ID: 959930578

View in Genome Browser
Species Human (GRCh38)
Location 3:111977805-111977827
Sequence AGGTATTTAGAGCTGGAGTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 308}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959930575_959930578 -5 Left 959930575 3:111977787-111977809 CCCAGGAATTAGTTTGAAAGGTA 0: 1
1: 1
2: 2
3: 22
4: 261
Right 959930578 3:111977805-111977827 AGGTATTTAGAGCTGGAGTCCGG 0: 1
1: 0
2: 1
3: 20
4: 308
959930570_959930578 16 Left 959930570 3:111977766-111977788 CCATGGTTGATGCTTGAGGCCCC 0: 1
1: 0
2: 0
3: 8
4: 109
Right 959930578 3:111977805-111977827 AGGTATTTAGAGCTGGAGTCCGG 0: 1
1: 0
2: 1
3: 20
4: 308
959930576_959930578 -6 Left 959930576 3:111977788-111977810 CCAGGAATTAGTTTGAAAGGTAT 0: 1
1: 0
2: 0
3: 10
4: 146
Right 959930578 3:111977805-111977827 AGGTATTTAGAGCTGGAGTCCGG 0: 1
1: 0
2: 1
3: 20
4: 308
959930574_959930578 -4 Left 959930574 3:111977786-111977808 CCCCAGGAATTAGTTTGAAAGGT 0: 1
1: 0
2: 1
3: 15
4: 197
Right 959930578 3:111977805-111977827 AGGTATTTAGAGCTGGAGTCCGG 0: 1
1: 0
2: 1
3: 20
4: 308
959930572_959930578 -3 Left 959930572 3:111977785-111977807 CCCCCAGGAATTAGTTTGAAAGG 0: 1
1: 0
2: 1
3: 12
4: 169
Right 959930578 3:111977805-111977827 AGGTATTTAGAGCTGGAGTCCGG 0: 1
1: 0
2: 1
3: 20
4: 308

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959930578 Original CRISPR AGGTATTTAGAGCTGGAGTC CGG Intergenic
901634665 1:10664971-10664993 CGGTATTTAGAGCAGGAGTGAGG + Intronic
901719164 1:11181511-11181533 ATTTATTTTGAGATGGAGTCTGG - Intronic
902776310 1:18676943-18676965 AGGGGTTTAGAGGTGAAGTCAGG + Intronic
903870519 1:26431106-26431128 ATTTATTTAGAGACGGAGTCTGG - Intergenic
903955864 1:27025156-27025178 ATTTATTTTGAGATGGAGTCTGG + Intergenic
904779485 1:32934667-32934689 ATGTATTTAGAGACGGAGTCTGG - Intergenic
905706884 1:40067290-40067312 TAGTTTTTAGAGCTGGAATCAGG + Intronic
906223763 1:44104136-44104158 AACAAGTTAGAGCTGGAGTCTGG - Intergenic
907012495 1:50977376-50977398 CGGGAGTTGGAGCTGGAGTCTGG - Intergenic
907288701 1:53398643-53398665 AGGGATCTTGAGCTGGACTCGGG + Intergenic
907346549 1:53786227-53786249 AGGCATTTAGAGATGGCATCTGG - Intronic
908410907 1:63864189-63864211 AGCTATTAAGAGATGGAGGCAGG + Intronic
909342300 1:74545655-74545677 AGGAATTTAGAGCCTGACTCTGG + Intergenic
910533453 1:88268219-88268241 AGGGATTAAGGTCTGGAGTCAGG + Intergenic
911376808 1:97061531-97061553 AGGCATTCAGAGTTGGAGGCTGG - Intergenic
913440165 1:118888616-118888638 ATCTCTTTACAGCTGGAGTCAGG - Intronic
915061348 1:153188412-153188434 AGGAATTTAGAGAGGCAGTCTGG + Intergenic
915649103 1:157294659-157294681 AGGAATTTAGAGAGGTAGTCTGG - Intergenic
915820490 1:159018104-159018126 AGATGTTTAGAGCTGGAGTCAGG - Intronic
917223222 1:172754069-172754091 AGGTCTTTAGAGCTAGTGTCTGG + Intergenic
917667039 1:177235263-177235285 AAGTATTTGGAGATGGAGACGGG + Intronic
919885269 1:201929112-201929134 ATTTATTTAGAGACGGAGTCTGG + Intronic
920704574 1:208242304-208242326 AGGCTTTGAGAGCAGGAGTCAGG - Intronic
922406195 1:225316058-225316080 AGGTATCTAGAGAGAGAGTCTGG + Intronic
