ID: 959924307

View in Genome Browser
Species Human (GRCh38)
Location 3:111904504-111904526
Sequence TGCCCCAGATTGCAAAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 152}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959924306_959924307 4 Left 959924306 3:111904477-111904499 CCAGTCTGCATAAAGGCAGGAGC 0: 1
1: 0
2: 1
3: 14
4: 146
Right 959924307 3:111904504-111904526 TGCCCCAGATTGCAAAGCTCTGG 0: 1
1: 0
2: 1
3: 13
4: 152
959924303_959924307 22 Left 959924303 3:111904459-111904481 CCTTCTCATTCGGGATGTCCAGT 0: 1
1: 0
2: 0
3: 4
4: 72
Right 959924307 3:111904504-111904526 TGCCCCAGATTGCAAAGCTCTGG 0: 1
1: 0
2: 1
3: 13
4: 152
959924301_959924307 24 Left 959924301 3:111904457-111904479 CCCCTTCTCATTCGGGATGTCCA 0: 1
1: 0
2: 1
3: 10
4: 80
Right 959924307 3:111904504-111904526 TGCCCCAGATTGCAAAGCTCTGG 0: 1
1: 0
2: 1
3: 13
4: 152
959924302_959924307 23 Left 959924302 3:111904458-111904480 CCCTTCTCATTCGGGATGTCCAG 0: 1
1: 0
2: 0
3: 5
4: 67
Right 959924307 3:111904504-111904526 TGCCCCAGATTGCAAAGCTCTGG 0: 1
1: 0
2: 1
3: 13
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959924307 Original CRISPR TGCCCCAGATTGCAAAGCTC TGG Intronic
900225172 1:1529599-1529621 AGCCCCACCTGGCAAAGCTCGGG - Intronic
900346866 1:2214337-2214359 AGCCCCAGGTTGCAAAGGCCCGG - Intergenic
900618490 1:3576298-3576320 TGGCCCAGATGGCAAGTCTCGGG - Intronic
901136885 1:7003195-7003217 TGCCCCTGGTTGCAAACCACTGG + Intronic
901630634 1:10646567-10646589 TGTCCCAGCATGCAATGCTCTGG - Intronic
903484249 1:23677814-23677836 GTCCCCAGACTTCAAAGCTCTGG - Intergenic
903835982 1:26203509-26203531 CTCCCCAGATTGCATAGCTCAGG - Intergenic
907810795 1:57867727-57867749 TGCCCAAGTTTGCACAGCTAAGG + Intronic
908040764 1:60109964-60109986 TGGGGCAGATTGCTAAGCTCAGG + Intergenic
914754704 1:150556325-150556347 GGCTCCAGATTGCCCAGCTCCGG + Exonic
919998311 1:202774685-202774707 TGGACCAGATTGCAAAGTACTGG - Exonic
920762385 1:208797865-208797887 TGACAGAGATTGCAAAGCACTGG - Intergenic
921367022 1:214383671-214383693 TGCCCCAGATCCCCATGCTCCGG - Exonic
922029649 1:221785708-221785730 TACCCAACATTGGAAAGCTCAGG - Intergenic
1063369347 10:5511176-5511198 TGCCCCGAGTTGCAAAACTCTGG - Intergenic
1064636313 10:17371424-17371446 TGCCCCAGAATTCAATCCTCAGG - Intronic
1068919127 10:62464909-62464931 TGCTGCAGAGTGCACAGCTCTGG - Intronic
1069682170 10:70292869-70292891 TGCCTCAGCTTCCAAAGCACTGG - Intergenic
1069754431 10:70764435-70764457 TGCCACAGATTAGAAATCTCTGG + Intergenic
1070812223 10:79304182-79304204 GGCCCCAGAAAGCACAGCTCTGG + Intronic
