ID: 959922156

View in Genome Browser
Species Human (GRCh38)
Location 3:111880260-111880282
Sequence GGGGGTCCTAACGACCTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 102}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959922156_959922164 11 Left 959922156 3:111880260-111880282 CCTGAAAGGTCGTTAGGACCCCC 0: 1
1: 0
2: 1
3: 16
4: 102
Right 959922164 3:111880294-111880316 CAGAATTAGAGATATGTTTGGGG 0: 1
1: 1
2: 4
3: 37
4: 314
959922156_959922165 12 Left 959922156 3:111880260-111880282 CCTGAAAGGTCGTTAGGACCCCC 0: 1
1: 0
2: 1
3: 16
4: 102
Right 959922165 3:111880295-111880317 AGAATTAGAGATATGTTTGGGGG 0: 1
1: 1
2: 3
3: 38
4: 315
959922156_959922162 9 Left 959922156 3:111880260-111880282 CCTGAAAGGTCGTTAGGACCCCC 0: 1
1: 0
2: 1
3: 16
4: 102
Right 959922162 3:111880292-111880314 GGCAGAATTAGAGATATGTTTGG 0: 1
1: 0
2: 4
3: 37
4: 202
959922156_959922163 10 Left 959922156 3:111880260-111880282 CCTGAAAGGTCGTTAGGACCCCC 0: 1
1: 0
2: 1
3: 16
4: 102
Right 959922163 3:111880293-111880315 GCAGAATTAGAGATATGTTTGGG 0: 1
1: 1
2: 6
3: 38
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959922156 Original CRISPR GGGGGTCCTAACGACCTTTC AGG (reversed) Intronic
900278271 1:1847504-1847526 GGGGGTCATAAGGACCTTTAAGG + Intronic
904615745 1:31748596-31748618 GGGGGTACTCACGTCCCTTCTGG - Intronic
907124432 1:52037136-52037158 GGGGGTGATAAGGACCTTTAAGG - Intronic
912841153 1:113040595-113040617 GGGGTTCATAAGGACCTTTAAGG + Intergenic
913647177 1:120869253-120869275 GGGAGTCATAAGGACCTTTAAGG + Intergenic
914079466 1:144393609-144393631 GGGAGTCATAAGGACCTTTAAGG - Intergenic
914099713 1:144572893-144572915 GGGAGTCATAAGGACCTTTAAGG + Intergenic
914174364 1:145262155-145262177 GGGAGTCATAAGGACCTTTAAGG - Intergenic
914299274 1:146364788-146364810 GGGAGTCATAAGGACCTTTAAGG - Intergenic
914637362 1:149563769-149563791 GGGAGTCATAAGGACCTTTAAGG + Intergenic
915997781 1:160581867-160581889 GGGGGTCATAAGGACCTTTAAGG - Intergenic
916375406 1:164148315-164148337 GGGGGTCCTGATGATCCTTCAGG - Intergenic
917071541 1:171156771-171156793 GGGAGTCATAAGGACCTTTAAGG + Intronic
917994415 1:180420497-180420519 GGGGGTTATAAGGACCTTTAAGG - Intronic
919567567 1:199207867-199207889 GGGGGTCATAAGGACCTTGAAGG - Intergenic
920151709 1:203914724-203914746 GGGGGTCATAAGGACCTTCAAGG + Intergenic
923399644 1:233603937-233603959 GGGGATCATAAGGACCTTTAAGG - Intergenic
1068190210 10:53642206-53642228 GGGGCTCATAAGGACCTTTAAGG - Intergenic
1069094486 10:64241921-64241943 GGGGGTCATAAGGATCTTTAAGG + Intergenic
1070809841 10:79292165-79292187 GGGGGTCCTAACGCCCCCGCAGG + Exonic
1071816531 10:89237890-89237912 GGAGGTCATAAGGACCTTTAAGG + Intronic
1072912909 10:99519983-99520005 GGGGGTCCTCAGGACGTGTCTGG - Intergenic
1073220376 10:101867397-101867419 GAGGGTCATAAAGACCTTTAAGG + Intronic
1076947527 10:133661422-133661444 GGGTGTCCTAAGAACTTTTCAGG + Intergenic
1079908037 11:26273356-26273378 GGGGATCATAAGGACCTTTAAGG + Intergenic
1081949714 11:47033816-47033838 GGGGGTTATAAGGACCTTTAAGG - Intronic
1093588119 12:20867164-20867186 TGGGGTCCTAAGGACATTTAAGG + Intronic
1096940395 12:55338324-55338346 AGGGGTCATAAGGACCTTTAAGG - Intergenic
