ID: 959925421

View in Genome Browser
Species Human (GRCh38)
Location 3:111915846-111915868
Sequence TAGGGAAGAAAGTAGGGGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 588
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 537}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959925421 Original CRISPR TAGGGAAGAAAGTAGGGGCA GGG Intronic
903846979 1:26284530-26284552 TAGGGATGAAAGTGGGGCCAAGG - Intronic
904270594 1:29347477-29347499 GAGGGAAGAAATTGGGGGCGGGG - Intergenic
904271130 1:29350741-29350763 GCAGGTAGAAAGTAGGGGCAGGG - Intergenic
904358184 1:29954974-29954996 GAGGGAAGCAACTAGAGGCATGG - Intergenic
904696424 1:32334317-32334339 CAGGGAAGGAGGTAGGGCCAGGG + Exonic
904934506 1:34120458-34120480 CAGTGAAGAAACGAGGGGCATGG + Intronic
905076901 1:35280188-35280210 AAGGGAAGAAAGGAAGGGAAGGG - Intronic
905508984 1:38503452-38503474 GAGGGAAGGAAGAAGGAGCATGG - Intergenic
905520950 1:38599210-38599232 TAGAGAAGAAAGCAGGGTAAAGG - Intergenic
906511761 1:46414027-46414049 TAGGTGAGAGAGGAGGGGCACGG - Intergenic
906803978 1:48761937-48761959 TAGGGATGTAAGGAAGGGCAGGG + Intronic
907776144 1:57517488-57517510 TGGGGAAGAGAGTAGGTGAAAGG + Intronic
907969411 1:59366182-59366204 GGGGGAGGAAAGTAGGGGAAAGG + Intronic
908440135 1:64145282-64145304 TATGGAACAAAGAAGGGGAAGGG + Intronic
908699794 1:66886778-66886800 CAGGGAAGGGAGTAGGGGCAGGG - Intronic
908756302 1:67471932-67471954 TAGGGAAGACAGCAGGTACAAGG + Intergenic
908901218 1:68958605-68958627 TAGGGAAGGAATTTGTGGCAGGG + Intergenic
909135995 1:71801008-71801030 TAGGAAAGAAGGTAGTTGCAGGG - Intronic
909480487 1:76124617-76124639 GAGGGAAAAAAGTTGGGGCCAGG - Intronic
910051504 1:82979267-82979289 TAGGGAACACAGTAGGAGCAAGG - Intergenic
910995561 1:93100996-93101018 AAGGGAAGAAATTGTGGGCATGG + Intronic
912230085 1:107783303-107783325 TAGGGAACAGAGAAGGGGCCAGG + Intronic
912489178 1:110052212-110052234 AGGGGAAGAAATTAGAGGCAGGG - Intronic
912690021 1:111797921-111797943 TGGGGATGAAAGTAGAGACAGGG + Intronic
913212128 1:116590498-116590520 TGAGAAAGAAAGCAGGGGCAAGG + Intronic
914391993 1:147232313-147232335 TTGGGAAGAAAGCTGAGGCAGGG + Intronic
914863933 1:151409630-151409652 AAGGGAAAAAAGTAAGGGCCAGG - Intronic
914904734 1:151734599-151734621 AGGGGAAGCAGGTAGGGGCAGGG + Intergenic
915411917 1:155707665-155707687 AAGGGAAGAAGATTGGGGCAGGG - Intronic
915475025 1:156148156-156148178 AAGGGAAGAAAATAGGGGCAGGG + Intronic
915594203 1:156887253-156887275 GAGGGAAGAAAGAAGGGAGAGGG - Intergenic
915630926 1:157153859-157153881 TTGAGAAGAAAGTGGGGGGAGGG + Intergenic
917216500 1:172683782-172683804 GAGGGTAGAAAGTAGGAGAAGGG - Intergenic
917290188 1:173464268-173464290 TTGGGAAGAAAGCTGAGGCAGGG + Intergenic
917904731 1:179577162-179577184 TATAGAAGAAAGTAGTGGAATGG - Intergenic
918064860 1:181093447-181093469 TAGGGAATAAAGTCTGGGCGCGG + Intergenic
918766246 1:188487332-188487354 GAAGGAAGAAACTAGGGGAAGGG - Intergenic
919816621 1:201444892-201444914 AAGGGGAGAAAGCAGAGGCATGG + Intergenic
919907097 1:202085578-202085600 TAGGGAAGGGGGTAGGGGCAGGG + Intergenic
920169296 1:204060505-204060527 TAGGGCAGAACCTAGGGACATGG + Intergenic
920212669 1:204339559-204339581 TTGGGAAGAATGGAGGGGCTTGG - Intronic
920337237 1:205253246-205253268 TACTAAAGAAAGAAGGGGCATGG + Intronic
920340585 1:205272917-205272939 CAGGGAAGACACTGGGGGCACGG - Exonic
921096030 1:211888021-211888043 TAGGGAACAAGGGAAGGGCATGG - Intergenic
922036991 1:221858490-221858512 AAGGAAAGAAAGAAGGGGCTGGG + Intergenic
922233079 1:223702918-223702940 GAGGGAAGAAAGTAAGGGAATGG + Intronic
922550596 1:226491430-226491452 TAGGCAAGAAAGATGGGGAAAGG + Intergenic
922719230 1:227891869-227891891 TGGGGCAGAAAGCAGGTGCAGGG - Intergenic
922722760 1:227906914-227906936 GAGGGAAGAAAGTAGGAGGAGGG - Intergenic
923227716 1:231954683-231954705 TAGGGAAGAAAGGAAGAGGAGGG + Intronic
923339724 1:232997093-232997115 TAGGGGAAAAAGGCGGGGCAGGG - Intronic
923763292 1:236867986-236868008 TAGGTGATAAAGCAGGGGCAAGG + Intronic
923930755 1:238693097-238693119 CAGAGAAGAAAGTAGAGGCAGGG + Intergenic
924011757 1:239672639-239672661 TAGGGGAGAAAGAATGGGAAAGG + Intronic
924204394 1:241696993-241697015 AAGGGAAGAAAGTAGAGGAGAGG - Intronic
1062767169 10:74683-74705 GAAGGAAGAAAGTAAGGGGAAGG + Intergenic
1063057051 10:2517055-2517077 TAAGGAAGGAGGCAGGGGCAGGG - Intergenic
1063663680 10:8049821-8049843 TAGGGAAGGAAATATGGACATGG + Intergenic
1064450090 10:15434392-15434414 GAGGGAAGAAAGGAGGGAAATGG - Intergenic
1064600571 10:16988104-16988126 TACGGGAGAAAGTAGAGACAGGG - Intronic
1064812487 10:19216464-19216486 TGGGGAGGAAAGTAGGAGAAAGG - Intronic
1064921151 10:20519932-20519954 AAGGGTAGAAAGGAGGGGAAGGG - Intergenic
1065177688 10:23095419-23095441 GAGGGAAGGAGGGAGGGGCAGGG + Intergenic
1068152031 10:53145018-53145040 GAGGGAGGAAAGGGGGGGCAAGG - Intergenic
1068821660 10:61383784-61383806 TAGGAAAGAAAGCAGTAGCAAGG - Intergenic
1068842636 10:61632328-61632350 AAGGTAAGAAAGGAAGGGCAGGG - Intergenic
1068846425 10:61680868-61680890 CAGGGAAGAAAGAAGGGGAAGGG + Intronic
1068976327 10:63013853-63013875 TATGGATGAAACTAGAGGCAGGG + Intergenic
1069546197 10:69330628-69330650 CAGGGAAGAAGGGAGGGGAAAGG - Intronic
