ID: 959929165

View in Genome Browser
Species Human (GRCh38)
Location 3:111959758-111959780
Sequence CTTGCTCCTCAGATCTTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959929165 Original CRISPR CTTGCTCCTCAGATCTTCCA AGG (reversed) Intronic
901325207 1:8361236-8361258 CTCCCTCCTCAGCTCCTCCAGGG - Exonic
901649372 1:10734853-10734875 CATGCTCCTCAGATCCTCCGTGG - Intronic
903676067 1:25065419-25065441 CTTGCTCTTCTTATGTTCCATGG + Intergenic
905162284 1:36046857-36046879 AGAGCTGCTCAGATCTTCCAGGG - Intronic
905273389 1:36801642-36801664 CATCCTCCTCAGATCTTCTGTGG - Exonic
905365437 1:37448694-37448716 CCTGCTCCTCAGATCTCCTGTGG + Intergenic
906757428 1:48331606-48331628 CTTTCTCCTCATGTCTTTCAGGG - Intronic
908457637 1:64319764-64319786 ATTGCTCCCCAGCCCTTCCAAGG + Intergenic
908785745 1:67732960-67732982 CCAGCTGCTCAGATCCTCCAAGG - Intronic
909880299 1:80867465-80867487 CTTCCTCCTCAGATTTTCTTAGG + Intergenic
910138091 1:83996528-83996550 CCTGATCCTCTGATCATCCAAGG + Intronic
912771078 1:112464826-112464848 CTTGCTCCTCAGGTCAGGCATGG + Intergenic
913062100 1:115217932-115217954 CCAGCTCCTCAGATCTGCGATGG - Intergenic
915723576 1:158001862-158001884 ATTGCTCCCCAGTTCTTACAGGG - Intronic
915899370 1:159835350-159835372 CATGGTCCTCATATCTCCCATGG + Exonic
915946160 1:160153181-160153203 CTTGGTGCTCAGCTCTTCCAAGG - Exonic
918078820 1:181190350-181190372 TTTTCTCCTCTGCTCTTCCAAGG - Intergenic
918614630 1:186530605-186530627 CATAATCCTCAGATTTTCCAAGG - Intergenic
921635735 1:217490011-217490033 CTTGCATCTCAGAACTTCCTTGG + Intronic
922975127 1:229777962-229777984 CTTGCTACTCTGGTCTCCCATGG - Intergenic
923993027 1:239460341-239460363 CTTGCTGCTAAGAAGTTCCAGGG + Intronic
1064300629 10:14119726-14119748 CCTGCCCCACAGACCTTCCAAGG + Intronic
1064982466 10:21178429-21178451 ATTTCTCCTCTGTTCTTCCATGG - Intergenic
1069704559 10:70450092-70450114 TTTTCTCCACAGCTCTTCCATGG + Intergenic
1071524176 10:86348571-86348593 CTTGCCCCTCAGAGCTCCCCAGG - Intronic
1071760390 10:88598186-88598208 CTTCCTCCACAGATCTTGCTAGG - Intronic
1072626778 10:97117224-97117246 CTTTATTCTCAGATCTTTCAGGG - Intronic
1072714921 10:97744633-97744655 CTTGTTCCTCACCTCCTCCAGGG - Intronic
1074495332 10:113975360-113975382 CTTTCTCCTTAGAACTTCTATGG + Intergenic
1075163186 10:120042283-120042305 CTTGCTGCTGTGTTCTTCCATGG + Intergenic
1075449067 10:122535257-122535279 CTTGAGCCACAGTTCTTCCAGGG + Intergenic
1076854473 10:133109086-133109108 CCTGCCCCTCATATCCTCCATGG + Intronic
1078897222 11:15607372-15607394 CTGGCTCCTCAGATACCCCAGGG - Intergenic
1079144023 11:17834570-17834592 CCTCCTCCTCAGATGTTCCAGGG - Intronic
1080782942 11:35448093-35448115 CATAATCCTCAGATTTTCCAAGG - Intronic
1081332594 11:41822993-41823015 CTTCTTCCTCAGGTCTTACATGG - Intergenic
