ID: 959928962

View in Genome Browser
Species Human (GRCh38)
Location 3:111957767-111957789
Sequence GATGGTTATTTCCTGTGGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959928962 Original CRISPR GATGGTTATTTCCTGTGGCT AGG Intronic
900429035 1:2593349-2593371 GCTGGTTTTCCCCTGTGGCTCGG - Intronic
903068032 1:20711662-20711684 GATGGTAGTTTACAGTGGCTAGG + Intronic
904368184 1:30030964-30030986 GAAGGTTATTTCTTGTGTCCTGG - Intergenic
904954351 1:34270562-34270584 AAAGATTATTTTCTGTGGCTGGG + Intergenic
905164483 1:36070166-36070188 GATGGTTATTCCCTGTTTCTTGG + Exonic
906008245 1:42498255-42498277 AATGGTCATTGCCAGTGGCTGGG + Intronic
906576638 1:46897113-46897135 AATGGTTGTTGCCTGAGGCTGGG + Intergenic
906595280 1:47070472-47070494 AATGGTTGTTGCCTGAGGCTGGG - Intronic
909403230 1:75257964-75257986 AATGGCTATTTCCTTAGGCTAGG - Intronic
913332014 1:117675486-117675508 GATGTTTGTTTCCTATGGATCGG - Intergenic
917808995 1:178639172-178639194 GATAGTGATTGCCTGGGGCTAGG - Intergenic
918666669 1:187159694-187159716 GTTGTTTATATCCTGTTGCTTGG - Intergenic
918871850 1:189985006-189985028 GCTGATTATGTCCTGTGCCTAGG - Intergenic
919111923 1:193230605-193230627 ACTGGTTATTTCTTCTGGCTTGG - Intronic
919377064 1:196808353-196808375 GATTGTTATTTCCAGTGAATAGG + Intergenic
920049104 1:203152576-203152598 GATGGTTTTTTCCTGTCCCACGG + Intronic
920499136 1:206475375-206475397 CATGGTGGTTTCCAGTGGCTGGG + Intronic
922793813 1:228327571-228327593 ATTAGTTATTTCCTGGGGCTGGG - Intronic
924897193 1:248352877-248352899 TATAGTTTCTTCCTGTGGCTTGG + Intergenic
1071192347 10:83116017-83116039 GAGGGTTAGTTTCTGGGGCTGGG - Intergenic
1076598013 10:131637937-131637959 AATGGGAGTTTCCTGTGGCTGGG - Intergenic
1078657692 11:13257344-13257366 AATGGTGATTTCCAGGGGCTGGG + Intergenic
1079488389 11:20959978-20960000 GATAGTTATCTCTAGTGGCTGGG + Intronic
1079686390 11:23364090-23364112 GAGGTTTAGTTCATGTGGCTGGG + Intergenic
1081486917 11:43537954-43537976 GCTGGTTCTTGTCTGTGGCTTGG - Intergenic
1081708027 11:45197320-45197342 AATGGTGGTTTCCAGTGGCTGGG + Intronic
1083125481 11:60561371-60561393 GATGGTATCTTCCTGTGGTTTGG + Intergenic
1083459885 11:62804117-62804139 GAGGGTTCTTTCCTGTGGATAGG - Intronic
1083574754 11:63782151-63782173 GATGATTTTTTTCTGTGGCCAGG - Intergenic
1084874322 11:72119638-72119660 GATGGTGGTTTCCAGGGGCTGGG + Intronic
1085069228 11:73527360-73527382 GGTAGTTATTTCCTGTGGGATGG - Intronic
1086667897 11:89507122-89507144 GATGAAGATTTTCTGTGGCTGGG + Intergenic
1087134673 11:94704441-94704463 GATGGTTATGTTCTGTATCTTGG + Intergenic
1088502827 11:110499724-110499746 AAAGGTTATTTCCTGATGCTAGG - Intergenic
