ID: 959927734

View in Genome Browser
Species Human (GRCh38)
Location 3:111942959-111942981
Sequence CCCAACCCTGTATTGTTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 167}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959927734 Original CRISPR CCCAACCCTGTATTGTTTTA GGG Intronic
903490851 1:23727198-23727220 ATCAACCCTGTAGGGTTTTAAGG + Intergenic
909205436 1:72750807-72750829 CCCAAACCTGTGTTGTTCAAGGG - Intergenic
910052895 1:82996988-82997010 CTTAACCCTGTATTGTTCAAGGG + Intergenic
910083841 1:83373912-83373934 CTAAAACCTGTATTGTGTTAAGG - Intergenic
910703403 1:90101326-90101348 GCTCACCCTGTATGGTTTTATGG + Intergenic
911646626 1:100343936-100343958 CCAACCCCTGTGTTGTTTAAGGG + Intergenic
912042088 1:105403903-105403925 TCCAACTCTGTAATGTTTTGTGG - Intergenic
914079373 1:144392573-144392595 CCTAACCCTATATTGTTCAAGGG - Intergenic
914099806 1:144573929-144573951 CCTAACCCTATATTGTTCAAGGG + Intergenic
915643741 1:157251908-157251930 CCCAACCTTGTATGGTCCTAGGG + Intergenic
917365042 1:174222123-174222145 CCCATCCCTGGCCTGTTTTACGG + Intronic
919010472 1:191954840-191954862 TCCTACCCTGTGTTGTTTAAGGG + Intergenic
919109839 1:193205087-193205109 ACCAACCCTGTATTTATTTTTGG + Intronic
919331270 1:196175249-196175271 CCTAACCCTGAATTGTTCAAGGG + Intergenic
920114224 1:203608619-203608641 GCCAGCCCAGGATTGTTTTAAGG + Intergenic
920163828 1:204020800-204020822 GCCAACTCTTTGTTGTTTTAAGG + Intergenic
920625704 1:207596134-207596156 CTCACCCCTCTTTTGTTTTATGG - Intronic
921128291 1:212197216-212197238 CCCCAACCTGCATTGTTGTAGGG + Intergenic
921580709 1:216892899-216892921 GCCAACCTTGCCTTGTTTTAAGG + Intronic
924546132 1:245029592-245029614 CCCAGCCCTGTTTTTTTTTTTGG + Intronic
1064454104 10:15470681-15470703 CCCAAACCTATATTGTTCTCAGG + Intergenic
1068568397 10:58600989-58601011 CCAACCCCTGTGTTGTTTAAGGG + Intronic
1068900557 10:62265046-62265068 CCCAAGCTTCTATAGTTTTATGG - Intronic
1071219127 10:83443220-83443242 CCAAATCCTGAATTGTTTTCTGG + Intergenic
1071690107 10:87809179-87809201 CCAATCCCTGTATTGTGTAAGGG - Intronic
1073887828 10:108061468-108061490 CCCAAACCTGTATCTTTTCATGG + Intergenic
1074910197 10:117901445-117901467 CCTAACCCTGTGTTGTTCAAGGG - Intergenic
1076136905 10:128051454-128051476 CCCAAGCCTGTCTTCCTTTATGG - Intronic
1077486321 11:2839998-2840020 CCCAACCCTGCATTGTTCAAGGG - Intronic
1080232437 11:30032928-30032950 CTAAGCCCTGTATTGTTTGAAGG + Intergenic
1080591837 11:33731202-33731224 CCTAACCCTGCATTGTTTTAGGG + Intronic
1082046874 11:47736908-47736930 CCCGGCCCTGAATTGTTTTTGGG - Intronic
1083257464 11:61505560-61505582 CCCAACTCTGTATTTTTTAAAGG - Intergenic
1086186544 11:84024114-84024136 CCCAACCCTACATTGTTTAAGGG + Intronic
1086536185 11:87849570-87849592 TCAAAACCTGTATTATTTTAGGG - Intergenic
1088338504 11:108736277-108736299 CACAACACTGTATAATTTTATGG - Intronic
1088523581 11:110726829-110726851 AACAACACTGTATTGCTTTATGG + Intergenic
1092315155 12:7404251-7404273 CCCAACACTATTTTATTTTACGG - Intronic
1092892849 12:12985317-12985339 CCCTACCCTGGATTATTTTTAGG - Intronic
1094062132 12:26325690-26325712 CCCAATCATGTTTAGTTTTAGGG - Intergenic
1095583541 12:43826614-43826636 CCCTGCACTCTATTGTTTTAAGG - Intergenic