1082891039 11:58139042-58139064 CTTCCTCCTCCCATCTTCCCAGG - Intronic
1083021826 11:59515548-59515570 CTTTCTCCTCATATCTTACACGG + Exonic
1083023738 11:59532420-59532442 CTTTCTCCTCATATCTTACACGG + Intergenic
1083731976 11:64657196-64657218 CTTGCTCCCCAGGACTTGCAGGG - Intronic
1085705888 11:78786631-78786653 CTTGCTCTTTAGCTCCTCCAAGG - Intronic
1088711893 11:112515960-112515982 CTTCCTCCTCAGGACTCCCAAGG - Intergenic
1089114414 11:116082734-116082756 CTGGCCCCACAGATCTTCCTGGG + Intergenic
1089849530 11:121484332-121484354 CTTCATCCTCATGTCTTCCAGGG - Intronic
1090836020 11:130454577-130454599 CTCTCTCCTAATATCTTCCAAGG - Intronic
1092117119 12:6017274-6017296 CTGTGTCCTCAGATCTTGCAGGG + Intronic
1094572820 12:31656484-31656506 CTAGCTCCCCAGACCTTCAATGG - Intronic
1095287306 12:40429584-40429606 CTTCCACCTTACATCTTCCAGGG - Exonic
1097284935 12:57869959-57869981 CTTCCTCCTCAGAGCTGTCATGG - Intergenic
1100081174 12:90852867-90852889 CTTGCTCCTCAGAGAGTTCATGG + Intergenic
1100922533 12:99504495-99504517 CTTGCTCCTTAGAAATTGCAAGG - Exonic
1102725487 12:115060734-115060756 CTTTCTGCTCAGATATTCCCTGG + Intergenic
1104041217 12:125132468-125132490 CTTGCAGCTCTCATCTTCCAGGG + Intronic
1105413910 13:20193050-20193072 CTGGGTCCTCAGAGCTTCCCGGG + Intergenic
1106483995 13:30156811-30156833 ATTGCTCCAAAGAACTTCCAGGG + Intergenic
1106516113 13:30455382-30455404 CTTACTCTTCATCTCTTCCAGGG + Intergenic
1108726113 13:53183314-53183336 CTTGCTTCCCAGATTTACCAAGG + Intergenic
1110144858 13:72178230-72178252 ATTGCTCCTCAGTGATTCCAAGG - Intergenic
1112739176 13:102454509-102454531 CTGCCTCCTCAGCTCTGCCAGGG - Intergenic
1112973162 13:105285587-105285609 CCAGCTCTTCTGATCTTCCAGGG - Intergenic
1114207184 14:20583162-20583184 CTGGCTCCTCTATTCTTCCATGG + Intergenic
1115140395 14:30164396-30164418 CTTGCTTATCAGGACTTCCATGG + Intronic
1115859738 14:37670922-37670944 CTAGCTCTTCAGATATTTCATGG - Intronic
1115926966 14:38447054-38447076 CATTATCCTCAGATTTTCCAAGG - Intergenic
1118331592 14:64819663-64819685 CTTCCAACTCAGAACTTCCAAGG + Intronic
1119319853 14:73723955-73723977 CTTCCTCCTCAGGTTTTCCAGGG - Intronic
1120300849 14:82704797-82704819 CATGATCATCAGATTTTCCAAGG - Intergenic
1120744377 14:88140597-88140619 CTTTCCCCTCAGATCTACCTAGG + Intergenic
1121690657 14:95875749-95875771 CCAGCTCCTTATATCTTCCAGGG - Intergenic
1122879176 14:104682344-104682366 TTTGCTCCTGAGCTCTTCCAGGG - Intergenic
1125163573 15:36676680-36676702 CTTTCTCCTCTGATCTTGAATGG + Intronic
1127136600 15:55930382-55930404 CTTTTTTCTCACATCTTCCAAGG - Intronic
1131622618 15:94083448-94083470 CATGCTCATCATTTCTTCCAAGG - Intergenic
1137664954 16:50244737-50244759 CCAGCTGCTCAGATCTTCCCGGG + Intergenic
1138043766 16:53699598-53699620 TTTGCTCTGCAGATCTTTCAGGG - Intronic
