ID: 959922165

View in Genome Browser
Species Human (GRCh38)
Location 3:111880295-111880317
Sequence AGAATTAGAGATATGTTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 1, 2: 3, 3: 38, 4: 315}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959922154_959922165 22 Left 959922154 3:111880250-111880272 CCATAATGAGCCTGAAAGGTCGT 0: 1
1: 0
2: 0
3: 7
4: 63
Right 959922165 3:111880295-111880317 AGAATTAGAGATATGTTTGGGGG 0: 1
1: 1
2: 3
3: 38
4: 315
959922160_959922165 -8 Left 959922160 3:111880280-111880302 CCCTGATCTAAAGGCAGAATTAG 0: 1
1: 1
2: 31
3: 68
4: 226
Right 959922165 3:111880295-111880317 AGAATTAGAGATATGTTTGGGGG 0: 1
1: 1
2: 3
3: 38
4: 315
959922161_959922165 -9 Left 959922161 3:111880281-111880303 CCTGATCTAAAGGCAGAATTAGA 0: 1
1: 3
2: 34
3: 83
4: 233
Right 959922165 3:111880295-111880317 AGAATTAGAGATATGTTTGGGGG 0: 1
1: 1
2: 3
3: 38
4: 315
959922158_959922165 -6 Left 959922158 3:111880278-111880300 CCCCCTGATCTAAAGGCAGAATT 0: 1
1: 2
2: 17
3: 44
4: 166
Right 959922165 3:111880295-111880317 AGAATTAGAGATATGTTTGGGGG 0: 1
1: 1
2: 3
3: 38
4: 315
959922159_959922165 -7 Left 959922159 3:111880279-111880301 CCCCTGATCTAAAGGCAGAATTA 0: 1
1: 2
2: 23
3: 91
4: 284
Right 959922165 3:111880295-111880317 AGAATTAGAGATATGTTTGGGGG 0: 1
1: 1
2: 3
3: 38
4: 315
959922156_959922165 12 Left 959922156 3:111880260-111880282 CCTGAAAGGTCGTTAGGACCCCC 0: 1
1: 0
2: 1
3: 16
4: 102
Right 959922165 3:111880295-111880317 AGAATTAGAGATATGTTTGGGGG 0: 1
1: 1
2: 3
3: 38
4: 315

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959922165 Original CRISPR AGAATTAGAGATATGTTTGG GGG Intronic