1097332711 12:58349628-58349650 AGGGGTCATAAGGACCTTTATGG + Intergenic
1098214980 12:68206310-68206332 AGGGGTCATAAAGACCTTTTAGG - Intronic
1106784952 13:33097630-33097652 GGGGGTCATAAGGACCTTTAAGG - Intergenic
1107539258 13:41370788-41370810 AGGGGTCATAAGGACCTTTAAGG + Intronic
1110563156 13:76930912-76930934 AGGGGTCATAAAGACCTTTAAGG - Intergenic
1111424533 13:88062381-88062403 AGGGGTCATAAGGACCTTTAAGG + Intergenic
1112096797 13:96141762-96141784 GGGGGTCTTAAGGACCTTTAAGG + Intronic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1115613745 14:35073425-35073447 AGGGGTCATAAGGACCTTTAAGG - Intronic
1120150145 14:81023464-81023486 CAGGGTCCTAAAGACCTTTAAGG - Intronic
1128654101 15:69446666-69446688 GGATGACCTAAAGACCTTTCTGG + Intronic
1130009149 15:80134413-80134435 AGGGGTCGTAAAGACCTTTCAGG + Intronic
1130293786 15:82628021-82628043 AGGGGTCATAAAGACCTTTAAGG + Intronic
1138203433 16:55106866-55106888 GGGGGTCATAGCCACCTCTCAGG + Intergenic
1141569775 16:84927659-84927681 GGGGGGCCTAGCGCCCTTCCAGG - Intergenic
1146644126 17:34565206-34565228 GGAGGCCCTAACACCCTTTCTGG + Intergenic
1147753952 17:42755867-42755889 GAGGGGCCTGACTACCTTTCAGG - Intergenic
1148142818 17:45340411-45340433 TGGAGTCCTCAGGACCTTTCTGG + Intergenic
1157398845 18:47368974-47368996 GGGGGTCATAAAGACCATTAAGG - Intergenic
1157462294 18:47909903-47909925 GGGAGTCATAAGGACCTTTAAGG + Intronic
1159268088 18:66110955-66110977 GGGGGCCATAAGGACCTTTAAGG + Intergenic
1163501799 19:17680494-17680516 GGGGGCCCCAAAGACCTTTGAGG - Intronic
1165877641 19:39020486-39020508 GGGGGTCATAAGGACCTTTAAGG + Intronic
925651510 2:6094423-6094445 GGGTGTCATAAGGACCTTTAAGG - Intergenic
928274275 2:29885290-29885312 GGGGGTCACAAGGACCTTTAAGG + Intronic
929215586 2:39408364-39408386 GGGGGTCATAAGGACCTTTAAGG + Intronic
930542614 2:52725826-52725848 GGAGGGCCTAACTAGCTTTCTGG + Intergenic
933830119 2:86199924-86199946 GGGGGTCATAACCACCTACCTGG + Intronic
939911044 2:147983533-147983555 GGGGGTCATAGGGACCTTTAAGG + Intronic
940906720 2:159175997-159176019 GGGGGACCTAGTGACCTTTCCGG + Intronic
941577183 2:167247909-167247931 GGAGGAACTTACGACCTTTCAGG + Exonic
943651022 2:190457573-190457595 TGGGGTCCTAACTTCCATTCAGG - Intronic
945491930 2:210466276-210466298 GGGGGTCATAAGGACCTCTCAGG + Intronic
947247935 2:228070838-228070860 GGGTGTCATAAGGACCTTTGAGG - Intronic
947463005 2:230319426-230319448 AGTGGTCCTACCCACCTTTCTGG - Intergenic
1174024190 20:47559095-47559117 GGAGGTCATAAGGACCTTTAAGG - Intronic
1176143318 20:63554410-63554432 GGGGCTCAGAACCACCTTTCCGG + Exonic
1176519403 21:7813401-7813423 GGGGGTCCTAGCAACTTCTCAGG + Intergenic
1178653431 21:34443414-34443436 GGGGGTCCTAGCAACTTCTCAGG + Intergenic
1181139869 22:20796545-20796567 GGAGGTCCTTACTACATTTCAGG - Intronic
1184015295 22:41781500-41781522 GGTGGTCATAAGGTCCTTTCTGG + Intronic
950850027 3:16053395-16053417 GGGGGTCCTAGAGACCTTCATGG - Intergenic
952600748 3:35079303-35079325 GGAGGTCATAATGACCTTTAAGG - Intergenic
953473324 3:43184934-43184956 GAGTGTCCAAAGGACCTTTCCGG - Intergenic
953778830 3:45847423-45847445 GGGGGTCATAAGGACCTTTAAGG - Intronic
954454560 3:50590747-50590769 GGGGCTCCCAAGGACCTTTCAGG - Intergenic