1069694661 10:70377670-70377692 AAGGGCAGAGAGAAGGGGCATGG + Intronic
1070348309 10:75566957-75566979 TAGGGAAGGAAGCAAGGGAAGGG - Intronic
1070624929 10:78044273-78044295 TAGGAAAGAAAGCAGGGAGATGG + Intronic
1070742719 10:78913341-78913363 TGGGGAAGAGAGTCAGGGCAGGG - Intergenic
1070989720 10:80721050-80721072 CAGGCAAGAGAGTAGGTGCAGGG + Intergenic
1071028359 10:81141952-81141974 GAGGGAGGGAAGGAGGGGCAAGG - Intergenic
1071038763 10:81280949-81280971 CAGGGGAGACAGTAGGGGGATGG + Intergenic
1072259285 10:93652987-93653009 TAGGAAAAAAAGCAGGGGGAGGG - Intronic
1072899701 10:99396090-99396112 AAGGAAGGAAAGGAGGGGCAGGG + Intergenic
1073433050 10:103499320-103499342 TGGGGATGAGAGCAGGGGCAGGG + Intronic
1073944043 10:108730188-108730210 GAGGGAAGTAAGTAGAGGGAGGG + Intergenic
1074284445 10:112084853-112084875 TAGGTAATTAAGGAGGGGCAGGG + Intergenic
1075206607 10:120454692-120454714 GGGGCAAGAAAGTAGGTGCAAGG - Intergenic
1075245420 10:120818077-120818099 AAGGAAAGAAAGAAGGGGCCAGG - Intergenic
1075303677 10:121348512-121348534 AGGGGAAGAAAGGTGGGGCAAGG - Intergenic
1075420831 10:122299173-122299195 GATGGGAGAAAGTAGGGGCCAGG + Intronic
1075617585 10:123902926-123902948 AAGGGAAGAATGAAAGGGCACGG - Intronic
1076453722 10:130575078-130575100 GAGGGAAGAAAGGAGGGGAAGGG - Intergenic
1076991168 11:276010-276032 CAGGAAAGAGAGTAGGGGAACGG - Intergenic
1078446953 11:11411759-11411781 GAGGGAAGCAAGTCAGGGCAGGG + Intronic
1078618536 11:12886784-12886806 TTGTGAAGAAGGTTGGGGCATGG - Intronic
1079947271 11:26759857-26759879 TAGGAAAGAAATTAGAGGAAGGG - Intergenic
1081038475 11:38180050-38180072 TGGGGAAGAAAATATGGGTAAGG + Intergenic
1081841219 11:46202711-46202733 TAAGGAAGAAACTAAGGGCCCGG - Intergenic
1083279057 11:61614167-61614189 GAGAGAAGACAGTAGGGTCAGGG + Intergenic
1083713102 11:64560643-64560665 GAGGGAAGCAAGGAGGGGCTGGG - Intronic
1083826896 11:65209044-65209066 TTGGGTAGAAAGATGGGGCAGGG - Intronic
1084719145 11:70892946-70892968 TAGGGAAGGAAGTCAGGGAAGGG - Intronic
1084895757 11:72266661-72266683 TGGGGCTGAAAATAGGGGCAAGG - Intergenic
1086540275 11:87900720-87900742 TAGGGAAGAAGGAAGAGGGAGGG + Intergenic
1087461321 11:98452447-98452469 TAGGGAAGAAAGGAAAGGAAAGG - Intergenic
1087666324 11:101053513-101053535 GAGGGAAGAAAGGAGGGAGAAGG - Intronic
1087666353 11:101053600-101053622 GAGGGAAGAAAGGAGGGAGAAGG - Intronic
1087813122 11:102630383-102630405 AATGGAGGAAAGTAGGGGCCAGG + Intergenic
1087813803 11:102636511-102636533 AATGGAGGAAAGTAGGGGCCAGG + Intergenic
1087815875 11:102658147-102658169 TAGGGAAGAAAGGAGGTGGAGGG + Intergenic
1088438677 11:109843797-109843819 TGGGGAAGAGAGGAGGGGTATGG + Intergenic
1088461754 11:110091005-110091027 TTGGCAGGAAAGTAGGGGCTGGG - Intergenic
1088713596 11:112529398-112529420 TAGAGAAAAAAGAAGGGGAAAGG + Intergenic
1088720463 11:112587815-112587837 TAGGGAAGAAAAAAGGGGCTAGG - Intergenic
1089612421 11:119676985-119677007 CAGGGAAGAAATTAGGGTCTGGG - Intronic
1090156629 11:124444992-124445014 TAGGACAGGAAGTAGGGACAGGG - Intergenic
1090549697 11:127806439-127806461 GAGGGAAGAAAGCAAGGGCCTGG - Intergenic
1090803318 11:130187997-130188019 TGGAGAAGAAAGCAGGGGCTTGG - Intronic
1091018081 11:132072330-132072352 TAGGGAAGTAGGGAGGGGTAGGG + Intronic
1091192653 11:133707596-133707618 AAGGGAAGAAAAAAGGGGAAGGG + Intergenic
1091218805 11:133918927-133918949 TGGAGAAGGAAGGAGGGGCAGGG + Intronic
1091388893 12:113091-113113 GAGGGAAGGAAGTGGGGGCCAGG - Intronic
1092318176 12:7441083-7441105 TAGGGTAGTGAGTAGGGGAAAGG + Intronic
1093141626 12:15516549-15516571 GAGGGAAGAAGGAAGGGGGAGGG + Intronic
1093173232 12:15882455-15882477 GAGGGAGGAAAGTAGGGGATGGG - Exonic
1093357213 12:18180295-18180317 TAGGGAAGCAAGTAGGAACAAGG + Intronic
1093485995 12:19653106-19653128 TTGGGAAGAAACTGAGGGCAGGG + Intronic
1095599954 12:44002732-44002754 TAGAGAAGGAAGAAGGGACAGGG - Intronic
1096511680 12:52133460-52133482 TCGGGGAGCAAGTAGGGGCTGGG + Intergenic
1096796617 12:54081941-54081963 TAGAGAAGACAGTGGGGGGAGGG + Intergenic
1098288737 12:68934387-68934409 TCTGTAAGAAAGAAGGGGCAGGG - Intronic
1098514907 12:71364012-71364034 TAGGGAAGACTGTAGGTGAAAGG + Intronic
1098965108 12:76779433-76779455 TAGGCAAGAAAGTGTGTGCAGGG + Intronic
1099507268 12:83494761-83494783 TAGGCAATAAAGCAGTGGCAGGG - Intergenic
1100286282 12:93169610-93169632 GAGGGAAGAAAGGAAGGGGAGGG + Intergenic
1101452064 12:104788945-104788967 AGGGGCAGAAAGCAGGGGCAAGG + Intergenic
1101684269 12:107001641-107001663 TAGGAGAGAAAGAAAGGGCAGGG - Intronic
1101728636 12:107408464-107408486 CTGGGAAGACAGTAGGGGCAGGG + Intronic
1101909421 12:108850534-108850556 TAGGGAGGAAATCTGGGGCAAGG + Intronic
1102140581 12:110611735-110611757 TAGGAAAGAAAGTAGAGGGCTGG + Intergenic
1102230049 12:111256204-111256226 CAGAGAAGAAAGGAGGGCCATGG - Intronic
1102298304 12:111753905-111753927 CAGGAAACAAGGTAGGGGCAGGG + Exonic
1103192665 12:119015498-119015520 GAGGAAGGAAAGTAGGGGCTGGG - Intronic
1103517023 12:121514710-121514732 GAGTGAAGATATTAGGGGCAGGG - Intronic
1104384730 12:128340483-128340505 TAGGGAAAAAAGTAAGACCAGGG + Intronic
1104692907 12:130839748-130839770 GAGAAAAGAAAGTAAGGGCATGG + Intergenic
1105215373 13:18281120-18281142 TGAGAAAGAAAGCAGGGGCAAGG + Intergenic