1088636790 11:111828850-111828872 GATGGTGATTTTCTTTGGGTCGG - Intronic
1089395421 11:118133616-118133638 CATGGTTTATTCCTCTGGCTTGG - Exonic
1089526547 11:119100981-119101003 GGGGGTGATTGCCTGTGGCTGGG - Intronic
1090004805 11:122992198-122992220 GATGGTTAAGTACTGTGGCCAGG - Intergenic
1090528486 11:127563259-127563281 GCTAGTTGTTTCCTGTGGCAAGG + Intergenic
1092012845 12:5129842-5129864 GATAGTAATTTTATGTGGCTAGG - Intergenic
1093730291 12:22558861-22558883 GATGGTAAGTTCCTTTGACTGGG - Intergenic
1094445729 12:30527675-30527697 AATGGTGATTACCTGAGGCTGGG + Intergenic
1095411352 12:41928172-41928194 GATGGTTCTTTCCTTGGCCTTGG - Intergenic
1101649740 12:106666357-106666379 GATGTTGTTTTCCTGTGGTTTGG + Intronic
1102961689 12:117097483-117097505 GATGGGCATTCTCTGTGGCTGGG - Intronic
1103681692 12:122699422-122699444 CGTGTTCATTTCCTGTGGCTGGG - Intergenic
1103683444 12:122712886-122712908 CATGTTCATTTCCTGTGGCTGGG - Intergenic
1107137422 13:36959185-36959207 AATGGTGGTTTCCTGAGGCTGGG + Intronic
1108549981 13:51534294-51534316 GGTGGTGACTTCCTGTGGGTCGG - Intergenic
1109623695 13:64945243-64945265 GATATTTATATCCTTTGGCTTGG - Intergenic
1110039670 13:70736984-70737006 TATGTTTATTTCCTTTGCCTTGG - Intergenic
1110822245 13:79930017-79930039 GATGGTTATTGCTGGTGCCTAGG - Intergenic
1111969523 13:94896855-94896877 AATGGTTGGTTGCTGTGGCTGGG - Intergenic
1114126192 14:19729501-19729523 GATGGTGATTGCCTCTGACTGGG + Intronic
1115305397 14:31928776-31928798 AATGGTGATTCCCAGTGGCTGGG - Intergenic
1116536062 14:46031866-46031888 GTTGCCTATTTCCTTTGGCTGGG + Intergenic
1117885337 14:60355502-60355524 GATTTTTATTTCCTCTTGCTGGG - Intergenic
1120049596 14:79849759-79849781 GATGGTAATTTCCTTTCCCTTGG - Intronic
1120279859 14:82425311-82425333 AATGATTTTTTCATGTGGCTTGG + Intergenic
1120343615 14:83254873-83254895 AATGTTTATTTTCTGTGTCTTGG + Intergenic
1121300698 14:92868363-92868385 AATGGTGATTTCCAGGGGCTGGG + Intergenic
1124349599 15:28945347-28945369 AGTGGTTATTTCCTGCGCCTTGG - Intronic
1125391422 15:39196747-39196769 GATGATCATTTCCTGTGCTTGGG - Intergenic
1126419645 15:48457827-48457849 GCAGGTTATATCCTGTGGCTTGG - Intronic
1130029067 15:80295448-80295470 GATGCTTAGGTCCTGTGCCTGGG + Intergenic
1130237949 15:82155608-82155630 GATAGGCACTTCCTGTGGCTTGG - Intronic
1134318277 16:13139699-13139721 GATGGTCAATTCCAGTGGTTTGG - Intronic
1134563729 16:15232822-15232844 GATGGTGATTACCAGAGGCTGGG + Intergenic
1136542700 16:30937212-30937234 GATGATGAGTTCCTGTGGCCTGG + Intronic
1137855246 16:51788319-51788341 TCTAGTTATTTCCTGTTGCTAGG + Intergenic
