ID: 959922156

View in Genome Browser
Species Human (GRCh38)
Location 3:111880260-111880282
Sequence GGGGGTCCTAACGACCTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959922156_959922163 10 Left 959922156 3:111880260-111880282 CCTGAAAGGTCGTTAGGACCCCC 0: 1
1: 0
2: 1
3: 16
4: 102
Right 959922163 3:111880293-111880315 GCAGAATTAGAGATATGTTTGGG 0: 1
1: 1
2: 6
3: 38
4: 252
959922156_959922164 11 Left 959922156 3:111880260-111880282 CCTGAAAGGTCGTTAGGACCCCC 0: 1
1: 0
2: 1
3: 16
4: 102
Right 959922164 3:111880294-111880316 CAGAATTAGAGATATGTTTGGGG 0: 1
1: 1
2: 4
3: 37
4: 314
959922156_959922162 9 Left 959922156 3:111880260-111880282 CCTGAAAGGTCGTTAGGACCCCC 0: 1
1: 0
2: 1
3: 16
4: 102
Right 959922162 3:111880292-111880314 GGCAGAATTAGAGATATGTTTGG 0: 1
1: 0
2: 4
3: 37
4: 202
959922156_959922165 12 Left 959922156 3:111880260-111880282 CCTGAAAGGTCGTTAGGACCCCC 0: 1
1: 0
2: 1
3: 16
4: 102
Right 959922165 3:111880295-111880317 AGAATTAGAGATATGTTTGGGGG 0: 1
1: 1
2: 3
3: 38
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959922156 Original CRISPR GGGGGTCCTAACGACCTTTC AGG (reversed) Intronic