ID: 959925202

View in Genome Browser
Species Human (GRCh38)
Location 3:111913300-111913322
Sequence TCTCCTGGAACACAGGGAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 390}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959925202 Original CRISPR TCTCCTGGAACACAGGGAGG AGG (reversed) Exonic