1072313365 10:94178462-94178484 TGCCCAAGATTGCATGGCTCAGG - Intronic
1073874349 10:107904166-107904188 TGCACCAGATTGCAGGGCACAGG - Intergenic
1074004020 10:109400991-109401013 TGCCCCAGATTTCACAACTATGG - Intergenic
1075408173 10:122208444-122208466 TGCTCCCGACTGCAAATCTCTGG - Intronic
1075434072 10:122419203-122419225 TGCACGTGATTGCAAAACTCTGG - Intronic
1076800407 10:132820366-132820388 TGGCCCAGGGTGCAAAGCCCTGG + Intronic
1078413846 11:11149293-11149315 TGCAGCAGAATGCAAGGCTCAGG - Intergenic
1081401124 11:42644256-42644278 TGACCCAGAATGGAAAGCTAGGG - Intergenic
1082802573 11:57425656-57425678 TACTCCAGACTGCAAAGCCCAGG - Exonic
1083477312 11:62922789-62922811 TGCCCCAGACTCCAGAGCCCTGG - Intergenic
1083768001 11:64851352-64851374 TGCCCCAGAGTTCATAGCCCTGG - Intergenic
1088332112 11:108665013-108665035 TGCCCCGGTTTCAAAAGCTCGGG + Exonic
1089309478 11:117548311-117548333 TGCCCCAAATCTCAAAGCTGGGG + Intronic
1089724420 11:120462917-120462939 TACCACATATTGCCAAGCTCCGG - Intronic
1090082951 11:123626586-123626608 TCCCCCAGATGGCAGGGCTCTGG + Intronic
1092022739 12:5215847-5215869 CCCCCCATCTTGCAAAGCTCTGG + Intergenic
1095049810 12:37545560-37545582 TGCCCCAGTTGTAAAAGCTCTGG - Intergenic
1095716847 12:45355637-45355659 TGAGCCAGAGAGCAAAGCTCCGG + Intronic
1096446266 12:51695304-51695326 AGCCCCAGACTTCAAAGCTGAGG + Intronic
1097254079 12:57658977-57658999 AGACCCACATTGAAAAGCTCAGG - Intergenic
1101759690 12:107648531-107648553 GACACCAGTTTGCAAAGCTCTGG + Intronic
1102018861 12:109667558-109667580 TGCCCCAGATTCCGCAGCTGGGG - Intergenic
1103246620 12:119463565-119463587 TGCCCAAGAATGGAAAGATCAGG + Intronic
1104049181 12:125185093-125185115 CGCCCCAGCTTGCACAGCTAAGG + Intergenic
1106033704 13:26025280-26025302 TGCCCGAGATGGCCAAGTTCAGG + Exonic
1112827171 13:103405160-103405182 TGCCCAAGTTCGCAAAGCTGAGG + Intergenic
1115159886 14:30381919-30381941 TGCCCCAGATTTTAAGGTTCTGG + Intergenic
1117032908 14:51693470-51693492 TGCCCTAGATTGCAAAGTTGTGG - Intronic
1117666197 14:58058865-58058887 TGCCCCAGAATGAAAAGGTAGGG + Intronic
1117730309 14:58715471-58715493 TGCCAGTGGTTGCAAAGCTCAGG + Intergenic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1127508739 15:59619641-59619663 TGCCACGAATTGCAAAGCCCTGG - Exonic
1127623892 15:60761251-60761273 TGCTCTTGATTGCAAACCTCTGG + Intronic
1130059429 15:80559053-80559075 TGCCCCAGGTTACAGAGCCCAGG + Intronic
1130134991 15:81174939-81174961 TGCCACAGATTGCTAAGCCAGGG - Intronic
1130184466 15:81666673-81666695 GGCCCCAGGTTGCAGAGCTTTGG - Intergenic
1132974378 16:2704206-2704228 TGCCCCAGGAGGCAGAGCTCAGG + Intronic