1138692135 16:58777999-58778021 GATGGTGATTGCCAGGGGCTGGG - Intergenic
1141326515 16:83065021-83065043 GATGGTGATTACCTGGGGCTGGG - Intronic
1142787261 17:2233925-2233947 GAGTGTTATATCCTGTGGCCTGG + Intronic
1144707533 17:17379493-17379515 GATGGTGGTTTCCTGGAGCTGGG - Intergenic
1145101985 17:20085133-20085155 GCTGGTCATTTGCTGTGCCTGGG + Intronic
1146233362 17:31133156-31133178 AATGGTGGTTTCCAGTGGCTGGG - Intronic
1147357901 17:39911985-39912007 GATGGTTAATTCCTCTGACTTGG - Intronic
1148334025 17:46829707-46829729 GATGGTTATCTCCTAAGGCCTGG + Intronic
1148341796 17:46877673-46877695 TTTGGTGACTTCCTGTGGCTGGG + Intronic
1149196002 17:54122046-54122068 GATGGTTATTTCCCTTGTCGTGG + Intergenic
1149369610 17:55979721-55979743 GATGGTGGTTTCCAGGGGCTGGG - Intergenic
1150862352 17:68814005-68814027 AATGGTTGTTTCCAGAGGCTGGG - Intergenic
1150887004 17:69098783-69098805 GATGGTTATTTCCAGGGGATGGG + Intronic
1150924581 17:69519318-69519340 CCTGGCTATTTACTGTGGCTCGG - Exonic
1152058284 17:78049827-78049849 AATTGCTATTTCCTGTGGCAGGG - Exonic
1152207318 17:78981104-78981126 GATGGTGACTTCCTGGGTCTAGG - Intergenic
1153167598 18:2280069-2280091 CATGTGTTTTTCCTGTGGCTGGG + Intergenic
1153570712 18:6470791-6470813 AATTGTTTTTTCCTGTGGATGGG + Intergenic
1154121230 18:11654204-11654226 GCTGCTTATTTCCTGTGGTAAGG - Intergenic
1154316658 18:13309692-13309714 GTGGAGTATTTCCTGTGGCTCGG + Intronic
1154945537 18:21158140-21158162 CAAGGGAATTTCCTGTGGCTAGG + Intergenic
1156741127 18:40329740-40329762 AATGGCTGTTGCCTGTGGCTAGG - Intergenic
1158016129 18:52786305-52786327 AATGGTGATTTCCTGCAGCTTGG - Intronic
1158090068 18:53700670-53700692 AATGGTGATTTCCAGGGGCTGGG - Intergenic
1160255420 18:77244103-77244125 GAGGGTTCTTCCATGTGGCTTGG + Intergenic
1165202239 19:34154531-34154553 GATGGTGGTTTCCAGGGGCTGGG + Intergenic
1166903821 19:46088876-46088898 GCTGATTATTTCCTCTGTCTGGG - Intergenic
1168000207 19:53439658-53439680 GATGGATAGTTACTGTGGCCTGG + Intronic
1168057378 19:53870681-53870703 GAAGTTACTTTCCTGTGGCTAGG + Intronic
926838419 2:17050647-17050669 GAGGGTAACTGCCTGTGGCTAGG - Intergenic
927636760 2:24822262-24822284 GATGGTTGTGTTCTGTGGCCAGG - Exonic
927895555 2:26779466-26779488 GAGGGGTATTTCCAGTGGATGGG - Exonic
929627133 2:43420973-43420995 GAAGGTTGTTTCCTATTGCTGGG - Intronic
929956771 2:46464218-46464240 GCTGGGTTTGTCCTGTGGCTTGG - Intronic
931696716 2:64876447-64876469 GATGGGAATTTCCTCTGGCCAGG - Intergenic
932375307 2:71230119-71230141 AATGGTGATTTCCAGGGGCTGGG - Intergenic
935547201 2:104413319-104413341 GATTGTGAGATCCTGTGGCTAGG - Intergenic
935632115 2:105220533-105220555 GCTGGTTCACTCCTGTGGCTTGG + Intergenic