923066940 1:230526973-230526995 AGGAATCTAGAGAGGGAGTCTGG + Intergenic
924141200 1:241025512-241025534 AAGTAGTTAGAGCTTGAATCTGG - Intronic
924249599 1:242118162-242118184 AGGTTCTAAGTGCTGGAGTCTGG - Intronic
1062765794 10:64120-64142 AGGCATGTGGAGCTGGAGTTGGG + Intergenic
1062777380 10:164075-164097 AGGGATTTTAAGCTGGAGTAGGG - Intronic
1064005887 10:11698671-11698693 TGTTATGTAGAGATGGAGTCTGG + Intergenic
1064584597 10:16827611-16827633 TGTTATTTTGAGATGGAGTCTGG + Intronic
1069195542 10:65546294-65546316 AGTTATTAAGAGCTGGACTGGGG - Intergenic
1069340639 10:67404176-67404198 AGGGATTTAGAACTGGACTGAGG + Intronic
1069744925 10:70709007-70709029 AGGTATGTACAGCTGGGATCAGG - Intronic
1070608072 10:77913598-77913620 ACTTTTTTAGAGCTGGGGTCTGG + Intronic
1071508115 10:86245151-86245173 AGGTATTGGGAGCTGGACACAGG - Intronic
1071534053 10:86412943-86412965 ATTTATTTAGAGACGGAGTCTGG - Intergenic
1072133712 10:92522698-92522720 AGCTTTTAAGTGCTGGAGTCAGG - Intronic
1072690452 10:97569490-97569512 AGGTGTACAGGGCTGGAGTCAGG - Intronic
1074175985 10:111003606-111003628 AGCTATTTAAAGATAGAGTCAGG + Intronic
1074866315 10:117546171-117546193 GGGTGTTTGGAGCTGGAGGCTGG + Intronic
1076128215 10:127992678-127992700 AGGTTTCTAGAGCAGGTGTCTGG - Intronic
1077459844 11:2703565-2703587 AGGTATTTAGAGTGGGGGTGGGG + Intronic
1078211113 11:9270314-9270336 GGGTATATAAAGCTAGAGTCCGG - Intergenic
1078564284 11:12400925-12400947 AGGCAGTTGGGGCTGGAGTCTGG + Intronic
1081337799 11:41888494-41888516 AAGTATGTAAAGCTGCAGTCAGG + Intergenic
1081354740 11:42098618-42098640 AGGTGTTGAGAACTGAAGTCTGG - Intergenic
1081824185 11:46031456-46031478 AGGTAATGGGAGCTGGAGCCTGG + Intronic
1083059723 11:59857268-59857290 AGAAATTTAGAGGTGGAGCCTGG - Intronic
1083093750 11:60227537-60227559 ATATATTTTGAGATGGAGTCTGG - Intronic
1083645384 11:64169394-64169416 ATTTATTTAGAGACGGAGTCTGG + Intergenic
1084080444 11:66820211-66820233 AGGATTCTGGAGCTGGAGTCAGG - Intronic
1085843471 11:80040055-80040077 AGGTATAGGGAGCTGGACTCAGG + Intergenic
1086349628 11:85932607-85932629 GTTTATTTAGAGATGGAGTCTGG + Intergenic
1087203092 11:95365745-95365767 AGGCATGTAGAACTGGAGACAGG - Intergenic
1087427797 11:98012820-98012842 AGGAATCTAGAGAGGGAGTCTGG - Intergenic
1087659065 11:100964492-100964514 AGTTATTTAGACATGGAGTGAGG - Intronic
1087695274 11:101369513-101369535 AGGAATTTAGAGAGGCAGTCTGG + Intergenic
1087729398 11:101761041-101761063 TGGTATCTAGAGGTGGAGTCTGG - Intronic
1088542634 11:110929046-110929068 AGATATATTGAGATGGAGTCTGG - Intergenic
1088572000 11:111231408-111231430 AGGTTTCTAGAGGTGGAGTGAGG - Intergenic
1089398683 11:118152333-118152355 AGGTATTTGGAGCTGGATCTTGG - Intronic
1089730987 11:120518633-120518655 AAATATTTTGAGATGGAGTCTGG + Intronic
1090307794 11:125705384-125705406 AGGAATTTAGAGAAGCAGTCTGG - Intergenic
1090594110 11:128302512-128302534 AGGTGTTTAGAGTTTGAGACTGG + Intergenic
1090913910 11:131145726-131145748 AGCTAATTAGTGATGGAGTCAGG + Intergenic