1138257287 16:55577198-55577220 TGCCCCAGCAGACAAAGCTCTGG - Intronic
1138392929 16:56683288-56683310 TGCCCCTGCCTGCAGAGCTCTGG - Intronic
1139343345 16:66286329-66286351 TTCCCAAGATTGAAAAGTTCTGG + Intergenic
1140884783 16:79233465-79233487 TGCCCCCAGTTGCATAGCTCTGG - Intergenic
1142604625 17:1074654-1074676 AACCCCAGATAGCAAAGCACAGG + Intronic
1144790132 17:17853332-17853354 TGCAACACATTGGAAAGCTCAGG - Intronic
1146604767 17:34248836-34248858 AGCCCCACATTGCAAAGCACTGG - Intergenic
1149308031 17:55368224-55368246 TACCCCAGATTTCAAACATCTGG - Intergenic
1152260106 17:79262256-79262278 TGCCCCTGGCTGCAGAGCTCTGG - Intronic
1152342736 17:79734152-79734174 ACCCCCAGTTTGCAATGCTCTGG + Intronic
1152503672 17:80731125-80731147 TGCCTCAGCCTGCAAAGTTCTGG + Intronic
1154981852 18:21508890-21508912 TTCCCCAGAGTGCTCAGCTCAGG - Intronic
1154995473 18:21636388-21636410 TTCCCCAGAGTGGAAGGCTCCGG - Intergenic
1157499234 18:48178278-48178300 GGCCCCACATTGCCATGCTCAGG + Intronic
1157625068 18:49044553-49044575 TTCCCCAGAGTGCAATGCTAGGG + Intronic
1158568632 18:58577231-58577253 TGCCCCAAATTTCAAAGAGCTGG - Intronic
1162452981 19:10765899-10765921 AGCCCCAGTGTGCAAAGCACTGG + Intronic
1162478683 19:10915688-10915710 TCCCCCAGCTTGCAAGGCTGGGG + Intronic
1165315078 19:35049985-35050007 TGCCCCAGACTACAGAGCTATGG + Intronic
1167115327 19:47486104-47486126 TGCCTCAGCTTCCAAAGTTCTGG - Intergenic
925887744 2:8407736-8407758 TTCCCCAGCTTGCAAAGGGCAGG + Intergenic
927109455 2:19853756-19853778 AGTCCCAGATTGCACAGCTTTGG - Intergenic
928829578 2:35463947-35463969 TTACCCACATTCCAAAGCTCAGG + Intergenic
933222306 2:79704961-79704983 TGCCCCAGGTTGAGAAGCACTGG - Intronic
934090595 2:88547348-88547370 TCCCCCAGATCCCTAAGCTCTGG - Intergenic
936982091 2:118274371-118274393 TGGCCAAGATTCCAGAGCTCAGG - Intergenic
937247135 2:120500739-120500761 TGCCCAAGATCACAAAGCTACGG + Intergenic
938602008 2:132851767-132851789 TGCGTCAGATTGCAAATCACTGG + Intronic
945600431 2:211856295-211856317 TTCCCCAGACTTCACAGCTCTGG - Intronic
945935734 2:215901121-215901143 TGCCCCACACAGCAAAGCCCAGG + Intergenic
1168826859 20:819803-819825 TGCCCCAGTTTCCCCAGCTCAGG - Intergenic
1169868838 20:10230108-10230130 TCCCCCAGATTGCAAGTTTCTGG - Intronic
1170964425 20:21053293-21053315 TTCCCCAGCCTGCAACGCTCTGG - Intergenic
1171122653 20:22579712-22579734 TGCCTCAGGTTTCTAAGCTCAGG - Intergenic
1172732552 20:37100079-37100101 TGCCCTAGATAGCTCAGCTCTGG + Intergenic
1173135459 20:40435025-40435047 TGCCCAAGGATGCAAAGCTTAGG + Intergenic
1175383645 20:58580484-58580506 TGCCCCAAGTTGGAAAACTCTGG - Intergenic