1138133973 16:54505416-54505438 CTGGCACATCAGTTCTTCCATGG + Intergenic
1139088233 16:63615102-63615124 CTTGCTCACCAAATATTCCATGG - Intergenic
1139504114 16:67390566-67390588 CTTGGTCGCCAGCTCTTCCAGGG + Exonic
1141463301 16:84191203-84191225 CTAGCGCCTCAGATCTTCGTTGG + Exonic
1144621597 17:16821971-16821993 CTTGTTCCTCAGATCCTCGATGG + Intergenic
1144884821 17:18450743-18450765 CTTGTTCCTCAGATCCTCGATGG - Intergenic
1145147403 17:20493634-20493656 CTTGTTCCTCAGATCCTCGATGG + Intergenic
1146232826 17:31129242-31129264 CTTTCTCCCCATATCTTTCAGGG + Intronic
1147573578 17:41586310-41586332 CTTGTTCCTCAGGTCCTCAATGG + Exonic
1147577694 17:41612158-41612180 CTTGTTCCTCAGGTCCTCGATGG + Exonic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1148044364 17:44733562-44733584 CTTGGTACCAAGATCTTCCAGGG + Intronic
1148781287 17:50123525-50123547 CTTGCTCCCCAGCCCCTCCAAGG - Intronic
1149433565 17:56614834-56614856 CTGGCTCATCAGATCATCCAAGG - Intergenic
1150784589 17:68152263-68152285 CCTGCTCCTCCCATCTCCCATGG - Intergenic
1151593471 17:75062320-75062342 CTTGCTCCTCACTTCTTCCCTGG + Intronic
1155463717 18:26112537-26112559 CTTTCTCCTCATCTCTTTCAGGG + Intergenic
1156498564 18:37542358-37542380 CTGGCTGCTCTGATCTTCCATGG + Intronic
1157271504 18:46279878-46279900 CTTACTCCACAGAACTGCCAGGG + Intergenic
1161569551 19:5023078-5023100 CGGGCTCCCCAGATCATCCAGGG - Intronic
1161677623 19:5661324-5661346 CTCACTCCTGAGATCTTCCTGGG + Intronic
1161912273 19:7203493-7203515 CTTGCAATTCAGACCTTCCACGG - Intronic
1162181474 19:8871941-8871963 CTTCCTCCTCCTATCTTCCTAGG + Intronic
1162839357 19:13344589-13344611 CTTGATCATCAGCTCCTCCAGGG + Intronic
1163491404 19:17619100-17619122 CATCCTCCTCAGTTCTTCCTGGG - Intronic
1164955332 19:32378027-32378049 CATGTTCCTCAGATCTGTCAAGG + Intronic
1166209656 19:41298061-41298083 TTTGCTCCTCAGATCTAGCTAGG + Intronic
1166581149 19:43901215-43901237 CTGGCTCCTCGGCGCTTCCAAGG + Intronic
1167223576 19:48220392-48220414 CTTGTTTCTCACCTCTTCCAAGG + Intronic
1167752478 19:51389148-51389170 CTGGCTGCTCAGCTCTCCCAAGG + Exonic
925459455 2:4047747-4047769 CTTGCTTCTCACAGCTTCCCAGG + Intergenic
927920986 2:26971359-26971381 CTGGCTGCTCAGAGCTTGCAGGG + Intronic
928621389 2:33091806-33091828 CTGCCTCCTGAGCTCTTCCAGGG + Intronic
928789458 2:34933359-34933381 GTTGGTCCTCAGATTCTCCAGGG - Intergenic
930304683 2:49664053-49664075 CTTTCTCCTCATCCCTTCCAGGG + Intergenic
931371902 2:61671167-61671189 CTCTCTCCCCAGATCTTCCCTGG + Intergenic
931856968 2:66312962-66312984 CTTGCTGGTCAGAGATTCCATGG + Intergenic
932763380 2:74455228-74455250 CTTGCTCCTCGGAGAGTCCAGGG + Intronic
932973234 2:76571340-76571362 CTCCCTCCTCATATCTTCCTGGG + Intergenic
933085607 2:78051301-78051323 CATAATCATCAGATCTTCCAAGG - Intergenic