1091240979 11:134052187-134052209 ATTTATTTAGAGATGGAGTCTGG - Intergenic
1091566797 12:1654806-1654828 GGGAATTTAGAGCTGGTGCCTGG + Intergenic
1092024778 12:5231505-5231527 AGGTCAGTAGAGGTGGAGTCAGG - Intergenic
1092217894 12:6695359-6695381 AGGTCTTCAGAGCTGGGGTGGGG - Intronic
1092830661 12:12441354-12441376 AGGTAGTCAGAGATGGAGCCAGG - Intronic
1093934249 12:24984033-24984055 AGGTATTGAAAACTGGAGTAAGG - Intergenic
1094815978 12:34185480-34185502 AGGCATGTGGAGCTGGAGTTGGG + Intergenic
1095230479 12:39733610-39733632 AGGAATTTAGAGAGGCAGTCTGG + Intronic
1097639071 12:62157558-62157580 AGGTAGATAGAGGTGGAGCCAGG - Intronic
1097919616 12:65057368-65057390 AGAATTTTAGAGCTGGAGTAAGG + Intronic
1098179739 12:67833112-67833134 AGGTCTTTAGGGTGGGAGTCAGG + Intergenic
1101785470 12:107879276-107879298 AGTTATTTAAAACTTGAGTCTGG + Intergenic
1101832204 12:108267528-108267550 AGTGGTTAAGAGCTGGAGTCTGG - Intergenic
1103869100 12:124078354-124078376 AGGCATTTATAGCGGGAGTGAGG + Intronic
1104365806 12:128175726-128175748 TGGTAGTTAGAGCTGGTGCCAGG - Intergenic
1105500260 13:20965672-20965694 ATTTATTTTGAGATGGAGTCTGG + Intergenic
1106413920 13:29530128-29530150 AGGTATTTAAAGGTGAAGTGAGG + Intronic
1106581746 13:31024806-31024828 GGCTGTTTAGTGCTGGAGTCTGG + Intergenic
1106613794 13:31308432-31308454 TGGCATTTATAGGTGGAGTCTGG + Intronic
1107146673 13:37067783-37067805 AGGTTTTAAGAGCTGGAGTAGGG - Intergenic
1111047655 13:82835670-82835692 ATTTTTTTAGAGATGGAGTCTGG - Intergenic
1111056101 13:82953034-82953056 AGGAATCTAGAGAAGGAGTCTGG - Intergenic
1111114235 13:83754862-83754884 AGGAATCTAGAGATGTAGTCTGG - Intergenic
1111128995 13:83949956-83949978 TGGTATCTGGAGCTGGAGTTGGG + Intergenic
1111466353 13:88616553-88616575 AGGTATTTGGATCTAGAGCCTGG - Intergenic
1111573765 13:90122436-90122458 AGTTATTTATAGCAGGATTCAGG - Intergenic
1111829440 13:93308451-93308473 ATTTATTTAGAGATTGAGTCTGG + Intronic
1112372917 13:98810714-98810736 AGGGATTTAGTGATGGAGTGTGG + Intronic
1113142196 13:107166456-107166478 ATTTATTTAGAACTGCAGTCAGG - Exonic
1115213246 14:30989470-30989492 ATTTATTTTGAGATGGAGTCTGG + Intronic
1116887277 14:50233124-50233146 AGTAGTTTATAGCTGGAGTCTGG - Intergenic
1118300493 14:64611273-64611295 TGGTATTGAGAGGTGGAGGCAGG - Intergenic
1118926987 14:70200000-70200022 AGGTATCTAGAGAAGCAGTCTGG + Intergenic
1120211019 14:81633964-81633986 ATTTATTTTGAGATGGAGTCTGG + Intergenic
1122454666 14:101841170-101841192 AGGTAGTCAGAGGTGGAGTTGGG + Intronic
1122682488 14:103476456-103476478 AGGGATTAAGAGCTGGATTCAGG - Intronic
1125087497 15:35747631-35747653 AGGGAGCTAGAGCTGTAGTCCGG + Intergenic
1125152590 15:36549954-36549976 AGAGATTCAGAGCTGGAGTTCGG - Intergenic
1125955851 15:43790773-43790795 ATTTATTTTGAGATGGAGTCTGG + Intronic
1126002108 15:44220452-44220474 AGATAGTTAGAGGTGGAGCCAGG - Intergenic
1126784400 15:52164614-52164636 ATTTATTTTGAGATGGAGTCTGG - Intronic
1127878030 15:63128753-63128775 ATTTATTTTGAGATGGAGTCTGG + Intronic
1128052576 15:64676763-64676785 ATTTATTTTGAGATGGAGTCTGG + Intronic