1175572443 20:60034332-60034354 TCCCCCAGAGCACAAAGCTCTGG - Intergenic
1178974255 21:37208356-37208378 TGCCTCAGCTTTCAAAGGTCTGG - Intergenic
1180858906 22:19065619-19065641 TGCCACAGGTGGCAAAGCTAAGG + Intronic
1180938190 22:19639684-19639706 TGCCCCACCTTGAAAGGCTCTGG + Intergenic
1182436676 22:30335278-30335300 TGCCCAACAATGCAAGGCTCTGG - Intronic
1182929707 22:34160994-34161016 TGCCTAAGTTTGCATAGCTCAGG + Intergenic
1183520934 22:38295651-38295673 TGCCCGGGGTTGCACAGCTCAGG + Intronic
1184409135 22:44316611-44316633 AGCCCCAGTTTGCAAACTTCTGG + Intergenic
1185038860 22:48494090-48494112 TGCCCCAGAGTTCTGAGCTCAGG + Intronic
952807736 3:37372995-37373017 TGCACCAGATTGTAAAGTCCAGG - Intergenic
959924307 3:111904504-111904526 TGCCCCAGATTGCAAAGCTCTGG + Intronic
960140448 3:114147266-114147288 TGCCACAGAATGCAAAGCTTTGG - Intronic
963622232 3:147624791-147624813 TGCTCCAAATTGCCAAGTTCAGG - Intergenic
965781410 3:172289797-172289819 AGTGCCAGATTGCAAAGCACAGG - Intronic
969099482 4:4757939-4757961 TGCCCCAAATGGAGAAGCTCAGG - Intergenic
978460357 4:108945035-108945057 TACCCCAGTTTGAAAAGCACAGG - Intronic
980348852 4:131662880-131662902 TGCCCTAGGTTACAAACCTCAGG + Intergenic
981966064 4:150604815-150604837 TGCCCCACAATTCAATGCTCAGG + Intronic
985492716 5:188790-188812 TGCCTCTGGTTCCAAAGCTCGGG - Exonic
987058905 5:14223130-14223152 TGCCCAAGATTCCAAAGCTGGGG - Intronic
987104588 5:14625202-14625224 TGGCTCAGATGTCAAAGCTCTGG + Intergenic
987750474 5:22032460-22032482 TGCCTCAGCTTCCAAAGTTCTGG - Intronic
995511581 5:112915708-112915730 TACCCCAGAAGGCAAAGCGCAGG + Intronic
996307179 5:122060602-122060624 TGCTCCAATTTGAAAAGCTCAGG - Intronic
998914217 5:146996749-146996771 GGCCCCATATTGGAAACCTCAGG - Intronic
999447116 5:151648949-151648971 TGCTCCACCTTGCACAGCTCTGG - Intergenic
1000811585 5:165869700-165869722 AGCCTAAGATTGCAAAGCTGAGG + Intergenic
1001042073 5:168343415-168343437 TGCCCAAGATCACAGAGCTCAGG + Intronic
1001808564 5:174609560-174609582 CGCCCCTGACTGCAAAGCTTTGG + Intergenic
1003247956 6:4400118-4400140 CACCACAGATTGCAAAGCACAGG - Intergenic
1004130642 6:12915956-12915978 TGCCCTTGATTGAAAACCTCTGG + Intronic
1004134614 6:12954604-12954626 TGCCCCAGTTGCCCAAGCTCAGG - Intronic
1005080262 6:21950116-21950138 TGCCCAAGATCACAAAGCTAGGG - Intergenic
1008894250 6:56534393-56534415 TGCCCCTGATAGCAATGGTCGGG - Intronic
1012556767 6:100522816-100522838 TGCCTAAGGTTGCATAGCTCTGG + Intronic
1015851719 6:137581030-137581052 GGCCCTAGTTTGCAAACCTCTGG - Intergenic
1017153670 6:151303960-151303982 TGCCCCAGGTCACACAGCTCAGG - Intronic