1095724987 12:45441849-45441871 CCAAAGCCTGTATTTCTTTAGGG - Intergenic
1097993755 12:65864865-65864887 CTCAAACCTGTATTGTTCAAGGG - Intronic
1098580259 12:72091218-72091240 CCCAACCCTTTCTTGCATTATGG + Intronic
1098986093 12:77014042-77014064 CCCACCCCTTCATTGTTTAAGGG + Intergenic
1101641964 12:106592638-106592660 CCCAACCCTCTTATGTTTTTAGG + Intronic
1106016678 13:25875972-25875994 CCCAACCATGTGTTGGTTTAGGG - Intronic
1106127487 13:26912303-26912325 CTGAGCCCTGCATTGTTTTATGG + Intergenic
1107273241 13:38645186-38645208 CACAAACATGTATTATTTTAAGG + Intergenic
1110839981 13:80130793-80130815 CCCAAGCCATTATTGTTGTAAGG + Intergenic
1110913665 13:80995116-80995138 CCCAACCCTGACTCATTTTAAGG - Intergenic
1111443195 13:88307802-88307824 CCCAACGCTGCATAGTATTATGG - Intergenic
1111907714 13:94274555-94274577 GCCAACCCTGTATGGTGTTTAGG - Intronic
1112376381 13:98845657-98845679 CCCAGCCGAGTTTTGTTTTAGGG + Intronic
1113151942 13:107273764-107273786 GCCAACCCTGTTCTGTTCTATGG - Intronic
1116968949 14:51044736-51044758 GCCAACCTTGTTTTGTTATATGG + Intronic
1117263554 14:54062069-54062091 CCCAACCCTGCATTGTTGAAGGG + Intergenic
1117437821 14:55733989-55734011 GCAAACCCTGTTTTGTTTCAAGG - Intergenic
1118490898 14:66258504-66258526 CACAACCCTGTCTTGCTTTCTGG - Intergenic
1119585315 14:75828621-75828643 CCAACCCCTGTATTGTTCAAGGG + Intronic
1121702370 14:95964308-95964330 CCCTATCCTGCATTGTTCTAGGG - Intergenic
1124622165 15:31279998-31280020 CCCAACCCTGTTTGGATTTCTGG - Intergenic
1125287533 15:38110057-38110079 GCCAGCCCTGTCTTTTTTTATGG - Intergenic
1126055188 15:44723475-44723497 CCCAAATCTGTATTGTTCAAAGG + Intergenic
1128600860 15:68994366-68994388 GCCAAACCTGTATTCTTTAATGG - Intronic
1130410438 15:83643283-83643305 CCAAACCCTGTATTCTGTTGGGG + Intergenic
1130835066 15:87642265-87642287 CCCAACCCAGAACTGATTTAGGG + Intergenic
1131656085 15:94460684-94460706 CCCAACCCTGCAGTGCTTTGAGG + Intronic
1131878109 15:96832666-96832688 CCAAAACCTGTACTGTTTCAAGG + Intergenic
1132112015 15:99108466-99108488 CCCAAGCCTGTAATTTTTTTCGG + Intronic
1134009836 16:10843719-10843741 CCCAGCCTTGGAATGTTTTAAGG + Intergenic
1134363883 16:13558445-13558467 CCCAACCCTGTATTTCTCTTAGG - Intergenic
1136737906 16:32479144-32479166 TCCATCCCTGTTTTGCTTTAAGG + Intergenic
1137654176 16:50146106-50146128 CCCAACCCTGAATTGTTCAAGGG + Intergenic
1138967046 16:62097008-62097030 TCCAACCTTGTCATGTTTTAAGG - Intergenic
1139534271 16:67562156-67562178 CCCAACCCTGTACGGGTTCAGGG + Intergenic
1142312487 16:89322162-89322184 CCAACCCCTGTATTGTTCAAGGG + Intronic
1203015167 16_KI270728v1_random:350433-350455 TCCATCCCTGTTTTGCTTTAAGG - Intergenic
1203033502 16_KI270728v1_random:623591-623613 TCCATCCCTGTTTTGCTTTAAGG - Intergenic
1144471199 17:15542952-15542974 CCTCTCCCTGTTTTGTTTTAAGG + Intronic
1144925267 17:18801741-18801763 CCTCTCCCTGTTTTGTTTTAAGG - Intronic
1146065010 17:29627748-29627770 CCCAACCCTTTCTTGATTTTTGG - Exonic
1149626895 17:58085799-58085821 CCCAAGCCTCTGTTTTTTTAGGG + Intronic
1155387739 18:25298918-25298940 GCCAACGCTGCATTGTTTTGGGG - Intronic
1155555326 18:27012169-27012191 CTAAACCCTGTATTGTTCAAGGG - Intronic
1159694188 18:71533459-71533481 CCCTACCTTGTAATTTTTTAAGG - Intergenic
1163743315 19:19030192-19030214 CCCAGCCCAGTTTTGTTTTTTGG - Intronic