1128823049 15:70679389-70679411 ATTTATTTAGAGATGGGGTCTGG - Intronic
1130728650 15:86467179-86467201 AGGAATCTAGAGATGCAGTCTGG + Intronic
1135160883 16:20095196-20095218 AGGTAGTAAGAGATGGAGCCAGG - Intergenic
1135234782 16:20745088-20745110 AGTTATTTAGAGCTGGACGAGGG - Intronic
1138435749 16:56999192-56999214 GGGTATTAGGAGCTGGGGTCTGG - Intronic
1138878871 16:60986362-60986384 ATTTATTTAGAAATGGAGTCTGG - Intergenic
1140165264 16:72543937-72543959 AGGAATCTAGAGATGCAGTCTGG - Intergenic
1141652690 16:85402014-85402036 AGGTTTTCAGAACTGGAGCCCGG + Intergenic
1141827339 16:86489857-86489879 AGTTATTTCCAGCTGGAGACTGG - Intergenic
1142578408 17:924900-924922 AGGTACACAGAGCTGGAGACAGG + Intronic
1143754865 17:9059320-9059342 AGGTATTTAGAACTGAAAACAGG + Intronic
1143830461 17:9646334-9646356 AGGTATTTTGAGAGGGAGTGGGG + Intronic
1146257779 17:31401518-31401540 AGGTCCTTACAGCTGGAATCTGG - Intronic
1146552161 17:33790602-33790624 AAGTCTGTAGGGCTGGAGTCAGG - Intronic
1147039806 17:37709863-37709885 AGCTATTAAGAGCTGGAGCTGGG + Intronic
1147525286 17:41216601-41216623 AGGAATATAGAGCGGCAGTCTGG - Intronic
1149380362 17:56087465-56087487 AGGTATCTAGAGCAGAAGGCAGG - Intergenic
1150152141 17:62818769-62818791 AGGTTGTGAGAGTTGGAGTCAGG + Intergenic
1150616733 17:66778097-66778119 AACTATTGAGAGCTGGAGCCTGG - Intronic
1155080551 18:22406262-22406284 AGGAATCTAGAGAGGGAGTCTGG - Intergenic
1155114249 18:22749064-22749086 AGGAATCTAGAGAGGGAGTCTGG - Intergenic
1157161772 18:45320031-45320053 AGGAATTTAATGGTGGAGTCTGG - Intronic
1157178850 18:45477690-45477712 AGGAATTTAGAGAAGCAGTCTGG + Intronic
1158858842 18:61572040-61572062 ATTTATTTTGAGATGGAGTCAGG - Intergenic
1159385949 18:67725741-67725763 AGGTATCTAGAGAGGCAGTCTGG + Intergenic
1159755870 18:72363818-72363840 AGGCGTTTACAGCTGGAGACTGG - Intergenic
1160197381 18:76767225-76767247 AGATATTTAGGGGTGGAGGCCGG - Intergenic
1160736430 19:664651-664673 TGTTTTTTAGAGATGGAGTCTGG + Intergenic
1160822642 19:1065728-1065750 AGGCATTTACAGCTGGGATCCGG - Intergenic
1162045443 19:7996799-7996821 TGGTTTTTGGAGATGGAGTCTGG - Intronic
1165498957 19:36172176-36172198 ATTTATTTTGAGATGGAGTCTGG - Intergenic
1166287388 19:41839753-41839775 AAGTATTTAGAACTGAGGTCAGG + Intronic
1166666034 19:44680975-44680997 GAGTGTTTAGGGCTGGAGTCGGG - Intronic
1167404044 19:49292447-49292469 AGGTATTTATGGCTGCTGTCTGG - Intronic
1167668988 19:50838971-50838993 AGGGAGGTAGGGCTGGAGTCTGG + Intergenic
1168157036 19:54480078-54480100 ATTTATTTTGAGATGGAGTCTGG - Intergenic
926130765 2:10302356-10302378 AGGTAACCAGAGCTGGAGCCAGG + Intergenic
926313865 2:11695514-11695536 AGGCATCTAGAGATGCAGTCAGG + Intronic
926349899 2:11984929-11984951 AGGTATCTGCAGCTGGAGTCTGG + Intergenic
926540229 2:14167950-14167972 AGGTATTTTCAGCAGGAATCAGG - Intergenic
926653262 2:15370181-15370203 AGCTAGTTAGAGGTGGAGCCAGG - Intronic
927168965 2:20352140-20352162 AGTTATTTATATTTGGAGTCGGG - Intronic
928545864 2:32328728-32328750 ATTTATTTTGAGATGGAGTCTGG + Intergenic
928743688 2:34386755-34386777 GGGTATTTAATGCTGAAGTCTGG + Intergenic