935300447 2:101689316-101689338 CTAGCTCCTCAGACCTCCCCTGG + Intergenic
938263537 2:129911176-129911198 CTGGCCCTTCAGATCTTCCTGGG - Intergenic
947926345 2:233925625-233925647 CTTCCTCCTCACCCCTTCCAAGG - Intronic
948630882 2:239301898-239301920 CTTGCTCCTCACTACTGCCAAGG + Intronic
949054187 2:241916352-241916374 CTTTCTCCTCATCTCTTTCAGGG - Intergenic
1170362300 20:15559547-15559569 CTTTGTCCTCAATTCTTCCAAGG - Intronic
1170510628 20:17072832-17072854 GGTACTCCTCAGTTCTTCCAGGG + Intergenic
1171072297 20:22084546-22084568 CCTGTCCCACAGATCTTCCAAGG + Intergenic
1172804992 20:37605373-37605395 TTTGCTCCTCAGATCTCCAGAGG + Intergenic
1173017920 20:39243782-39243804 CTTGCTCTTCAGGACTTCCATGG - Intergenic
1173091155 20:39973590-39973612 CCTAATCCTCAGATTTTCCAAGG - Intergenic
1173616772 20:44408288-44408310 CTGGGACTTCAGATCTTCCAAGG - Intronic
1174044506 20:47724016-47724038 TTTGTTCCTCAGAACTTCCAAGG - Intronic
1175116410 20:56685752-56685774 CTTGCTCCTCAGTTCTCCACTGG + Intergenic
1175610490 20:60347357-60347379 CTTGCTCCTCAGTCCTCCCTTGG - Intergenic
1176258236 20:64164971-64164993 CATGCTCCTCTGAGATTCCAGGG + Intronic
1180054761 21:45351987-45352009 CAAGCTGCTCAGATTTTCCAGGG - Intergenic
1180568555 22:16695760-16695782 CTGTGTCCTCAGATCTTGCAAGG + Intergenic
1180958719 22:19752687-19752709 CTTCCTTCTCAGAGCTTCCCAGG + Intergenic
1182219998 22:28751003-28751025 ATTGCTCCTTAGACCTTTCATGG + Intronic
1182973796 22:34603388-34603410 CTCCCTCCTCTGAGCTTCCATGG + Intergenic
1183903103 22:41021159-41021181 CTGGCTCCTGGCATCTTCCAGGG + Intergenic
949847550 3:8387189-8387211 CCTGCTCCTCAGATCATGCCTGG + Intergenic
950357815 3:12426411-12426433 ATTGCTCCTCAAATCATCCATGG + Intronic
950514002 3:13452124-13452146 CTGGCTCTTCAGGTCTTCCTGGG + Intergenic
952254035 3:31680317-31680339 CCTGCTCCTCTGCTCTTCCTGGG + Intronic
954518118 3:51198160-51198182 CTTGCTCCTCAGACACTTCAGGG + Intronic
954624591 3:52015690-52015712 CCTCCTGCTCAGCTCTTCCAGGG - Intergenic
955883602 3:63574147-63574169 CTTGCTCCCCAAATATTACAGGG - Intronic
955948940 3:64222683-64222705 TTGGCTCCTCAGAAGTTCCAAGG - Intronic
956906739 3:73773678-73773700 ATTGCTATTCATATCTTCCATGG + Intergenic
959929165 3:111959758-111959780 CTTGCTCCTCAGATCTTCCAAGG - Intronic
961981157 3:131080534-131080556 CTTGCTCCACAAAACTTGCATGG - Exonic
963604694 3:147404590-147404612 CTTGCTCCCCACATCAACCACGG + Intronic
964705188 3:159610749-159610771 ATTGCTCTTCAGAGCTTGCATGG + Intronic
964893365 3:161563421-161563443 CTTGCTCCTCTGTTCTTACATGG - Intergenic
965678524 3:171225545-171225567 CTGCCTTCTCAGTTCTTCCAAGG - Intronic
967882064 3:194308438-194308460 CTTGTTTGTCAGAACTTCCAGGG + Intergenic
969350837 4:6597027-6597049 CCAGCTTCTCAGCTCTTCCAGGG + Intronic