1105281413 13:18964867-18964889 TAGAGGAGAAAGTGGGGGGAGGG - Intergenic
1105341425 13:19529624-19529646 AGGAGAAGAAAGTAGGGGAAGGG - Intronic
1105747458 13:23391454-23391476 TAAGGAAGAGAGTACGGTCAGGG + Intronic
1106220080 13:27739468-27739490 TATGGAAGAAAGAAGGAGAATGG - Intergenic
1107517070 13:41140045-41140067 TGGGGCAGCAAGTAGGGGGATGG + Intergenic
1108098741 13:46932779-46932801 TTGGGAAGAAAGCTGAGGCAGGG - Intergenic
1108221395 13:48236927-48236949 TAGGAGAGAAAATAGTGGCAGGG + Intronic
1108577120 13:51800104-51800126 TAGGGAATAAAGGAGGAGGATGG + Intronic
1109220176 13:59633602-59633624 TTGGGAAGAAAGTAAGTGAATGG - Intergenic
1109259764 13:60130455-60130477 TTAAGAAGAAAGCAGGGGCAAGG + Intronic
1110843986 13:80173176-80173198 GAGGGAAGGAAGTAGGGAGAAGG + Intergenic
1110887764 13:80659293-80659315 TTGGGAAGAAAGCTGAGGCAGGG - Intergenic
1111310307 13:86475608-86475630 TAGGCAAGAAAGCATGTGCAGGG + Intergenic
1111806442 13:93044395-93044417 TTGGGAAGAAAGCTGAGGCAGGG + Intergenic
1114438295 14:22726283-22726305 TGGGGAAGACAGCAGGGGCATGG + Intergenic
1114465922 14:22922671-22922693 AAGGGAAGAAAGCAGGAGGAAGG + Intronic
1114486010 14:23062129-23062151 GAGGAAAGAGAGGAGGGGCAGGG - Intronic
1114657028 14:24322460-24322482 TGTGGGAGAAAGGAGGGGCAGGG + Intronic
1115090266 14:29566560-29566582 TAGGCAAGAAAGCATGTGCAGGG + Intergenic
1115353685 14:32424644-32424666 GAGGGTAGAGAGTAGGGGGAGGG - Intronic
1116792501 14:49354340-49354362 GAAGGAAGAAAGAAGGGGCTGGG + Intergenic
1116844284 14:49850782-49850804 TAGGAAAAAAAGGTGGGGCAGGG + Intronic
1116877589 14:50128288-50128310 TAGGAAAGAAAGAAGGGAAAGGG + Intronic
1117533693 14:56684472-56684494 TTGGAAAGGAAGAAGGGGCAGGG - Intronic
1118243398 14:64083550-64083572 GAGGAAAGGAAGTAGGGACAAGG + Intronic
1119761324 14:77154040-77154062 TAGGAAAAAAAGTATGAGCAAGG + Intronic
1120030771 14:79638145-79638167 CAGGCTAGAAAGGAGGGGCATGG - Intronic
1120049515 14:79849033-79849055 TGGGGAAGAGAGTTGGGACAGGG - Intronic
1120278816 14:82412912-82412934 TTGGGAAGAAAGTAGAGGTAGGG + Intergenic
1120308142 14:82796583-82796605 TAGGCAAGAATGGAGGTGCAAGG + Intergenic
1120838683 14:89063751-89063773 TAGAGAAAAAAGCATGGGCATGG + Intergenic
1121077681 14:91083095-91083117 TAGGGTTGCAAGTTGGGGCAGGG - Intronic
1121950043 14:98163687-98163709 TAGAGAAGAAAGTAGGAGGATGG - Intergenic
1124602031 15:31141488-31141510 TAAGGAAGAAAATAGAAGCAAGG + Intronic
1125306623 15:38324476-38324498 TTTGGGAGAAACTAGGGGCAGGG + Intronic
1126106280 15:45149002-45149024 TGGGGCAGGAAGTAGGGGGAAGG - Intronic
1126352700 15:47761681-47761703 TGGGGAAGAAATTAGTGGCCTGG + Exonic
1126465095 15:48954665-48954687 TAGGGAAGAAAGTTCTGCCAGGG + Intronic
1126882744 15:53116929-53116951 AAGGGAAGAAAGAAAGAGCAAGG - Intergenic
1127129042 15:55842825-55842847 CAGGGAGGAAAGTAGAGGTAGGG - Intronic
1127906537 15:63380296-63380318 TAGGGAAGAAAGGAAGGGGAGGG + Intronic
1128675773 15:69607512-69607534 TAGAGAAGGAATGAGGGGCATGG - Intergenic
1128982859 15:72199192-72199214 TAGAGAAGCAAGTAAGGGCCAGG + Exonic
1129141779 15:73605166-73605188 TGTGGAAGAAACTGGGGGCAGGG + Intronic
1129322430 15:74782500-74782522 GAGGGAAGAAAGGCGGGGGAAGG - Exonic
1129384031 15:75185820-75185842 TAGGGAAGGAAGTGGGAGGAGGG + Intergenic
1129506877 15:76088801-76088823 AAGGGAAAAAAGGCGGGGCATGG + Intronic
1130241758 15:82200063-82200085 CGGGGAAGGAAGCAGGGGCAGGG + Intronic
1130458669 15:84141097-84141119 CGGGGAAGGAAGCAGGGGCAGGG - Intergenic
1131200231 15:90389311-90389333 TGGGGAAGACAGTATGAGCACGG + Intronic
1131287150 15:91069784-91069806 AAGGGAAGAATGCGGGGGCAGGG - Intergenic
1131443009 15:92472820-92472842 CAGGCAAGAAACTAGGGGCCAGG + Intronic
1131449289 15:92525872-92525894 AAGGGAGGAAAGAAGGGGGAAGG - Intergenic
1132082896 15:98882703-98882725 TAGGGTATACAGAAGGGGCAAGG - Intronic
1132839706 16:1973007-1973029 AAGGAAAGAAAGCAGAGGCAAGG + Intronic
1133392053 16:5418663-5418685 GAGGGAGGAAAGAAGGGGGAAGG - Intergenic
1134126816 16:11621755-11621777 TTGGGAAGAGAGTCGGGGCAGGG - Intronic
1134673696 16:16074551-16074573 TAGGGCAGGAAGGAGGGGCTGGG - Intronic
1135224197 16:20641375-20641397 TTGGGAAGAAAGCTGAGGCAGGG + Intronic
1135404978 16:22191080-22191102 GAGGGAGGAAAAAAGGGGCAGGG - Exonic
1135833509 16:25800419-25800441 TGGGAGAGAAAGTAGGGGGAAGG - Intronic
1135920296 16:26643415-26643437 AAGGAAAGAGAGGAGGGGCAGGG - Intergenic
1138303386 16:55951684-55951706 AATGAAAGAAAGTAGGGGGATGG + Intronic
1138750488 16:59413909-59413931 TAGTTGAGAAAGTAGTGGCAGGG - Intergenic
1140421228 16:74821094-74821116 CAGGAAAGAAAATACGGGCAGGG - Intergenic
1140628350 16:76821876-76821898 TAGGGAAGAGAGTGTGTGCAGGG + Intergenic
1140872057 16:79115383-79115405 TAGGAAAGAAACTCGGGGCATGG + Intronic
1141449816 16:84091188-84091210 TAGGTAAGAAAGAATTGGCAGGG + Intronic
1142792524 17:2278881-2278903 TAGAGAAGATAGCAGGGGCCAGG - Intronic
1143259311 17:5586237-5586259 TAGTGAAGCAGGGAGGGGCAGGG - Intronic
1144182999 17:12770324-12770346 TAGGAAAGAAAAGAGGGCCAGGG + Intergenic
1144609967 17:16702513-16702535 TAGGGAAGAGACCAGGGACAAGG - Intronic
1144928284 17:18833075-18833097 TAGGGAAGAGACCAGGGACAAGG - Intergenic
1144952394 17:19001248-19001270 CAGGGCAGAAAGCAGGGGCTTGG + Intronic