928750672 2:34466945-34466967 AGGAATTTAGAGAGGCAGTCTGG - Intergenic
930180066 2:48346622-48346644 AGAAATTTATAGCTGGATTCTGG + Exonic
930793558 2:55361072-55361094 AAGTTTTTTGAGATGGAGTCTGG - Intronic
931219150 2:60273568-60273590 AGGTTCTTTGAGCTGGAGACTGG - Intergenic
931814857 2:65890386-65890408 AGGAATTTAGAGAGGCAGTCTGG - Intergenic
931858105 2:66325121-66325143 ATATATTTACTGCTGGAGTCTGG - Intergenic
933255314 2:80073979-80074001 GGGTATGTAGTGATGGAGTCTGG + Intronic
933663336 2:84945207-84945229 AGGTATTTGGAGGTGGAATCAGG - Intergenic
934167140 2:89304425-89304447 AGGCAGTTAGTGCTGGATTCTGG - Intergenic
934200138 2:89878019-89878041 AGGCAGTTAGTGCTGGATTCTGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937659465 2:124413955-124413977 AAGTATTGAGAGATGGAGTGAGG + Intronic
937659666 2:124416194-124416216 AAGTATTGAGAGTTGGAGTGAGG + Intronic
938952293 2:136266459-136266481 AGGAATCTAGAGATGCAGTCTGG + Intergenic
938976501 2:136483289-136483311 AGTTTGGTAGAGCTGGAGTCAGG + Intergenic
939640824 2:144638378-144638400 AGGAATTTAGAGAGGCAGTCTGG + Intergenic
940370578 2:152896310-152896332 AGGAATCTAGAGATGCAGTCTGG - Intergenic
943105731 2:183543982-183544004 AGGAATTTAGAGAGGCAGTCTGG - Intergenic
943512332 2:188841053-188841075 AGGAATTTAGAGAGGCAGTCTGG - Intergenic
943836844 2:192524907-192524929 AGGAATCTAGAGAGGGAGTCTGG - Intergenic
944050881 2:195468151-195468173 AAGTATTTGTAGCTGGAGTCAGG + Intergenic
944668832 2:201978656-201978678 AGGTAGTAAGAGGTGGAGGCAGG - Intergenic
945031699 2:205670805-205670827 AGGTAGGAAGAGCTGGAGTTTGG + Intergenic
946216606 2:218188603-218188625 AGGTAGTTTCAGCAGGAGTCTGG - Intergenic
947650858 2:231785307-231785329 AGGGGTACAGAGCTGGAGTCAGG - Intronic
1168768455 20:398058-398080 AGCTATTGAGTGCTGGAGCCAGG - Intergenic
1169712713 20:8582471-8582493 ACGTAGTTACAGCTGGAGACTGG - Intronic
1170326253 20:15157380-15157402 TGGTATTTAGAGGTGAAGCCTGG - Intronic
1170454622 20:16520462-16520484 AGGAATTTAGAGAGGCAGTCTGG - Intronic
1172697216 20:36831171-36831193 ATGTACATAGAGATGGAGTCTGG - Intronic
1173000511 20:39102148-39102170 AGGCATGTGAAGCTGGAGTCTGG - Intergenic
1174101064 20:48126499-48126521 AGGGTTTTAGAGCTGGAGCCTGG - Intergenic
1174853750 20:54022810-54022832 AGCTATTTAGTGGTAGAGTCTGG + Intronic
1178875166 21:36408557-36408579 AGGTAGGTAGAACTGGAGTAAGG + Intronic
1179834705 21:44022830-44022852 TGGTAGTTGGAGCTGGAGGCTGG + Intronic
1179932718 21:44580750-44580772 TGGTGTTTAGAGCTGGTGGCTGG + Intronic
1182890435 22:33813801-33813823 AGGTATTTAAGGCTGAAGTTGGG - Intronic
1182975950 22:34624277-34624299 ATTTATTTTGAGATGGAGTCTGG - Intergenic
1184224331 22:43120589-43120611 AGGCATTCAGAGCTGGTGCCAGG + Intronic
949120807 3:381574-381596 AGGTATCTTGAACTGGAGTTGGG + Intronic
950850861 3:16060998-16061020 AGGTAGTGATTGCTGGAGTCAGG + Intergenic
951079587 3:18436938-18436960 AGGGATTTAAAGCTGGACTTAGG - Intronic
951237689 3:20254395-20254417 AGGAATTTAGAGAGGCAGTCTGG + Intergenic
952704575 3:36364523-36364545 TGGCATTTATAGGTGGAGTCAGG - Intergenic