957444312 3:80295048-80295070 GGGGGTCATAAGGGCCTTTAAGG + Intergenic
959922156 3:111880260-111880282 GGGGGTCCTAACGACCTTTCAGG - Intronic
959969174 3:112389474-112389496 GGGGATCATAAGGACCTTTAAGG + Intergenic
960411175 3:117326888-117326910 GGGGGTTATAATGACCTTTGTGG - Intergenic
962783577 3:138745184-138745206 GGAGGTCATAAGGACCTTTAAGG - Intronic
963381241 3:144533199-144533221 GGGAGCCTTAACTACCTTTCTGG + Intergenic
967124132 3:186409314-186409336 AGGGGTCCTAAAGGCCTGTCTGG - Intergenic
969496596 4:7529894-7529916 GGGGGGCCTCAGGACCTGTCTGG - Intronic
969637857 4:8379656-8379678 GGGGGTGCTAAGGACCTACCGGG + Intronic
971869979 4:32222209-32222231 GGGTGTCATAAAGACCTTTAAGG - Intergenic
976089665 4:81443408-81443430 GAGGGTCCAAAGGAGCTTTCTGG - Intronic
977103193 4:92845129-92845151 GGGAGTCTTCAAGACCTTTCAGG - Intronic
981170483 4:141617008-141617030 AGGGGTCATAAAGACCTTTAAGG - Intergenic
983039648 4:162910281-162910303 GTGGGTCATAAGGACCTTTAAGG + Intergenic
984535002 4:180963514-180963536 GGGGGACATAAGGACCTTTAAGG - Intergenic
985450981 4:190062220-190062242 GGGTGTCCTAAGAACTTTTCAGG + Intergenic
985778927 5:1859557-1859579 GGGGGACCTAACATCCTTGCCGG - Intergenic
1002550371 5:179985417-179985439 GGGGGTCCTAAGGACCCTTACGG - Intronic
1008742612 6:54627697-54627719 GGAGGTCATAAGGACCTTTAAGG + Intergenic
1010728228 6:79359970-79359992 GGGGGTCATAAGGACCTTTAAGG - Intergenic
1013363384 6:109415787-109415809 GGGGGTCATAAGGACCTTTAAGG - Intronic
1017473736 6:154766933-154766955 GGGGGTCATAAGGACCTTTAAGG - Intronic
1022145948 7:27540690-27540712 GGGGATCATAAGGACCTTTAAGG - Intronic
1023831920 7:44044571-44044593 GCGGGTCCTAGCGAGCTGTCCGG - Intergenic
1023880745 7:44319663-44319685 GGCCCTCCTAATGACCTTTCAGG + Intronic
1028152933 7:87395828-87395850 GGGGGTTATAAGGACCTTTAAGG + Intronic
1031328195 7:120429138-120429160 GGGGGTCCCTAGGACATTTCAGG + Intronic
1032382359 7:131498256-131498278 AAGGGTCCTAACCACCTCTCGGG - Intergenic
1034048433 7:147955538-147955560 GGGGGTTCTGAATACCTTTCAGG - Intronic
1034053171 7:148005244-148005266 AGGGGCCCTAACGAGCTCTCTGG - Intronic
1034065190 7:148129432-148129454 GGGGGTGCAAAGGAACTTTCTGG + Intronic
1037439390 8:18899538-18899560 GGGGGTCATAAGGACCATTAAGG - Intronic
1041353427 8:56973294-56973316 GGAGGTCATAAGGACCTTTAAGG + Intronic
1043050184 8:75376792-75376814 GGTGGGCCTAACGAGCTGTCTGG - Intergenic
1044106055 8:88208547-88208569 GGGGGTCATAAAGACCTTTAAGG + Intronic
1046446385 8:114325872-114325894 GGGGATCATAAAGACCTTTAAGG - Intergenic
1047322081 8:123796167-123796189 GGGGGTTATAATGACCTTTAAGG + Intronic
1057536962 9:95919537-95919559 GAGGGTCATAAGGACCTTTAAGG + Intronic
1058837455 9:108871240-108871262 GGGTGTCATAAGGACCTTTAAGG - Intronic
1060611016 9:124964589-124964611 GGGGGTCCTAAGGACCTTTAAGG - Intronic
1061417834 9:130457506-130457528 GGGGTTCCCAATGACTTTTCAGG - Intronic
1062369964 9:136233409-136233431 TGGGGTCCTAAGGCCCTTTAGGG + Intronic
1185495649 X:552982-553004 GGGGCTACTAACGACGTTACGGG - Intergenic
1187121590 X:16412738-16412760 GGGGGTCAAAAGGACCTTTAAGG + Intergenic
1199198431 X:145059314-145059336 GGGGGCCCTAATGACATTTAAGG - Intergenic
1199275428 X:145936717-145936739 AGGGGTCATAAGGACCTTTAAGG - Intergenic