1163902286 19:20113925-20113947 ACTAACTCTGTATTTTTTTAAGG + Intronic
1165615554 19:37196925-37196947 CCCAAGCCTGCATCGTTTGAAGG + Intronic
1167423736 19:49418718-49418740 CCCAATCATGTATTCTTTTCGGG - Intergenic
1168370523 19:55830088-55830110 CTCAAACCTGTATTGTTCAAGGG + Intronic
925919941 2:8631641-8631663 CCCAGCACTGCCTTGTTTTAGGG + Intergenic
926868259 2:17384041-17384063 CACAACCCTGTAATGTTTGCTGG + Intergenic
927292043 2:21414004-21414026 TTCAACCCTGTGTTGTTTAAGGG - Intergenic
927944690 2:27128518-27128540 CCCAACGCTGTGGTGTTTTGAGG + Exonic
928212151 2:29331292-29331314 TCCAAACCTGTATTGTTCAAGGG - Intronic
931001794 2:57793515-57793537 CCCAACACTGTGTTGTCTTCAGG - Intergenic
931399890 2:61921741-61921763 CCCAACCCAGTATTATTTTGGGG + Intronic
937279990 2:120711208-120711230 CCCTTCCCTGTCTTCTTTTAAGG - Intergenic
938045250 2:128113085-128113107 CCCAAACCTTTATTGTTCAAAGG + Exonic
940315797 2:152326384-152326406 CCAAACCCTGAATTGTTCAAGGG + Intergenic
941195964 2:162452136-162452158 CCCAACTCTGGATTGTTCTGAGG - Intronic
941659888 2:168184959-168184981 ACCAACACTGTCTTGCTTTAAGG + Intronic
941744892 2:169076690-169076712 CCAATCCCTGTGTTGTTTAAGGG - Intronic
942105951 2:172633806-172633828 ACCTTCCCAGTATTGTTTTATGG + Intergenic
942991162 2:182204787-182204809 CCAACCCCTGTATTGTTCAAGGG + Intronic
944755923 2:202761485-202761507 CCCAACCATGTAATATGTTAGGG - Intronic
948425473 2:237884578-237884600 CCCCACCCTGTATGGCTTCAGGG + Intronic
1168787716 20:554334-554356 TCCAACCCTGAACTCTTTTATGG - Intergenic
1170512331 20:17091023-17091045 CTCTACCTTGTATTGTTCTATGG + Intergenic
1173215814 20:41082087-41082109 CCCAACCCCTTCTTGTCTTAGGG - Intronic
1174573113 20:51517619-51517641 CCCAGCCTTGTGTTGTTTTTTGG - Intronic
1180211784 21:46299267-46299289 CCCAACCCTTTGTTTCTTTAGGG + Intergenic
949302428 3:2599978-2600000 CCCAACTCTATTTTGGTTTATGG + Intronic
952573836 3:34749919-34749941 CCCAACTCTCTACTGTTTTCAGG + Intergenic
953268671 3:41418134-41418156 CCTAACCCTGTGTTGTTCAAGGG - Intronic
953444560 3:42951767-42951789 CCAAACTGTGAATTGTTTTAGGG + Intronic
954510824 3:51123324-51123346 CCCTACCCTATATTCTTTGAGGG + Intronic
955741756 3:62098558-62098580 CCCAACTCTGTTTTTTTTAATGG - Intronic
957421447 3:79977046-79977068 CCCAAATCTCTATTGTTTTCCGG + Intergenic
959793460 3:110393251-110393273 CCCAACTCTTTATTTTTTGAGGG + Intergenic
959927734 3:111942959-111942981 CCCAACCCTGTATTGTTTTAGGG + Intronic
960850969 3:122053363-122053385 CCTAAACATTTATTGTTTTAAGG + Intergenic
961745363 3:129060914-129060936 CCCAACCCTGTCTTGTTAAAGGG - Intronic
962124478 3:132601294-132601316 CCCAATCCTTTATGTTTTTATGG + Exonic
962833470 3:139164807-139164829 ACCAACCCTATAATATTTTAGGG - Intronic
963110831 3:141686532-141686554 CAGAAACTTGTATTGTTTTAAGG + Intergenic
965435356 3:168643866-168643888 TTCAAACCTGTATTGTTTAAGGG + Intergenic
969324473 4:6433196-6433218 CCCAACCCCGTGTTGTTCGAGGG + Intronic
971467478 4:26978848-26978870 CCCAACCCTGCATCCTTTCAAGG - Intronic
971824304 4:31601012-31601034 CTCAACATTTTATTGTTTTAAGG - Intergenic
971983845 4:33793684-33793706 CTAAACCCTGTGTTGTTTAAGGG + Intergenic
973167547 4:47096198-47096220 CCAAACCCTATATTGCTTTTAGG + Intronic