952754546 3:36855065-36855087 AGGTTTTTACAGCTGAAGTAAGG - Intronic
953179521 3:40582940-40582962 AAGTATTTAGACCTGTAGACAGG + Intergenic
956903346 3:73740075-73740097 ATGAATTAGGAGCTGGAGTCAGG + Intergenic
956986586 3:74708614-74708636 ATTTATTTTGAGATGGAGTCTGG + Intergenic
957011208 3:75008275-75008297 AGGAATTTAGAGAGGCAGTCTGG + Intergenic
957404094 3:79754831-79754853 AGGTAATTAGAGCTTGGGTAGGG - Intronic
958543294 3:95508718-95508740 ATTTATTTTGAGATGGAGTCTGG - Intergenic
959881176 3:111446813-111446835 AGGAATCTAGAGCAGCAGTCTGG + Intronic
959930578 3:111977805-111977827 AGGTATTTAGAGCTGGAGTCCGG + Intergenic
961967336 3:130919113-130919135 AGGCATTTTGAGTTGGAGGCAGG + Intronic
964118681 3:153161385-153161407 AGGTAATTTGAGCTAGAGTGTGG + Intergenic
965272338 3:166634635-166634657 TGGTAGATAGAGCTGGTGTCTGG - Intergenic
965487301 3:169293565-169293587 TGGTACTTAGAGCAGGGGTCAGG - Intronic
965989224 3:174796004-174796026 AATTATTTAGAGATGGAGACAGG + Intronic
966160241 3:176959954-176959976 AGGCATTTAGGGCTGGCGTGGGG - Intergenic
966493748 3:180556725-180556747 AGGAATTTAGAGAGGCAGTCTGG - Intergenic
966692839 3:182759263-182759285 TTTTTTTTAGAGCTGGAGTCTGG + Intergenic
966810406 3:183838729-183838751 AGGTATTTGGAGTTAGAGTGGGG - Intronic
967088344 3:186113910-186113932 AGCTAGTAAGAGTTGGAGTCAGG + Intronic
968090641 3:195896266-195896288 AGGTATTTAGGGCTGAGCTCAGG + Intronic
969897059 4:10315314-10315336 AAGTGTCTAGAGATGGAGTCAGG + Intergenic
970274485 4:14383376-14383398 AGGTTTGTAAAGCAGGAGTCGGG - Intergenic
970316237 4:14831037-14831059 AGGTAATTAGTGGTGTAGTCAGG - Intergenic
971699420 4:29950228-29950250 ATTTATTTTGAGATGGAGTCTGG - Intergenic
972281160 4:37603318-37603340 AGGTGTTTAGAGCTACAGTGAGG + Intronic
972910273 4:43807579-43807601 ATGTTTTTAGAGGTAGAGTCAGG - Intergenic
974391184 4:61271116-61271138 AGGTCTTCAGAGTTGAAGTCAGG + Intronic
974434277 4:61837106-61837128 AGCTATTAAGTGCTAGAGTCAGG + Intronic
974560108 4:63506371-63506393 AGGAATTTAGAGAAGCAGTCTGG - Intergenic
974813977 4:66982175-66982197 AGGAATCTAGAGGGGGAGTCTGG - Intergenic
974946604 4:68536109-68536131 AGGAATTTAGAGGCGTAGTCTGG + Intergenic
979206707 4:118046650-118046672 AGGTACTTGGAGTTGGATTCTGG - Intronic
980102502 4:128555407-128555429 AGGTATTAAGTGCTGGAGCTGGG - Intergenic
981600883 4:146487243-146487265 AAGTCTCTAGAGCTTGAGTCAGG - Intronic
981653430 4:147085034-147085056 AGGTATTTAGATCTAGTGCCTGG + Intergenic
981662538 4:147184316-147184338 AGGAATTTAGAGATGCAATCTGG - Intergenic
982854561 4:160364396-160364418 AGATTTTAAGAGCTGGAGTTGGG - Intergenic
983169572 4:164520752-164520774 AGGAATCTAGAGAAGGAGTCTGG + Intergenic
983983425 4:174027338-174027360 AGATATTTAGTTCTGGAGGCTGG - Intergenic
984682566 4:182626583-182626605 AGCTATTTATAGGTGAAGTCTGG + Intronic
986244915 5:5998443-5998465 AGCTGTGTAGAGCTGGAGGCAGG - Intergenic
990029426 5:51239296-51239318 ATTTATTTTGAGATGGAGTCTGG + Intergenic
991773931 5:70065766-70065788 GGGTCTTTAGAGCTGATGTCAGG + Intronic