936467400 2:112765346-112765368 AATGGTGATTGCCTGGGGCTGGG - Intergenic
936675815 2:114712732-114712754 AATGGATATTTCTAGTGGCTAGG - Intronic
940203526 2:151177022-151177044 GATGTTGATTACCTCTGGCTTGG + Intergenic
942863530 2:180644957-180644979 AAAGGTTATCTCATGTGGCTAGG - Intergenic
944042579 2:195373010-195373032 GATGGTTATTTGATGGGGGTGGG + Intergenic
944189233 2:196983494-196983516 GCTGGTAATTTCTTGTGGTTAGG + Intronic
945408546 2:209481403-209481425 GACAGTAACTTCCTGTGGCTAGG + Intronic
1171090261 20:22278526-22278548 AATGGTTATTTCCTTTCGTTTGG + Intergenic
1175496448 20:59417874-59417896 GAGGGTTCTTTACTGTGCCTGGG + Intergenic
1178729182 21:35083427-35083449 GATGGTTGTCTGCTGTGGTTTGG + Intronic
1178957211 21:37033724-37033746 GATGGTGATTACCAGAGGCTGGG - Intergenic
1179032574 21:37733398-37733420 GATGGGCATTTCCTTTGCCTGGG + Intronic
1179498386 21:41790539-41790561 GATGGTGATTGCCTGAGGCTAGG + Intergenic
1179983141 21:44906853-44906875 GCTGGTTATTGGCTCTGGCTGGG - Intronic
1180119298 21:45736233-45736255 GATTGTTATTCCCTGAGGCTTGG + Intronic
1181505656 22:23354945-23354967 AATGGATATTACCTGTGGCAAGG + Intergenic
1181656854 22:24308543-24308565 GATGTTAACTTCCTTTGGCTAGG + Intronic
1182948175 22:34344671-34344693 GCTGGTTATTTCTGCTGGCTTGG + Intergenic
1184346870 22:43918923-43918945 GATGGTGGTTTCCAGGGGCTGGG + Intergenic
949095255 3:78034-78056 GTTGGTTAGATCCTCTGGCTGGG + Intergenic
950032405 3:9861693-9861715 GATGGTTTTTGTCTGTGGCCAGG - Intergenic
950058413 3:10048107-10048129 GATGTTTATTTCTTGTTGGTTGG + Intronic
950905367 3:16532934-16532956 AATGGTTGTTTCCAGGGGCTAGG - Intergenic
951420051 3:22473482-22473504 GATGGATATTTGCTGTGCTTTGG + Intergenic
951433428 3:22634590-22634612 AATGGTGGTTTCCAGTGGCTGGG - Intergenic
951599989 3:24363027-24363049 TATTTTTATTTCCTGTGGTTAGG + Intronic
952526769 3:34218830-34218852 TATTGCTGTTTCCTGTGGCTAGG + Intergenic
953332830 3:42068494-42068516 GTTGGTTATTTTCAGTGCCTTGG + Intronic
953678274 3:45020256-45020278 GATGGTGGTTTCCAGGGGCTTGG - Intronic
955052683 3:55427983-55428005 GATGTTCATTTCCTGAGGCTTGG + Intergenic
956852221 3:73239806-73239828 GATGGTTGTTACCAGAGGCTGGG - Intergenic
958077687 3:88704257-88704279 GATGGGTATTTACTGTGGAATGG + Intergenic
959109353 3:102103601-102103623 GATGGTTCTATCCTATGTCTTGG - Intronic
959928962 3:111957767-111957789 GATGGTTATTTCCTGTGGCTAGG + Intronic
961014923 3:123460204-123460226 GATTGTGAAATCCTGTGGCTGGG + Intergenic
962463258 3:135634197-135634219 TATGGTTATTTCTTATGCCTGGG + Intergenic
963189974 3:142459040-142459062 GTTGGTTATATTCTGGGGCTTGG - Exonic
