ID: 959926525

View in Genome Browser
Species Human (GRCh38)
Location 3:111927772-111927794
Sequence CTTGATAAACAGATGGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2570
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 2547}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959926525_959926527 17 Left 959926525 3:111927772-111927794 CCTTGAACCATCTGTTTATCAAG 0: 1
1: 0
2: 1
3: 21
4: 2547
Right 959926527 3:111927812-111927834 TGATAAAATGATTTTTTAATTGG 0: 1
1: 0
2: 5
3: 107
4: 950

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959926525 Original CRISPR CTTGATAAACAGATGGTTCA AGG (reversed) Intronic
Too many off-targets to display for this crispr