1145194952 17:20884104-20884126 TAGGGAAGAGACCAGGGACAAGG + Intronic
1145938873 17:28730955-28730977 AAGGAAAGAAAGAAGGGGCCGGG + Intronic
1146466757 17:33092322-33092344 AAGGGAAGAGAGTGAGGGCAGGG - Intronic
1146692977 17:34889457-34889479 TAGGGAAGAAAGGGGTGGAAGGG - Intergenic
1147178779 17:38672571-38672593 AAGGGAAGTAAGTTGGGGGAGGG + Exonic
1147440619 17:40444818-40444840 TAGGGAATAGAGAAGGGGCCAGG + Intronic
1149921046 17:60659863-60659885 TCAAGAAGAAAGTAGGGGAAGGG + Intronic
1151191649 17:72402700-72402722 TAAGTAACAAAGTAGAGGCATGG + Intergenic
1151323818 17:73366875-73366897 GAGGGGAGAGAGTAGAGGCAGGG - Intronic
1151326011 17:73380169-73380191 AGGGGAAGGAAGCAGGGGCAGGG - Intronic
1151547483 17:74802026-74802048 CCGGGAAGAAAGGAGGGACAGGG - Intronic
1151768315 17:76143520-76143542 GCGGGAAGAATGTAGGGGGAAGG + Exonic
1151823308 17:76509017-76509039 GTGGGAAGAAAAGAGGGGCAAGG + Intergenic
1151872296 17:76844592-76844614 TGGGGAAGAGAGAAGGGGGACGG + Intergenic
1152654774 17:81514536-81514558 TGGGGAAGAAAGGTGGGGGACGG - Intronic
1153552724 18:6279004-6279026 TAGAGAAAAAATTGGGGGCAGGG + Intronic
1154951461 18:21214062-21214084 TAGTGAAGTAGGTAGGTGCATGG - Intergenic
1155219547 18:23671810-23671832 TGGGGAAGACAGTATGGGGAGGG + Intergenic
1155527893 18:26735833-26735855 CAGGCAAGAGAGTAGGAGCAGGG - Intergenic
1156672769 18:39490898-39490920 TAAGGAAGAAAATGAGGGCATGG + Intergenic
1157174311 18:45437289-45437311 CAGGAAAGAAAGCAGGGCCAAGG + Intronic
1157384534 18:47250036-47250058 TAAGAAAGTAAGTAGAGGCAAGG + Intergenic
1158439055 18:57457470-57457492 GAGAAAAGGAAGTAGGGGCAGGG - Intronic
1158569581 18:58586279-58586301 TATGGTAGAAAGTAGAAGCATGG + Intronic
1158860297 18:61584920-61584942 TAGAGAAGAAATTAAGGGCAAGG - Intergenic
1158990031 18:62858756-62858778 TAGATAATAAAGTAGGGGCAAGG - Intronic
1159940383 18:74402489-74402511 AAGAGAAGAAAGAAGGGGGAAGG + Intergenic
1160786337 19:901659-901681 TGGGGAAGACAGTTGGAGCATGG - Intronic
1160898722 19:1415990-1416012 TAGGGAAAAAAGAAGGAACAGGG + Intronic
1161447839 19:4328145-4328167 TAGGGAAGAAGGTAGAGCCCAGG - Intronic
1162105535 19:8367485-8367507 ATGGGAGGAAAGTAGGGGAAAGG + Intronic
1162228249 19:9242844-9242866 GAGGGAAGAAAGAAGAGGAAAGG - Intergenic
1162609389 19:11737910-11737932 TTGGGAAGAAAGAAGGGACTGGG + Intronic
1162612652 19:11768048-11768070 TTGGGAAGAAAGAAGGGACAGGG - Intronic
1162713223 19:12611370-12611392 TTGGGAAGAAAGAAGGGACTGGG - Intronic
1163430165 19:17262693-17262715 TTGGGAAGCAGGAAGGGGCAGGG - Exonic
1163901390 19:20103382-20103404 TTGGGAAGAAAGCTGAGGCAGGG - Intronic
1164834296 19:31347963-31347985 AAGGGCAGAGAGTAGGGTCAGGG - Intronic
1164912564 19:32024939-32024961 CAGGGAGGAAAGGAGAGGCAGGG - Intergenic
1164956612 19:32392129-32392151 CAGGGAGGAAAGAAGGGGGAGGG + Intergenic
1165120178 19:33553777-33553799 TAGGGAAGTGAGGAGGGGCTAGG + Intergenic
1166695418 19:44848917-44848939 CAGGGAAGAAAGCTGGGGGAGGG - Intronic
1168320514 19:55506826-55506848 TAGGGAGCAAAGCAGGGGAAGGG + Intronic
1168533794 19:57152069-57152091 TAGTTAAGAAAGCAGTGGCAGGG + Intergenic
925763465 2:7208776-7208798 TTGGGGAGAAATTAGGGGAAGGG - Intergenic
926078731 2:9965997-9966019 CAGGGAAGAAGGCAGGGGCAAGG - Intronic
926341366 2:11907358-11907380 CAGGGAAGAAGGTATGGACAGGG - Intergenic
926457386 2:13083689-13083711 TAAGGAAGAAAGTAGGCCAAGGG - Intergenic
926602155 2:14856115-14856137 TTTGGAAGAAAGTAAGGGGAGGG + Intergenic
926641667 2:15244366-15244388 GAGGGAAGAAACTGGGGTCATGG + Intronic
926643040 2:15258340-15258362 TAGGGAACAAGGTAAGGGAAGGG + Intronic
926679982 2:15655581-15655603 TAGGGAGGAGGGTAGGGGCCGGG + Intergenic
926843371 2:17106811-17106833 TAGGGAAGAACATAGGGGCTGGG + Intergenic
927139700 2:20121419-20121441 TGGAGAAGAAAGAAGGGGCTTGG - Intergenic
928174755 2:29026136-29026158 AAGGCAAGAAAGTGGAGGCAGGG - Intronic
928182486 2:29079287-29079309 AAGGGAAGAGAGTATGGGGAAGG + Intergenic
928622994 2:33110000-33110022 TAGCGAAGAAAGTACAGGAAGGG - Intronic
929505571 2:42525502-42525524 AAGGGAAGAAAGGAAGGGGAAGG - Intronic
930317563 2:49816327-49816349 TAGGGAAAAGATTAGGGGGATGG - Intergenic
930871773 2:56178409-56178431 GAGGAAAGAAAGAAGGGGGAAGG - Intergenic
931321809 2:61179536-61179558 TAGGGAAGAAAGATGGCACAAGG - Intronic
932815278 2:74856149-74856171 TTGGGAGGGGAGTAGGGGCAGGG + Intronic
932939454 2:76145499-76145521 TAGAAAATAAAGTAGGGACATGG + Intergenic
933937014 2:87214525-87214547 TAGGGAAGAGGGTAGGGAGAGGG + Intergenic
934298955 2:91765607-91765629 TGAGAAAGAAAGCAGGGGCAAGG - Intergenic
934563930 2:95328056-95328078 AGGGGAAGAGAGCAGGGGCAAGG + Intronic
935088819 2:99874665-99874687 CAGGGCAGAAGGTTGGGGCATGG + Intronic
935326734 2:101944312-101944334 ACGGGGAGAGAGTAGGGGCATGG + Intergenic
936356128 2:111751299-111751321 TAGGGAAGAGGGTAGGGAGAGGG - Intergenic
936576935 2:113665088-113665110 GAGGGAAGAAACTAAGGACAAGG + Intergenic
937333078 2:121044236-121044258 AAGGGAAGAGGGAAGGGGCAGGG + Intergenic
939189593 2:138901370-138901392 TAGGGAGGAGAGGAGGGGCCTGG + Intergenic
939194940 2:138960308-138960330 AAGGGAAGAAGAAAGGGGCAAGG - Intergenic
939665282 2:144944302-144944324 TAGGAAAGTAAGTTGGGGAATGG + Intergenic
939779780 2:146431627-146431649 TTGGGAAGAAGGGAGAGGCAGGG + Intergenic
