ID: 959922163

View in Genome Browser
Species Human (GRCh38)
Location 3:111880293-111880315
Sequence GCAGAATTAGAGATATGTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 1, 2: 6, 3: 38, 4: 252}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959922158_959922163 -8 Left 959922158 3:111880278-111880300 CCCCCTGATCTAAAGGCAGAATT 0: 1
1: 2
2: 17
3: 44
4: 166
Right 959922163 3:111880293-111880315 GCAGAATTAGAGATATGTTTGGG 0: 1
1: 1
2: 6
3: 38
4: 252
959922160_959922163 -10 Left 959922160 3:111880280-111880302 CCCTGATCTAAAGGCAGAATTAG 0: 1
1: 1
2: 31
3: 68
4: 226
Right 959922163 3:111880293-111880315 GCAGAATTAGAGATATGTTTGGG 0: 1
1: 1
2: 6
3: 38
4: 252
959922159_959922163 -9 Left 959922159 3:111880279-111880301 CCCCTGATCTAAAGGCAGAATTA 0: 1
1: 2
2: 23
3: 91
4: 284
Right 959922163 3:111880293-111880315 GCAGAATTAGAGATATGTTTGGG 0: 1
1: 1
2: 6
3: 38
4: 252
959922154_959922163 20 Left 959922154 3:111880250-111880272 CCATAATGAGCCTGAAAGGTCGT 0: 1
1: 0
2: 0
3: 7
4: 63
Right 959922163 3:111880293-111880315 GCAGAATTAGAGATATGTTTGGG 0: 1
1: 1
2: 6
3: 38
4: 252
959922152_959922163 30 Left 959922152 3:111880240-111880262 CCATAGGGTACCATAATGAGCCT 0: 1
1: 0
2: 1
3: 7
4: 60
Right 959922163 3:111880293-111880315 GCAGAATTAGAGATATGTTTGGG 0: 1
1: 1
2: 6
3: 38
4: 252
959922156_959922163 10 Left 959922156 3:111880260-111880282 CCTGAAAGGTCGTTAGGACCCCC 0: 1
1: 0
2: 1
3: 16
4: 102
Right 959922163 3:111880293-111880315 GCAGAATTAGAGATATGTTTGGG 0: 1
1: 1
2: 6
3: 38
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959922163 Original CRISPR GCAGAATTAGAGATATGTTT GGG Intronic