975099142 4:70492131-70492153 CCCAACCCTGTAGATTTTCAAGG + Intergenic
978256284 4:106696550-106696572 GCCAACCCTGGAATGTTTCAAGG + Intergenic
980597949 4:134980017-134980039 CCCAACCCTGAAATGATTTCTGG + Intergenic
981571758 4:146159201-146159223 CCCTAACCTGCATTGTTTGAGGG + Intergenic
982883659 4:160750639-160750661 CCCAACACTGTACTGTATTCAGG - Intergenic
984520340 4:180794957-180794979 CCCAACTCTGCATGGTTTTTAGG - Intergenic
995235419 5:109824113-109824135 CAAAACACTGTATTGTTTTCAGG - Intronic
997609621 5:135206433-135206455 CCCAGCCCTATATTATTTTAAGG - Intronic
998119657 5:139565443-139565465 CCCCACCCTGCTATGTTTTAAGG + Intronic
998769211 5:145522983-145523005 CCAATTACTGTATTGTTTTAAGG - Intronic
1002692796 5:181062143-181062165 CCCAGCTCTGTCTTGTTTGAAGG + Intergenic
1003947027 6:11085264-11085286 CCCCACCCTGTGTTGTTCAAGGG - Intergenic
1004576016 6:16895784-16895806 CCCAAACCTGCATTGTTCAAGGG + Intergenic
1008730160 6:54472672-54472694 CCAAACCCTGTAATGTTCCATGG - Intergenic
1010274109 6:73949105-73949127 CCAACCCCTTTATTGTCTTAGGG - Intergenic
1011013157 6:82724605-82724627 CCCAATTTTGTAATGTTTTATGG - Intergenic
1012404467 6:98879336-98879358 CCTAAACCTACATTGTTTTAGGG + Intronic
1012969085 6:105707399-105707421 CTCACCCCTGTATTGTTCAAGGG + Intergenic
1014313606 6:119835908-119835930 CCCAACAGTGTACTGTATTAAGG + Intergenic
1015686017 6:135861678-135861700 CCCAACAGTATTTTGTTTTAGGG - Intronic
1015979387 6:138823643-138823665 CCCAATCCTTTATGTTTTTATGG + Intronic
1026508442 7:71006837-71006859 CCCGACCAGGTATTGTTCTAAGG - Intergenic
1027300670 7:76830050-76830072 CTAAAACCTGTATTGTGTTAAGG - Intergenic
1031106916 7:117554996-117555018 TTCAAGCCTGTATTGTTTAAGGG - Intronic
1033392110 7:140938188-140938210 CCCTGCCCAGTATTGTTTAAGGG - Intergenic
1034200190 7:149279335-149279357 CCCAACCCTCTGTTCTTTTCAGG + Intronic
1034846445 7:154450744-154450766 CCAATCCTTGTTTTGTTTTATGG + Intronic
1034952617 7:155310573-155310595 TCAAACCCTGTGTTGTTTAAGGG + Intergenic
1038470045 8:27807876-27807898 CCCGACCCTCTATTTTTATAAGG - Intronic
1041427678 8:57741121-57741143 CCCAATTCTGGATTATTTTAGGG + Intergenic
1041728225 8:61038261-61038283 CCCAACCCAGTCCTGTTTTAGGG + Intergenic
1050038076 9:1458927-1458949 TAAAACCCTGTATAGTTTTAAGG - Intergenic
1051296775 9:15604706-15604728 CCAATCCCTGGATTGTCTTAAGG - Intronic
1051874977 9:21783093-21783115 GCAAACCCTGTATAGGTTTAAGG - Intergenic
1052434837 9:28413233-28413255 CCCCACCCCATATTGTTTAAGGG + Intronic
1056412258 9:86341666-86341688 CCAAACTCTTTATTGATTTAGGG + Intronic
1059198832 9:112395990-112396012 ACCAGCCCTGTCTTCTTTTACGG + Intronic
1059318415 9:113446959-113446981 CCCCTCCCTGTATTTTTTAAAGG - Intronic
1060024572 9:120160424-120160446 GCCAACACTGTATTTTTCTAGGG + Intergenic
1060297582 9:122353660-122353682 GCCACCCCTGCATTGTTTAAGGG + Intergenic
1190038491 X:47049459-47049481 CCCAACCCTTTTTTTTTTTCAGG + Intronic
1192459743 X:71306882-71306904 CCCAACCTTGCATTGTTCAAGGG - Intergenic
1193014349 X:76715684-76715706 GCCAATCCTGTATTTTTCTATGG - Intergenic
1196230864 X:113219436-113219458 CAAATCCCTGTATTGTTTAAGGG + Intergenic
1199733366 X:150659834-150659856 CTCTACCCTGTATTATTTTGGGG - Intronic
1202111421 Y:21425508-21425530 ACAAACCCTGTGTTATTTTATGG - Intergenic