939954013 2:148509763-148509785 TTGGGAAGAAAGTTGGGCCACGG - Intronic
940205406 2:151196525-151196547 TTGGGAAAGAAGTTGGGGCATGG - Intergenic
940656155 2:156489921-156489943 GAGGGAAGAAAGGAGGGGAGGGG - Intronic
940665292 2:156601490-156601512 TAGGGAAGAAAGTATGGGGAAGG - Intronic
941861969 2:170292023-170292045 GAGGGAAGTGAGTAGGAGCAAGG - Intronic
942135976 2:172925938-172925960 GAGGGAAGGAAGGAGGGGGAGGG + Intronic
942378840 2:175365752-175365774 TCGGGGAGAAAGTAGGAGGAAGG + Intergenic
942426989 2:175870568-175870590 TAGGCAAGTTAGTAGGAGCAAGG - Intergenic
943176048 2:184475614-184475636 TAGGAAAGAAAGTAAAGGAATGG - Intergenic
944031797 2:195243137-195243159 TGGGGAAGAAAGGAGGGGCCTGG + Intergenic
944192429 2:197017887-197017909 TAGGGCAGCAAGGAGGGGAAGGG - Intronic
944850445 2:203713943-203713965 TAGGAAAGAAAGGAGGAGGAGGG + Intronic
945119054 2:206440260-206440282 TAGGGGAGAAAGTAGAAGAAGGG - Intergenic
945205712 2:207329680-207329702 GAAGGAAGAAAGGAGGGGTATGG + Intergenic
945246935 2:207727259-207727281 GAGGGAAGAAAATAAGGTCACGG - Intronic
945470871 2:210226325-210226347 TTGGGAAGAAAGCTGAGGCAGGG + Intergenic
945567417 2:211418264-211418286 TAGGAAAGAAAGGAGGAACATGG + Intronic
945613068 2:212030316-212030338 TAGGGGAGAAAGTGGTGGTAAGG - Intronic
945686426 2:212975980-212976002 TAGGGATGAAAGCAGGGGATTGG - Intergenic
945762831 2:213935457-213935479 ATGGGAAGAAAGAAGGGGCAAGG - Intronic
945973759 2:216254696-216254718 TATGGCAGAGGGTAGGGGCATGG - Intergenic
947030070 2:225783085-225783107 GAAGGAAGAAAGTGGGGGAAGGG - Intergenic
947380297 2:229538940-229538962 TAGGGAAGAAAGCAGTGAGAGGG - Intronic
947469082 2:230383506-230383528 GAAGGAAAAAAGAAGGGGCATGG + Exonic
948020990 2:234733042-234733064 TAGGGAAGAAAGATGGTCCATGG - Intergenic
948221189 2:236270971-236270993 GAGGGAAGAGAAGAGGGGCAAGG + Intergenic
948728923 2:239951395-239951417 TTGGGAAGAAAGTGGGGCCAGGG + Intronic
948949099 2:241237239-241237261 TAGGGGAGACAGAAAGGGCAAGG + Intronic
1168904448 20:1392395-1392417 GAGGGATGGAAGTGGGGGCAGGG + Intronic
1169036927 20:2461528-2461550 TAGGGAAGAAGGTAAGATCAGGG + Intergenic
1169314450 20:4576858-4576880 TGGAGAAGAATGTAGGTGCAAGG - Intergenic
1169544334 20:6635266-6635288 AAGGAAAGAAAGAAGGGGCAAGG - Intergenic
1169773760 20:9229847-9229869 GAGGGCAGGAAGTAGGGGGAGGG - Intronic
1170143401 20:13147562-13147584 TAGAGAAGCAGGGAGGGGCAGGG + Intronic
1170788896 20:19491638-19491660 TTGGGAACAGAGGAGGGGCAGGG - Intronic
1171223005 20:23418325-23418347 TAGCTAAGAAGGCAGGGGCAGGG + Intronic
1171245831 20:23608767-23608789 AAAGGAAGACAGCAGGGGCAGGG + Intergenic
1171848078 20:30289956-30289978 TAGAGAAGACAGTGGGGGGAGGG + Intergenic
1172091345 20:32434994-32435016 TTGGGAGGACAGTAGGGGCAAGG - Exonic
1172409666 20:34711680-34711702 TGGGGGAGACAGAAGGGGCAGGG + Exonic
1173175442 20:40761675-40761697 AAGGGAAGGAAGTGGGGGCTAGG - Intergenic
1173484863 20:43433532-43433554 GAGGAAAGAAAGGAGGGGAAGGG + Intergenic
1173928918 20:46802070-46802092 AAGGAAAGAAAGTAGGGAAAGGG - Intergenic
1174812387 20:53658066-53658088 ATGGGAAGAAAGAAGGGGGAAGG + Intergenic
1176195863 20:63836122-63836144 CAGGGGAGAAGGCAGGGGCAGGG + Intergenic
1176195932 20:63836312-63836334 CAGGGGAGAAGGCAGGGGCAGGG + Intergenic
1176358030 21:5969019-5969041 TAGGTAAGAAAGTAAGGACTTGG + Intergenic
1177080442 21:16632724-16632746 TAGGGAATAAGTTAGAGGCAGGG + Intergenic
1178503936 21:33148116-33148138 AAGGGAAGAATGAAGGGGCAGGG + Intergenic
1179136937 21:38687900-38687922 GAGGGATGAAAAAAGGGGCAAGG - Intergenic
1179452709 21:41476462-41476484 GAGGGAAGAAGGTGGGGTCACGG - Intronic
1179646971 21:42782055-42782077 GAGGGGAGAAAGGAGAGGCAGGG - Intergenic
1179765488 21:43569532-43569554 TAGGTAAGAAAGTAAGGACTTGG - Intronic
1181667488 22:24408158-24408180 TAGGGAGGAAACTAGGACCAGGG - Intronic
1181976862 22:26736556-26736578 CAGGGAAGAAATAAGGGGAAGGG - Intergenic
1182332313 22:29559985-29560007 TAGGGAAGAATGTGGGGAGATGG - Intronic
1183003676 22:34882333-34882355 TGGTGATGAAAGTATGGGCAAGG - Intergenic
1183232441 22:36591382-36591404 GAGGGAAGAAGGGAGGGGCTGGG + Intronic
1184042690 22:41953348-41953370 TGGGGAGGAAAGCAGGGGGATGG - Intergenic
1184988984 22:48154757-48154779 AAGGGAAGCAAGTTGGGGCTGGG + Intergenic
1184995008 22:48199185-48199207 TAGGGAAGAGAGTGGGGGAGGGG + Intergenic
1185025705 22:48410630-48410652 TGGAGAAGAAAGTAGGGGACAGG - Intergenic
949094610 3:71353-71375 TAGAGATGAAAGTGGGGGCCAGG - Intergenic
949727099 3:7061915-7061937 TAGATAAGAAGTTAGGGGCAGGG - Intronic
950453398 3:13078447-13078469 GAGGGGAGAAAGGAGGGGTATGG - Intergenic
950464226 3:13143773-13143795 GAGGGAAGGAAGTAGAGCCAGGG + Intergenic
950542207 3:13619382-13619404 CAGGGAAAAAAGCAGGGGAAGGG - Intronic
951378175 3:21949518-21949540 AAGGAAAGAAAATAGGGGCATGG - Intronic
952554544 3:34517409-34517431 TGGGGAAGGAGGGAGGGGCAAGG + Intergenic
952625666 3:35399759-35399781 TAGGGAAGAAGATAGGGCAATGG + Intergenic
952815939 3:37448042-37448064 TAGGTCAGAATCTAGGGGCAAGG - Intergenic
953329764 3:42043259-42043281 AAGGGAAGAAAGAACGGGAACGG - Intronic
953602429 3:44379890-44379912 TAGGGAAGAGAGTGGGAGGAGGG + Intronic
954448425 3:50558973-50558995 GGGGGAAGGAAGTAGGGGAATGG - Exonic