970369570 4:15393595-15393617 ATTGGTCCTCAGAATTTCCAGGG - Intronic
976902274 4:90193030-90193052 CTTGCTCCTGAGATTCTCAATGG - Intronic
978241328 4:106520226-106520248 CATTCTCCTCACCTCTTCCAGGG + Intergenic
979226295 4:118289341-118289363 CTTGTTCATCAGAGCTTCCTTGG - Intronic
979637322 4:122971991-122972013 CTTGCTCCTCAAATCTTAAAGGG - Intronic
982653372 4:158116185-158116207 CTTTCACATCAGATCTTCCTTGG + Intergenic
984141910 4:176013940-176013962 ATTGCCCCACAGCTCTTCCAGGG - Intergenic
984452450 4:179919944-179919966 CTGGTTACTCAGATTTTCCATGG + Intergenic
986478936 5:8165081-8165103 CATAGTCTTCAGATCTTCCAAGG - Intergenic
986491835 5:8300710-8300732 CTTGCCCCTCAGAACTTTGAGGG - Intergenic
986953268 5:13117832-13117854 CATGTTCCTCAGCTCTTCAAAGG + Intergenic
988200996 5:28067986-28068008 CATTCTCCTCATATCTTTCAGGG - Intergenic
988500530 5:31780015-31780037 CTTGCTTCTCAGGGCTTCTAAGG - Intronic
989339016 5:40353935-40353957 CTGGCTTCTCAGCGCTTCCACGG + Intergenic
990533731 5:56699575-56699597 CTTGATCCGCAGCTCCTCCATGG + Intergenic
990975765 5:61560266-61560288 CTTACTCCTCAGATCTTAGAGGG - Intergenic
993591105 5:89796045-89796067 TTTGCTCTTCAGACCTTCCACGG - Intergenic
993838550 5:92846897-92846919 CTCGCTCCTTAGGTCTTCCAGGG + Intergenic
994761632 5:103861650-103861672 CTTAATCATCAGATCTTCCTGGG - Intergenic
994829039 5:104754179-104754201 CTTGCTTCTCTGATGTTCCCTGG + Intergenic
995107642 5:108393187-108393209 CTTGCTCCTCAGCTCATAGATGG - Intergenic
996640299 5:125743738-125743760 CTTGCTGCCCAGATCTCTCATGG + Intergenic
996903502 5:128571724-128571746 CTTGCTCCACAGATCCTGCTAGG + Intronic
997604444 5:135163939-135163961 ATTGCTCCTCAAATGTGCCAGGG - Intronic
999384761 5:151146195-151146217 CTGGCCTCTCTGATCTTCCAGGG + Intronic
1000141792 5:158411976-158411998 CTTGCTCAGGAGAGCTTCCAAGG - Intergenic
1001911656 5:175523877-175523899 CTGGCTCCTCAGTTTTTCCTTGG + Intronic
1002107211 5:176885811-176885833 CCTGCTTCTCACATCTTACAAGG + Intronic
1003350821 6:5316480-5316502 CTGTCACCTCAGTTCTTCCATGG - Intronic
1006716022 6:36121193-36121215 CTTGCTAATCGGATCCTCCAAGG - Intergenic
1007251620 6:40499205-40499227 CTTGCACCTCAACTATTCCATGG - Intronic
1008382938 6:50854458-50854480 TTTGCTCCTGAGTTCTTCAATGG - Intergenic
1012284259 6:97369380-97369402 CTTGCTCCTCTGAACTTTCCAGG + Intergenic
1012297341 6:97541415-97541437 TTTTCTGCTCAGATCTTACAAGG + Intergenic
1013297308 6:108769098-108769120 CTTCCTCGTCAGGTCCTCCAAGG - Intergenic
1013780654 6:113725342-113725364 CCTGCTTCCCAGATCTTCCTGGG + Intergenic
1015489401 6:133808572-133808594 CTTGGCCCTCAGGTCTGCCAGGG + Intergenic
1015658577 6:135547153-135547175 TTCACTCCTCAGTTCTTCCAAGG + Intergenic
1016297526 6:142589697-142589719 ATTGCTCCTCATATATGCCAAGG - Intergenic
1018198193 6:161373146-161373168 TTTGCTCGTCAGGCCTTCCATGG + Intronic