991853225 5:70941190-70941212 GGGTCTTTAGAGCTGATGTCAGG + Intronic
993541654 5:89159613-89159635 AGGAATCTAGAGATGCAGTCTGG - Intergenic
993911576 5:93690487-93690509 AGGAATTTAGAGAGGCAGTCTGG - Intronic
994005145 5:94828661-94828683 AGGAATCTAGAGCGGCAGTCTGG + Intronic
994148636 5:96422720-96422742 AGGTCTTTAGATCAGGAGGCTGG - Intronic
994176533 5:96717995-96718017 AGGTGATTAGACCTGGAGTAGGG + Intronic
996199052 5:120647879-120647901 AGGTATTGAGATCTTGAGTTAGG + Intronic
997416317 5:133731588-133731610 AGGTATTTAGAGCTTGGCTTGGG + Intergenic
997463954 5:134074291-134074313 ATTTATTTTGAGATGGAGTCTGG - Intergenic
998003989 5:138645164-138645186 AGGTTTCTGGAGCTGTAGTCAGG - Intronic
998471801 5:142389519-142389541 AGGTCTTTAGGGCTGAAATCTGG + Intergenic
1000546112 5:162604822-162604844 ATGTATGTAGAGCTGGAGGCTGG + Intergenic
1000772242 5:165369170-165369192 ATGTACTTAAAGCTGGAGTCTGG + Intergenic
1001131500 5:169067807-169067829 AGCTATTTTGAGTTGGAGGCTGG - Intronic
1006511050 6:34521367-34521389 AGGAATTAAGAGCAGGAGCCTGG - Intronic
1007738344 6:43995671-43995693 GGGCATTTATAGCTAGAGTCTGG - Intergenic
1008376025 6:50793251-50793273 AGTTATTGAGTGGTGGAGTCAGG + Intergenic
1008852681 6:56042883-56042905 GAGTATTTAGATCAGGAGTCAGG - Intergenic
1009492741 6:64312313-64312335 AGGAATCTAGAGATGCAGTCTGG - Intronic
1011686247 6:89826264-89826286 ATTTTTTTTGAGCTGGAGTCTGG - Intergenic
1011691338 6:89872228-89872250 ATGTTTTAAGAGATGGAGTCAGG + Intronic
1013208430 6:107965443-107965465 AGGAATGTGTAGCTGGAGTCAGG + Intergenic
1013901883 6:115166355-115166377 AGGAATCTAGAGATGCAGTCTGG + Intergenic
1015309798 6:131754403-131754425 GGGTATTTAGAGCCATAGTCAGG + Intergenic
1016249538 6:142023327-142023349 AGATATTTTGAGCTGGGCTCTGG - Intergenic
1018169723 6:161135263-161135285 AGGTATTTGGAGCATGAGTTAGG - Exonic
1022033958 7:26516756-26516778 AGGTAACAAGAGCAGGAGTCGGG - Intergenic
1025224898 7:57149676-57149698 AGGCATTCACAGCTGGAGTGTGG - Intergenic
1025992769 7:66508107-66508129 ATTTATTTTGAGATGGAGTCTGG + Intergenic
1026475313 7:70729892-70729914 ATGTATTTAGAGACGGACTCTGG + Intronic
1028318701 7:89435355-89435377 AGTTTTTAAGAGCTGGAGTAGGG - Intergenic
1028429930 7:90735519-90735541 AGGAATCTAGAGAAGGAGTCTGG + Intronic
1028575369 7:92343652-92343674 ATGTATTTTGAGATGGGGTCTGG - Intronic
1029270959 7:99376195-99376217 ATTTATTTAGAGACGGAGTCTGG - Intronic
1029687512 7:102158882-102158904 GGGTGTTTAGAGATGGAGTAGGG - Intronic
1030855661 7:114553172-114553194 ACGAATATAGAGCTGGAGTTAGG + Intronic
1031097991 7:117443767-117443789 AGGTATGGAGAGCAGGAGCCAGG + Intergenic
1031349079 7:120706183-120706205 AGGTATATAGACTTGGAGTCAGG + Intronic
1034342465 7:150366861-150366883 ATTTATTTTGAGATGGAGTCTGG - Intergenic
1035980062 8:4360499-4360521 AGGTTCTTTGAGATGGAGTCTGG + Intronic
1037245422 8:16829509-16829531 ATTTATTTAGACATGGAGTCTGG + Intergenic
1039279136 8:35963613-35963635 TATTATTTAGAGATGGAGTCTGG + Intergenic
1040634462 8:49255951-49255973 AGATTTTTAGTGCTGGAGTGTGG - Intergenic
1041092952 8:54319874-54319896 AAATATTTAGAGTTGAAGTCAGG + Intergenic