954576645 3:51680060-51680082 TAAGGGGGAAAGTAGAGGCAGGG - Intronic
955023942 3:55148976-55148998 GAGGTAAGAAAGAAAGGGCAGGG + Intergenic
955491893 3:59491042-59491064 TATGGAAGAAAGTGTGGGCCAGG - Intergenic
955645907 3:61137192-61137214 TGGGGAAGAAGGAAGGAGCAGGG - Intronic
955758250 3:62249297-62249319 GAGGGCAGACAGGAGGGGCAGGG + Intronic
957218981 3:77357792-77357814 TAGGAAATAAAGTAGGGAAATGG + Intronic
957435438 3:80168939-80168961 CAGGCAAGAGAGTGGGGGCAGGG + Intergenic
957512061 3:81201781-81201803 CAGTGAAGAGAGAAGGGGCAGGG + Intergenic
957883047 3:86247523-86247545 TATGGATTAAAGTAGGGGTAAGG + Intergenic
958050397 3:88336626-88336648 TAGGCAAGAAAGCATGTGCAGGG + Intergenic
958558297 3:95708062-95708084 TAGGGGAGAAATTAGGGCAAGGG + Intergenic
958832829 3:99110338-99110360 TATGGAATAAGGAAGGGGCATGG - Intergenic
959925421 3:111915846-111915868 TAGGGAAGAAAGTAGGGGCAGGG + Intronic
960304772 3:116047628-116047650 TGAGGAGGAAAATAGGGGCAGGG - Intronic
960428372 3:117537162-117537184 TGGGGAGGAAAGTAATGGCATGG - Intergenic
961284518 3:125790320-125790342 TAGCCAAGAAAGTTGGGGAATGG + Intergenic
961996749 3:131253535-131253557 TAGGGAAGGAAGAAGAGGAAAGG - Intronic
962106374 3:132394869-132394891 TAGGGAAAGAAGTAGAGGGAAGG + Intergenic
962191428 3:133315178-133315200 TACTGAAGAAAGTAAAGGCATGG + Intronic
962304589 3:134274266-134274288 CACAGAAGAAAGTAGAGGCAAGG + Intergenic
962867316 3:139458420-139458442 TGGGGCAGACAGTAAGGGCAGGG - Intronic
963890636 3:150632544-150632566 TAGGGAAGAGAGTTGGGGTAGGG + Intergenic
964646978 3:158968968-158968990 AAGGGAAGAAGGGAGGGGAAAGG + Intronic
965257083 3:166426511-166426533 TTTGGAAGAAAGTAAGGGAATGG + Intergenic
965961979 3:174440246-174440268 GAGGGAAGGAAGAAGGGGGAAGG - Intronic
966471302 3:180292187-180292209 GAAGGAAGAAAGTAGGGCAAAGG + Intergenic
966862749 3:184239661-184239683 GAGGCAAGACAGCAGGGGCATGG - Intronic
967410747 3:189164455-189164477 TAAGAAAAAAAGTAGGGGCCAGG - Intronic
967501043 3:190197735-190197757 AAGGGGAGAAAGAAGGGGAAAGG + Intergenic
968186684 3:196637603-196637625 CAGGGATGAGATTAGGGGCAGGG + Intergenic
969226502 4:5801925-5801947 GAGGGAAGAAAGGAAGGACAGGG - Intronic
969926180 4:10587806-10587828 TAGGGGAGACAGTAGGGACCGGG - Intronic
971265279 4:25091444-25091466 CAGGGGAGGAAGAAGGGGCAGGG - Intergenic
972094142 4:35327411-35327433 CTGGTAAGAAAGTAGGGGCTGGG + Intergenic
972388465 4:38590266-38590288 TAAGGAAGGAGGGAGGGGCATGG - Intergenic
972698617 4:41472348-41472370 GAGGGAGGAAGGGAGGGGCAGGG - Intronic
974939123 4:68442592-68442614 TGGGGAAGCAGTTAGGGGCATGG + Intergenic
975037120 4:69697849-69697871 CAGGCAAGAAAGTATGTGCAGGG + Intergenic
975504480 4:75122995-75123017 AAGGGAAGAAGGGAGGGGAATGG + Intergenic
975731771 4:77344350-77344372 TAGGCAAGAAAGAAGGGGTAAGG + Intronic
976126568 4:81839403-81839425 TGGGGAAGAAAGGAAGGACAAGG + Intronic
976776176 4:88708670-88708692 TGGAGAAGAAAGCAGGGGCAAGG + Intergenic
977193888 4:94034424-94034446 TAGAGAGAAAAGTAGTGGCAGGG - Intergenic
977869223 4:102070269-102070291 TAGGGAAGAATGAAGGGAAAGGG - Intronic
978904882 4:113994059-113994081 TAGGAATGAAAGTAGAGGAAAGG - Intergenic
979506404 4:121502617-121502639 GAGGGAAGGAAGGAGGGGGAGGG - Intergenic
979918823 4:126473790-126473812 CAGGCAAAAAAGGAGGGGCAGGG + Intergenic
979977477 4:127214461-127214483 TAGGGAAAAAAGGAGGGGCATGG + Intergenic
980018868 4:127683921-127683943 ATGGGAAGAAAGTAGGAGAAAGG - Intronic
980025135 4:127757274-127757296 CAGGGAGGAAAGTGGGGGAAGGG - Intronic
981092131 4:140742846-140742868 GAGAGAAGAAAGAAGGTGCAGGG + Intronic
981428726 4:144635361-144635383 TAGGGAAGAAGGCACGGTCACGG + Intergenic
982453201 4:155576867-155576889 TAAGGAATGAAGGAGGGGCAGGG + Intergenic
983238063 4:165202416-165202438 TAGGAAAGACAATAGGGGTAGGG + Intronic
983654203 4:170065030-170065052 GAGGGAAGAAGGGAGGGGTAGGG + Intronic
984555778 4:181212336-181212358 TAGGGAAGAGAGTCAGGGCTTGG + Intergenic
984991270 4:185383831-185383853 TAGTGAAGAATGCAGGGACATGG - Intronic
985120633 4:186637744-186637766 TTGGGAAGAAGGTAGGGGTGTGG - Intronic
985143297 4:186865259-186865281 TTGGGAAGAAATTTGGGGGAAGG - Intergenic
985937232 5:3106540-3106562 AAGGGAAGAAAGGAGGGGAGGGG - Intergenic
986530051 5:8726763-8726785 TGGGGAAGCAAGTAAGGGCCAGG - Intergenic
986558069 5:9031675-9031697 TGGAGAAGGAAGTTGGGGCAGGG - Intergenic
986598007 5:9443324-9443346 TAGGGAAGAAAGCAGAGAGAGGG + Intronic
986617389 5:9632562-9632584 TAGTTAATAAAGTAGTGGCACGG - Intronic
986875507 5:12103212-12103234 TAGGGAAGAAAGAAAGGGGTGGG - Intergenic
987474334 5:18372282-18372304 AAGGGAAGAAAGGAGGGGATGGG + Intergenic
987516782 5:18920234-18920256 TAGGGGAGAAAATATTGGCATGG + Intergenic
987795929 5:22626415-22626437 TAGGGAATAAAGCTGGGGCCTGG + Intronic
988036797 5:25837345-25837367 TGATGAATAAAGTAGGGGCAGGG - Intergenic
989714837 5:44450741-44450763 TAGGGAAGCTATGAGGGGCAGGG + Intergenic
990166988 5:53005329-53005351 TAGAGATGAAAGTGGGGGCCAGG + Intronic
990539434 5:56757430-56757452 GAGGGAAGAAAGTAGGCCAATGG - Intergenic
991068862 5:62455004-62455026 TAGGGACTAAAGTAGGGACTAGG + Intronic
992145380 5:73841795-73841817 TAGGGAAGGAAATAGGGAAATGG + Intronic
992751735 5:79868697-79868719 AATGGAATAAAGTTGGGGCAAGG + Intergenic