965065176 3:163839261-163839283 GGTGGTTTTCTCCTGGGGCTGGG + Intergenic
966472924 3:180312103-180312125 GGTTGTAATTTCCTGTGGCTGGG - Intergenic
971556001 4:28013727-28013749 GATGGATATTTCACATGGCTTGG - Intergenic
974113027 4:57547472-57547494 GATGATCATTTTCTGTGGCCAGG + Intergenic
974571271 4:63651942-63651964 GATTCTCTTTTCCTGTGGCTAGG - Intergenic
976961835 4:90986619-90986641 GAGGGTTATTGCATGTGGTTTGG - Intronic
980108803 4:128614885-128614907 CAAGGTGCTTTCCTGTGGCTAGG - Intergenic
983980672 4:173992023-173992045 GATGATTCTTTCCTGTGACAGGG + Intergenic
984421389 4:179526801-179526823 TATGGTTGTTGCCAGTGGCTGGG - Intergenic
984895682 4:184537566-184537588 GCTGGAGGTTTCCTGTGGCTTGG - Intergenic
985717612 5:1471531-1471553 GGAGGTTCTTTCCTGTGGCCTGG - Intronic
986746618 5:10750427-10750449 GACGACTATTTCCTCTGGCTTGG + Intronic
990852347 5:60220946-60220968 GAGGATTATTTCCTTGGGCTAGG - Intronic
990977350 5:61571481-61571503 GATGCTTATTCCCTCTGCCTGGG + Intergenic
991302745 5:65144996-65145018 GGATGTTATTTCCTGTGGTTTGG + Intergenic
993553741 5:89308885-89308907 GAGTTATATTTCCTGTGGCTTGG - Intergenic
994954265 5:106507182-106507204 AATGGTTATTACCAGAGGCTGGG + Intergenic
995167378 5:109060134-109060156 GATTGTATTTTCCTGGGGCTGGG + Intronic
996893776 5:128455822-128455844 GATGGTAGTCCCCTGTGGCTTGG - Intronic
997883197 5:137608913-137608935 GTTAATTTTTTCCTGTGGCTTGG + Intergenic
998921676 5:147075036-147075058 AATGGTTATATGCTGTAGCTGGG + Intronic
1000688140 5:164278829-164278851 GATGGTTCTTTCTTCCGGCTTGG - Intergenic
1003727502 6:8781835-8781857 AATGGTTATTACCAGAGGCTGGG - Intergenic
1008703537 6:54130180-54130202 GCTTGTTATTTCCTCTGGGTGGG + Intronic
1009738979 6:67719669-67719691 GATGGTTATTTCTTGGAGGTTGG - Intergenic
1010761930 6:79733559-79733581 GATGATGAATTTCTGTGGCTGGG + Intergenic
1011450709 6:87489164-87489186 CCTGGTTATATGCTGTGGCTTGG + Intronic
1012042169 6:94221529-94221551 TATTTTTATTTCCTGTGGTTGGG - Intergenic
1012070058 6:94603427-94603449 GATAGTTATTTCCTTGGCCTTGG - Intergenic
1012704313 6:102501787-102501809 GATGGTGATTTCCAGGGGCCAGG - Intergenic
1013523113 6:110950702-110950724 GATGGAGATTTCCTTAGGCTGGG + Intergenic
1017827861 6:158095774-158095796 GATGCTGGCTTCCTGTGGCTTGG - Exonic
1019263954 7:101864-101886 GATGCCTCTTTCCTGTGCCTGGG + Intergenic
1022351596 7:29571344-29571366 GAAGGTATTTTCCTGTGGCCGGG + Intergenic
1022689207 7:32629562-32629584 GATGGTGGTTTCCAGGGGCTGGG + Intergenic
1026671322 7:72393124-72393146 GATGGTTCTTGCTTGTGGCGGGG - Intronic
1032132888 7:129245521-129245543 AATGGTGATTTCCAGGGGCTGGG - Intronic
