ID: 959922162

View in Genome Browser
Species Human (GRCh38)
Location 3:111880292-111880314
Sequence GGCAGAATTAGAGATATGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 202}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959922154_959922162 19 Left 959922154 3:111880250-111880272 CCATAATGAGCCTGAAAGGTCGT 0: 1
1: 0
2: 0
3: 7
4: 63
Right 959922162 3:111880292-111880314 GGCAGAATTAGAGATATGTTTGG 0: 1
1: 0
2: 4
3: 37
4: 202
959922156_959922162 9 Left 959922156 3:111880260-111880282 CCTGAAAGGTCGTTAGGACCCCC 0: 1
1: 0
2: 1
3: 16
4: 102
Right 959922162 3:111880292-111880314 GGCAGAATTAGAGATATGTTTGG 0: 1
1: 0
2: 4
3: 37
4: 202
959922159_959922162 -10 Left 959922159 3:111880279-111880301 CCCCTGATCTAAAGGCAGAATTA 0: 1
1: 2
2: 23
3: 91
4: 284
Right 959922162 3:111880292-111880314 GGCAGAATTAGAGATATGTTTGG 0: 1
1: 0
2: 4
3: 37
4: 202
959922152_959922162 29 Left 959922152 3:111880240-111880262 CCATAGGGTACCATAATGAGCCT 0: 1
1: 0
2: 1
3: 7
4: 60
Right 959922162 3:111880292-111880314 GGCAGAATTAGAGATATGTTTGG 0: 1
1: 0
2: 4
3: 37
4: 202
959922158_959922162 -9 Left 959922158 3:111880278-111880300 CCCCCTGATCTAAAGGCAGAATT 0: 1
1: 2
2: 17
3: 44
4: 166
Right 959922162 3:111880292-111880314 GGCAGAATTAGAGATATGTTTGG 0: 1
1: 0
2: 4
3: 37
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959922162 Original CRISPR GGCAGAATTAGAGATATGTT TGG Intronic