ID: 959926525 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:111927772-111927794 |
| Sequence | CTTGATAAACAGATGGTTCA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 2570 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 21, 4: 2547} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 959926525_959926527 | 17 | Left | 959926525 | 3:111927772-111927794 | CCTTGAACCATCTGTTTATCAAG | 0: 1 1: 0 2: 1 3: 21 4: 2547 |
||
| Right | 959926527 | 3:111927812-111927834 | TGATAAAATGATTTTTTAATTGG | 0: 1 1: 0 2: 5 3: 107 4: 950 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 959926525 | Original CRISPR | CTTGATAAACAGATGGTTCA AGG (reversed) | Intronic | ||
| Too many off-targets to display for this crispr | |||||