1019806302 7:3128678-3128700 TGACACAGATTGCAAAACACTGG - Intergenic
1024853080 7:53744187-53744209 AGCGCCAGCCTGCAAAGCTCAGG - Intergenic
1026902375 7:74044357-74044379 TTCCCCAAACTCCAAAGCTCAGG + Intronic
1033719498 7:144042925-144042947 AGCCTCAGATCCCAAAGCTCCGG - Intergenic
1035280906 7:157777342-157777364 TGCCCCACACTGCTAAGCTCAGG + Intronic
1035280916 7:157777398-157777420 TGCCCCACACTGCTAAGCTCAGG + Intronic
1035280925 7:157777454-157777476 TGCCCCACACTGCTAAGCTCAGG + Intronic
1035280935 7:157777510-157777532 TGCCCCACACTGCTAAGCTCAGG + Intronic
1037263294 8:17031533-17031555 TGCCTCAGCTTGCAAAGTGCTGG + Intronic
1037522009 8:19689118-19689140 TGGCCCAGATTGCAGAGGACGGG - Intronic
1040060488 8:43099450-43099472 TCCCCCAGAGTTCAGAGCTCAGG - Intronic
1045218666 8:100175532-100175554 TGCCTCAGCTTCCAAAGTTCTGG + Intronic
1045699407 8:104849529-104849551 TGCCTCTGATTGAAATGCTCAGG + Intronic
1046763487 8:118045474-118045496 TGCCCCAGATTGCACATTTGGGG - Intronic
1047507010 8:125488037-125488059 TGCCCCAGTTTGACCAGCTCTGG - Intergenic
1047761373 8:127957152-127957174 TGCCCCAGGTTGCACAGCTTGGG + Intergenic
1048292606 8:133192077-133192099 AGCCCCAGATTCCACAGCCCAGG + Intronic
1048381573 8:133870261-133870283 ATCTCCAGATTGCAAAGCTCAGG + Intergenic
1049798733 8:144508163-144508185 AGCCCCAGAGGGCACAGCTCTGG + Intergenic
1050625528 9:7500071-7500093 TGCCAGAGGTTGCACAGCTCAGG + Intergenic
1052687307 9:31772368-31772390 TGCCAAAGACTGCAAAGGTCTGG - Intergenic
1058419491 9:104820576-104820598 TGCCCAAGATTGCAGAGCTCAGG + Intronic
1060195892 9:121623153-121623175 AGCCCCAGATTGCCAAGCCGGGG + Intronic
1060196899 9:121629622-121629644 TGCCCCAGACAGCCCAGCTCGGG - Intronic
1062402710 9:136379462-136379484 TACCCCAGATGGCAATGCTCCGG + Intronic
1187164359 X:16790954-16790976 TGCCCAAGGTTGCAGAGCTATGG - Intronic
1189960622 X:46321517-46321539 TGCCCAAGATTTCAAACATCTGG + Intergenic
1190731266 X:53227521-53227543 TGCCCCATATTGCCAAGGACTGG - Intergenic
1191221870 X:57998255-57998277 AGCCCCAGGCTGCACAGCTCAGG + Intergenic
1191626699 X:63277900-63277922 TGCTCCTAATTGCAAGGCTCAGG - Intergenic
1195214316 X:102683424-102683446 TGCCCAAGGTGGCAGAGCTCAGG - Intergenic
1195330768 X:103797452-103797474 TGCTCCAGAGAGCAAAGCTAGGG + Intergenic
1195574944 X:106439028-106439050 TGCCCCAGATTCCACAGATTGGG - Intergenic
1195889727 X:109679181-109679203 TGCCCCTGATTGAAAACCACTGG + Intronic
1198763889 X:140061825-140061847 ACCCCCAGATACCAAAGCTCAGG - Intergenic
1200216310 X:154369582-154369604 TGCCTTATATGGCAAAGCTCTGG + Intronic