1032825365 7:135563073-135563095 GATAATTCTTTCCTCTGGCTAGG + Intronic
1033069448 7:138188783-138188805 GAAGGTTATTTACTGTAACTAGG + Intergenic
1033825500 7:145185192-145185214 GATTGTGATTTTCTGTGGCAGGG - Intergenic
1035479203 7:159168646-159168668 GATGGTTGTTACCAGGGGCTGGG + Intergenic
1039499270 8:38003868-38003890 GATGGTTATCTCTTGTGGGCAGG + Intergenic
1040585551 8:48737152-48737174 GGTGGTTATTTCTGGTGGCCTGG + Intergenic
1040915198 8:52562056-52562078 GATGTTTCTTTCCTTTGGCAGGG + Intronic
1042333580 8:67607945-67607967 GGTGGTTATTTCTTGTGAGTGGG + Intronic
1042375736 8:68050321-68050343 GCTGTTTAGTTCATGTGGCTGGG + Intronic
1043763630 8:84101232-84101254 GATGGTTATTTCCTGTGATTTGG + Intergenic
1044093635 8:88033996-88034018 GATGGGTATTGCCTGTTGATAGG - Exonic
1044720750 8:95143523-95143545 GCTGGGTATATCCTGTGGCCAGG - Intronic
1045382889 8:101644428-101644450 GCTGGTTCTTTCCTTTGCCTTGG + Intronic
1045702291 8:104880919-104880941 GGTGGTTATTTTCCATGGCTTGG + Intronic
1045706330 8:104927231-104927253 AATGGTTCTTGCCTGTGGCCTGG + Intronic
1047158283 8:122347021-122347043 GTTGGTTTTTGCCTGGGGCTGGG + Intergenic
1047356652 8:124128539-124128561 AATGGTGATTTCCAGGGGCTAGG - Intergenic
1049915299 9:311637-311659 GCTTGTTCTTTCCTGGGGCTGGG - Intronic
1050872608 9:10592491-10592513 CATGGCTATTACCTGTAGCTGGG - Intronic
1053548165 9:39045598-39045620 AATGGTCATTGCCTGGGGCTGGG - Intergenic
1053812287 9:41865636-41865658 AATGGTCATTGCCTGGGGCTGGG - Intergenic
1054618308 9:67321803-67321825 AATGGTCATTGCCTGGGGCTGGG + Intergenic
1055715202 9:79109964-79109986 AATGGTGATTTCCAGGGGCTGGG + Intergenic
1056389040 9:86123545-86123567 GATGGTAATATTCTGTGTCTTGG - Intergenic
1057515429 9:95716462-95716484 GATTGTTCTTTCATGTGGTTGGG - Intergenic
1058407647 9:104694817-104694839 GATGGTTGTGTCCCTTGGCTTGG + Exonic
1058410129 9:104722634-104722656 GATGGTTGTGTCCCTTGGCTTGG + Intergenic
1059377706 9:113898814-113898836 TGTGGTTCTTTCCTTTGGCTTGG + Intronic
1061300955 9:129704799-129704821 GATGTTGACTTCGTGTGGCTTGG - Intronic
1193897074 X:87127458-87127480 AATGATTATGTCTTGTGGCTTGG + Intergenic
1195879481 X:109577582-109577604 GATGATGATTGCATGTGGCTTGG - Intergenic
1197552683 X:127913295-127913317 AATGGTTATGTCCTGGTGCTGGG + Intergenic
1198278631 X:135120698-135120720 GGTGGGTATATCCTGTGGCTGGG + Intergenic
1198292330 X:135251818-135251840 GGTGGGTATATCCTGTGGCTGGG - Intronic
1199331230 X:146562105-146562127 AAGGGATATTTCCTGTGGCTTGG + Intergenic
1199489934 X:148387187-148387209 CAAGGTGCTTTCCTGTGGCTAGG - Intergenic
1202021167 Y:20466486-20466508 GGTGGCTTTTTCTTGTGGCTTGG + Intergenic