1018501301 6:164413479-164413501 CTTTCTCCTCATCCCTTCCATGG + Intergenic
1019049985 6:169175225-169175247 CTTGCTCGTCAGACCCACCAAGG + Intergenic
1019550066 7:1597754-1597776 GATGATCCTCAGAGCTTCCAGGG + Intergenic
1019900297 7:4015265-4015287 CTGGTTCCTCAGCTCTTCCCTGG + Intronic
1021313833 7:19121096-19121118 CTTTCTCCTCAGACCTTAGATGG + Intergenic
1023989854 7:45122234-45122256 CTGCCTCCTCAGAGCTTGCAAGG - Intergenic
1026728104 7:72887391-72887413 CTTTCTCCTCACATCTGCCTCGG + Intronic
1027115732 7:75478395-75478417 CTTTCTCCTCACATCTGCCTCGG - Intronic
1029721808 7:102372250-102372272 CTTTCTCCTCACATCTGCCTCGG + Intronic
1029790293 7:102836251-102836273 TTTGTGCCTCAGATTTTCCATGG - Intronic
1030041459 7:105454160-105454182 CTTCTCCCTCAGATTTTCCAAGG + Intronic
1031972936 7:128076991-128077013 CTTGGTCCTCAGGTCTGCCCAGG - Intronic
1032924542 7:136588619-136588641 TTTCCTCCACAGATATTCCATGG + Intergenic
1034035326 7:147814124-147814146 CAGTCCCCTCAGATCTTCCAAGG + Intronic
1034300036 7:150007261-150007283 CTTGCTCATCACATCTTCACAGG + Intergenic
1034806008 7:154090049-154090071 CTTGCTCATCACATCTTCACAGG - Intronic
1037962121 8:23105473-23105495 CTGGCTCCTCTGTTCCTCCATGG - Intronic
1037977021 8:23221019-23221041 CTGGCTCCTCTGTTCCTCCACGG + Intronic
1039583607 8:38686665-38686687 CTTGTTTCTCAGATGTTCAATGG + Intergenic
1048651614 8:136484606-136484628 CTTGCACCTCAGATCTGGCATGG + Intergenic
1048862494 8:138734158-138734180 TTTGCTCCTCACAGTTTCCATGG - Intronic
1052337162 9:27331637-27331659 CCTGCTCCTCAGACCATCCTTGG - Intronic
1052849138 9:33365739-33365761 CTAGCCCCTCAGATCTTTGAAGG + Intronic
1053200054 9:36146194-36146216 CTTGCCCTTCTGCTCTTCCATGG - Intronic
1057112071 9:92482494-92482516 CTTGCTCCTCAGTACTAACATGG - Exonic
1057447464 9:95127443-95127465 GTTGCTCCTCAGATCATCAGAGG + Intronic
1060385332 9:123221280-123221302 CTTGCCACTCACATCCTCCACGG + Intronic
1061486437 9:130922810-130922832 CCTGCTCCTCAGATGTTCCCTGG + Intronic
1061589512 9:131589510-131589532 CTCGCTCCTCAGTGTTTCCATGG - Intronic
1062166954 9:135112700-135112722 CTTGCTGCTGAGCTCTCCCAGGG - Intronic
1185632894 X:1528520-1528542 CTTGCTCCTCCGGGCTTCCCTGG - Intronic
1186711196 X:12199101-12199123 CTTGCTTCTCAGATATTTGACGG - Intronic
1187818319 X:23257255-23257277 CTTTATCATCAGATTTTCCAAGG + Intergenic
1190312906 X:49129779-49129801 CTTGCTCCTGAGATGTATCATGG + Intergenic
1193758634 X:85439255-85439277 CATGATCTTCAGATGTTCCAAGG - Intergenic
1194901374 X:99515618-99515640 CATACTCGTCAGATTTTCCAAGG + Intergenic
1196788370 X:119441682-119441704 CCTGCTTCCCAGATCTTCCTGGG + Intronic
1197698391 X:129575809-129575831 CTTACTCCTCATATCCTCTATGG + Intronic
1200808051 Y:7452705-7452727 CTTGCTGCTGCGCTCTTCCAAGG - Intergenic