1041459721 8:58098250-58098272 AGGAATCTAGAGATGCAGTCTGG + Intronic
1045444179 8:102242945-102242967 ATGCAGTTATAGCTGGAGTCAGG - Intergenic
1046354698 8:113066562-113066584 ATGTATTGAGAGCTGGAATCTGG - Intronic
1047133697 8:122051796-122051818 AGGAATCTAGAGAGGGAGTCTGG - Intergenic
1048084858 8:131166130-131166152 AGGTATTAAGTGGTGGAGACAGG - Intergenic
1048910427 8:139129540-139129562 GGCTATTTGGAGCTGGAGTTGGG + Intergenic
1050637431 9:7626938-7626960 AGGAATTTAGAGATGCAGTCTGG - Intergenic
1052384551 9:27808093-27808115 AGTTTTTAAGAGCTGGAGTAGGG + Intergenic
1052785929 9:32828406-32828428 AGATATTTTGAGCTGAAGGCAGG + Intergenic
1053052786 9:34975909-34975931 AGGGACTCAGTGCTGGAGTCAGG + Intronic
1053529154 9:38861095-38861117 TGTTATTTTGAGATGGAGTCTGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054201379 9:62085524-62085546 TGTTATTTTGAGATGGAGTCTGG - Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054636980 9:67502836-67502858 TGTTATTTTGAGATGGAGTCTGG + Intergenic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054774869 9:69116776-69116798 ATTTATTTAGAGATGGAGTCTGG + Intergenic
1055739389 9:79369135-79369157 ATTTATTTAGAGATGGAGTCTGG - Intergenic
1056320942 9:85433850-85433872 AGGAATTTAGAGAGGCAGTCTGG - Intergenic
1057341994 9:94211198-94211220 AGCTAGTAAGAGCTGGAGTCAGG - Intergenic
1060302576 9:122383823-122383845 GGGTACTTAGAGGTGGAGGCTGG + Intronic
1060993138 9:127860381-127860403 TGGTATTTAAAGCTGTTGTCTGG - Intergenic
1062458520 9:136652753-136652775 ATTCATTTAGAGATGGAGTCTGG - Intergenic
1062739452 9:138160151-138160173 AGGCATGTGGAGCTGGAGTTGGG - Intergenic
1185486703 X:487097-487119 ATTTATTTTGAGATGGAGTCTGG + Intergenic
1187518431 X:19992337-19992359 ATTTATTTAGAGATAGAGTCTGG + Intergenic
1188552160 X:31376302-31376324 AGGGATTGAGATCAGGAGTCTGG + Intronic
1189203963 X:39221833-39221855 AGGTATATGGAGCTGGAGCTTGG + Intergenic
1189739682 X:44105122-44105144 AGGCATTAAGAGCTGGAGCCAGG + Intergenic
1189805514 X:44731783-44731805 GGTTATTTAGGGCTGGAGTGGGG + Intergenic
1190515335 X:51218101-51218123 TGTTTTTTAGAGATGGAGTCTGG + Intergenic
1191148090 X:57190110-57190132 AGGTATCTAGAGAGGCAGTCTGG + Intergenic
1191785020 X:64908017-64908039 AGGAATTTAGAGAGGCAGTCTGG - Intergenic
1191837649 X:65481483-65481505 CTGCATTTGGAGCTGGAGTCAGG - Intronic
1192573803 X:72227005-72227027 AGGGATTTAGTGTTGGAGTAGGG - Intronic
1192873490 X:75206465-75206487 AGTTTTTAAGAGCTGGAGTAGGG + Intergenic
1192953153 X:76039324-76039346 AGGAATTTAGAGAAGCAGTCTGG + Intergenic
1192994033 X:76493087-76493109 AGGTATCTAGAGAGGCAGTCTGG - Intergenic
1193334668 X:80274159-80274181 AGGTATCTAGAGAGGCAGTCTGG - Intergenic
1194837447 X:98698818-98698840 AGGAATCTAGAGATGCAGTCTGG + Intergenic
1197142219 X:123130079-123130101 AGGAATCTAGAGATGCAGTCTGG - Intergenic
1197191114 X:123648748-123648770 AGGAATTTAGAGAGGCAGTCAGG - Intronic
1201230997 Y:11864113-11864135 AGGAATTTAGAGAGGCAGTCTGG + Intergenic
1201462288 Y:14239731-14239753 AGGAATCTAGAGATGCAGTCTGG - Intergenic