992804669 5:80324936-80324958 GAGAGAAAAAAGGAGGGGCACGG - Intergenic
995323388 5:110862499-110862521 TAGAGGAGAATGTAGGGTCATGG - Intergenic
996215056 5:120856195-120856217 TAGGGAAGCCAGAAGGGGGATGG - Intergenic
996562752 5:124848711-124848733 TAGGGAGGAAGGTGGGGGAAAGG - Intergenic
996722953 5:126647852-126647874 CTGGGAAGAAAGTAGGAGCTAGG + Intergenic
997779387 5:136641494-136641516 TAGGTAACAAAGTGAGGGCAAGG + Intergenic
998364610 5:141621169-141621191 CAGGGAAGAAATAAGGGGCAAGG + Exonic
1001084436 5:168690550-168690572 CAGGGAAGAATGAAGGGGCAAGG - Intronic
1001084734 5:168692313-168692335 GAGGCAAGGAAGAAGGGGCAGGG + Intronic
1001560225 5:172664171-172664193 TATGGAAGAAAGTTAGGACAGGG + Intronic
1002327618 5:178420352-178420374 GAGGAAAGAGAGGAGGGGCAGGG - Intronic
1002543361 5:179921264-179921286 TAGGGTAGAAAGAAGGGCAAGGG - Intronic
1002759077 6:187960-187982 AGGGGAAGAAATTCGGGGCAAGG - Intergenic
1003422961 6:5974445-5974467 TTGGGAAGCAAGTAAGGGCCAGG - Intergenic
1003835982 6:10073088-10073110 AAGGGAAGAAAATAGTGGAAAGG + Intronic
1004155980 6:13168722-13168744 TAGAGAAGATAGGAGGGGTAAGG + Intronic
1004205264 6:13586698-13586720 TAGGGAAGAGAGGAAGGGAAGGG + Intronic
1006205583 6:32338843-32338865 TAGGGAATAAACAAGGGGAAAGG + Intronic
1006300286 6:33190462-33190484 TAGGGGAGCAAGTGAGGGCAAGG - Intronic
1007119296 6:39366991-39367013 TGGGAAAGAAAGCTGGGGCAAGG + Intronic
1007187024 6:39980562-39980584 GAGGGGAGACGGTAGGGGCAGGG + Intergenic
1007340815 6:41190632-41190654 TAGGGAAGAAGTCAGGGACAGGG - Exonic
1007610766 6:43147391-43147413 GAGGGAAGGAAGAAGGGGCCGGG - Intronic
1007946166 6:45828956-45828978 TAAGGAAGAAAACAGGTGCAGGG + Intergenic
1008913077 6:56757681-56757703 GAGGGAAGGAAGAAGGGGCAAGG - Intronic
1008933021 6:56959245-56959267 TGGGGAAGAAACCATGGGCATGG - Intronic
1009490107 6:64279528-64279550 TAGGAAAGACAGCAGGGACATGG + Intronic
1010001798 6:70956302-70956324 TAGGGAGAGAAGTAGGGGCGCGG + Exonic
1011749770 6:90443324-90443346 TAGATAAGAAACTAGAGGCAAGG + Intergenic
1012664593 6:101951739-101951761 CAGGCAAGAAAGTATGTGCAGGG - Intronic
1015238935 6:131002351-131002373 GAGAGAAGAAAGAAGGGGAATGG + Intronic
1015378835 6:132543794-132543816 GAGGGGAGAAAGTAGAGACAGGG - Intergenic
1015719382 6:136225614-136225636 CAGGCAAGAGAGTAGGTGCAGGG + Intergenic
1015778217 6:136836370-136836392 TAAGGTAGAAAGCAGGGGAAGGG + Intronic
1016211753 6:141544458-141544480 TGGGGAAAACAGGAGGGGCAGGG + Intergenic
1016382388 6:143498396-143498418 TAGGTAGGAAAGGAGGGGCCTGG + Intronic
1016527371 6:145017366-145017388 TAGGAAAGCAAATAGGGACATGG - Intergenic
1016789334 6:148051588-148051610 TAGAGAAGGAAGTAAGGACATGG + Intergenic
1017134584 6:151136880-151136902 TCGGAAAGAGAGGAGGGGCAGGG - Intergenic
1017340617 6:153317349-153317371 AAGAGAAGAAAGTAGGGGGCTGG + Intergenic
1017713937 6:157194824-157194846 TAGACAAGAAAATAGGGGCCAGG + Intronic
1017930012 6:158943835-158943857 GAGGGAAGAAAGAAAGGGAAGGG - Intergenic
1018152970 6:160957081-160957103 CAGGGAAGAAGGTAGGGGGTGGG + Intergenic
1018272008 6:162089880-162089902 GAGGGAAGTGAGCAGGGGCATGG + Intronic
1018805257 6:167254367-167254389 TAGGAAAGAAGGAAGGGGAATGG + Intergenic
1018839777 6:167508747-167508769 TGGGGAGGAAAGGAGGGACAGGG - Intergenic
1020120040 7:5497984-5498006 TGGGGGAGAAAGTGGAGGCAGGG - Intronic
1021221033 7:17975594-17975616 TAGGGAAGTAAGGCCGGGCATGG + Intergenic
1021950511 7:25769569-25769591 GAGGGAGGAAAGAAGGGGAAGGG + Intergenic
1022205505 7:28159644-28159666 TGGTGGAGAAAGTAGAGGCAGGG + Intronic
1022332618 7:29394661-29394683 TAGATTAGACAGTAGGGGCATGG - Intronic
1022440465 7:30428823-30428845 GAGGCAAGAAAGAAGTGGCATGG + Intronic
1022692015 7:32665423-32665445 TGGGGAAGACAGATGGGGCAAGG + Intergenic
1022891968 7:34710325-34710347 TAGGGAAGAAAGCAGAGGAAAGG + Intronic
1022919684 7:34999976-34999998 TGGGGAAGACAGATGGGGCAAGG + Intronic
1023161898 7:37304988-37305010 TAGGGGAGAAAATATCGGCAAGG + Intronic
1023300112 7:38761176-38761198 GAGGGAAGAAAGGAAGGACAAGG - Intronic
1023559385 7:41458080-41458102 AAGGGAAGAAAGGAAGGGAAGGG - Intergenic
1023703797 7:42918519-42918541 GAGGGAGGAAAGTAGGGGATGGG - Intronic
1024920122 7:54546206-54546228 GAGAGAAGGAAGTAGGGGAATGG + Intronic
1025145385 7:56496701-56496723 TAGGGAAGAAAGGACAGACAGGG + Intergenic
1025260984 7:57417201-57417223 TAGGGAAGAAAGAACAGACAGGG + Intergenic
1025738298 7:64174411-64174433 TAGGGAAGAAAGGACAGACAGGG + Intronic
1026386752 7:69857534-69857556 AAGGGAGGAAAGTAGGGCTATGG + Intronic
1026910168 7:74086940-74086962 GTAGGAAGAAAGTAGGGTCAGGG + Intronic
1028212696 7:88094486-88094508 AAGGGATGAAAGTAGGAGGATGG + Intronic
1028388422 7:90286643-90286665 TCTGGAAGTGAGTAGGGGCATGG - Intronic
1028474399 7:91237914-91237936 TAGAAAAGAAAGAAGGGGAAAGG - Intergenic
1029478356 7:100798618-100798640 TAGGGGAGACAGAAGGAGCAGGG + Intergenic
1029654741 7:101916864-101916886 AAGGGAAGGAAGAAGGGGCCAGG - Intronic
1030229687 7:107194722-107194744 CAGGGAAGGAAGTAGGAGCTAGG + Intronic
1030380258 7:108803247-108803269 AAGGGAAGAAAGAAGGGGAAGGG - Intergenic
1030443872 7:109624714-109624736 TTGGGAAGAAAGCTGAGGCAGGG - Intergenic
1030585371 7:111412006-111412028 CAGGGAACAAAGTTGGGGCCTGG - Intronic
