1
1: 0
2: 0
3: 7
4: 63
Right 959922163 3:111880293-111880315 GCAGAATTAGAGATATGTTTGGG 0: 1
1: 1
2: 6
3: 38
4: 252
959922154_959922162 19 Left 959922154 3:111880250-111880272 CCATAATGAGCCTGAAAGGTCGT 0: 1
1: 0
2: 0
3: 7
4: 63
Right 959922162 3:111880292-111880314 GGCAGAATTAGAGATATGTTTGG 0: 1
1: 0
2: 4
3: 37
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959922154 Original CRISPR ACGACCTTTCAGGCTCATTA TGG (reversed) Intronic