1030964290 7:115970414-115970436 GAGGGAAGGAAGTCGAGGCAGGG + Intronic
1032502456 7:132410121-132410143 TAGGGGTGAAAGTTGGGGGATGG + Intronic
1033784365 7:144712914-144712936 TAGGGAAGAAAGGGGGGGATGGG + Intronic
1034247157 7:149654962-149654984 TAGGAATGATAGTGGGGGCAGGG + Intergenic
1034730741 7:153385579-153385601 GAGGGAAGTAAGTATTGGCAAGG - Intergenic
1035352298 7:158255343-158255365 TCTGGAAGAAAGTAGGCCCAGGG + Intronic
1036950948 8:13138745-13138767 TAGGGTAGAGAGTGGGGGTAGGG - Intronic
1038030514 8:23634541-23634563 AAGGGAAGAAAGGAAGGGGAGGG - Intergenic
1038255481 8:25947279-25947301 CAGGGAAGAAAGCATGTGCAGGG - Intronic
1038791062 8:30668564-30668586 TCAGCAAGAAAGTAGGGGAATGG - Intergenic
1040548957 8:48423692-48423714 TAGGGAAGAAAGAGGGGTGAAGG + Intergenic
1041123978 8:54615900-54615922 TAGGCAAGAAAGAAGATGCAAGG + Intergenic
1041467678 8:58173448-58173470 TAGGGAAGATGGCAGGGGGATGG - Intronic
1041605625 8:59779602-59779624 TAGGGAAGAATGAAGGGAAAGGG + Intergenic
1042574895 8:70206845-70206867 TAGGTAAAAAAGTCGGGGCTGGG - Intronic
1042930686 8:74011045-74011067 TATGGAAGAAAGTGGGAGGAGGG - Intronic
1043221581 8:77672460-77672482 TAGGGAATCAAATAAGGGCATGG - Intergenic
1044092332 8:88017307-88017329 AAAGGCAGGAAGTAGGGGCAGGG + Intergenic
1045671885 8:104564525-104564547 TAGGGATGAGAGTAGGGGACAGG + Intronic
1046027298 8:108740186-108740208 TTGGGAAGAAAGCTGAGGCAGGG - Intronic
1046555561 8:115768716-115768738 AAGGGAAGAAAGGATGGGAAGGG - Intronic
1047109036 8:121768092-121768114 TAGGGTAGAACACAGGGGCAGGG - Intergenic
1048234935 8:132680699-132680721 AAGGGAAGAGAGGAGGGGAAAGG - Intergenic
1048263327 8:132964255-132964277 GAGGGAAGAAAGCAGGGGGCAGG - Intronic
1048460163 8:134614931-134614953 TAAGGAAGAAGGTAGGAGAAAGG + Intronic
1048837886 8:138538375-138538397 AAGGGAAGAAAGGAAGGGAAGGG + Intergenic
1050900359 9:10940650-10940672 TAGGGACAAAAGAAAGGGCATGG - Intergenic
1052849205 9:33366089-33366111 AAGGGAGGAAAGGAGGGGAATGG - Intronic
1052974791 9:34402540-34402562 GAGGGAAGAAAGTGGTGGGACGG - Intronic
1052986417 9:34491263-34491285 TAAGCTAGAAAGCAGGGGCAGGG - Intronic
1054855375 9:69893521-69893543 TGGGGAAGACAATAGGGACATGG - Intronic
1054895777 9:70309477-70309499 TAGGTGATAAAGTAGAGGCAGGG - Intronic
1055141639 9:72883210-72883232 TGGGGGAGAAAGAAGGGGAAAGG - Intergenic
1055247488 9:74264496-74264518 CAGGGATGAAAGGAGGGGAATGG + Intergenic
1055706557 9:79011408-79011430 GAGGAAAGAAAATAGGGGCCAGG + Intergenic
1055718848 9:79148856-79148878 AAGGGAAGAAAGTAGGGGGTGGG - Intergenic
1056578478 9:87873175-87873197 GAGGGAAGAAAGGAGAGGGATGG + Intergenic
1057810485 9:98253443-98253465 TAGAGAAGAAACTAGGGGAAGGG - Intronic
1057819734 9:98321833-98321855 CAAGGAAGCAAGTAAGGGCAAGG - Intronic
1058618550 9:106861044-106861066 TGGAGAAGAAAGGAGGGGGAGGG - Intergenic
1058847066 9:108971577-108971599 TAGGCAAGAAAGTATGTACAGGG - Intronic
1059230058 9:112712126-112712148 TAGCAAAAAAATTAGGGGCAAGG + Intronic
1061537365 9:131258434-131258456 AAGGGCAGAAAGAAGGGGCACGG + Exonic
1061761880 9:132857139-132857161 TAGGGAAGAAAGGTGGGGGAAGG - Intronic
1203443137 Un_GL000219v1:30032-30054 CAGGCAAGAAAGAAGGGTCACGG - Intergenic
1203513945 Un_KI270741v1:148941-148963 CAGGCAAGAAAGAAGGGTCACGG - Intergenic
1185533102 X:837738-837760 TAGAGCAGGAAGCAGGGGCAGGG + Intergenic
1186456560 X:9714434-9714456 CAGGGAGGAAGGTAGGGGGAAGG + Intronic
1186731576 X:12416185-12416207 AAGGGAAGAAAGGAGGAGGAAGG - Intronic
1186809168 X:13170258-13170280 AAGGAAAGAAAGAATGGGCATGG - Intergenic
1187188304 X:17009111-17009133 TAGAGAAGAGAGGAGGGGCTAGG - Intronic
1187761340 X:22589390-22589412 TAGAGAAGAGAAAAGGGGCAGGG + Intergenic
1188501184 X:30828476-30828498 TTTGGAAGAGAGTAGAGGCAGGG - Exonic
1189197128 X:39162170-39162192 TAGGGCAGAAAGGATGGGAAAGG - Intergenic
1189387451 X:40549067-40549089 GAGGGCAGAAAGTAGTGGCTTGG - Intergenic
1189588604 X:42487949-42487971 TGGGGAGCAAGGTAGGGGCAGGG + Intergenic
1190446302 X:50528272-50528294 CAAGCCAGAAAGTAGGGGCATGG - Intergenic
1190816933 X:53937636-53937658 AAGGAAGGAAAGTAGAGGCAGGG + Exonic
1192001985 X:67161211-67161233 TGGGGCAGAAAGTTGAGGCATGG + Intergenic
1192234204 X:69285725-69285747 TAAGGAAGAAAGGAGGGGAAAGG + Intergenic
1192470121 X:71391125-71391147 ACGGGAAGAAAGTAGAGGCCAGG - Intronic
1194034049 X:88848796-88848818 TTGGGAAGAAAGCTGAGGCAGGG - Intergenic
1195113453 X:101670257-101670279 TAGAGAAGTAAGCAGGGGCAAGG - Intergenic
1196206828 X:112949295-112949317 TGGAGAAGTAAGGAGGGGCAAGG + Intergenic
1196815912 X:119665511-119665533 TAGGGAAACCAGTAGGGGAAAGG + Intronic
1196838589 X:119836520-119836542 TAAGGAAGAAATTATGTGCAGGG + Intronic
1197161374 X:123326538-123326560 TTGGGAAGAAGGTATGGGAAAGG - Intronic
1197677721 X:129347841-129347863 TGTGGGAGAAAGTAGGGGAAGGG + Intergenic
1197723588 X:129761095-129761117 TAGTGAAGCAAGAAGGGGCAAGG + Intronic
1197856244 X:130916818-130916840 CACGGATGAAAGTATGGGCAGGG + Intergenic
1198006389 X:132498747-132498769 TAGGGAAGACAGTAGGGCTGAGG - Intergenic
1199327343 X:146514382-146514404 TGGGAATGATAGTAGGGGCAGGG - Intergenic
1199356887 X:146873100-146873122 TATGGAAGAAAGGAGGTGGAAGG + Intergenic
1200419349 Y:2947123-2947145 TATGGAAGAAAGTTGGACCATGG + Intronic