ID: 959930770

View in Genome Browser
Species Human (GRCh38)
Location 3:111979373-111979395
Sequence AGAGCTCTGCCGCGGCCCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 169}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959930763_959930770 22 Left 959930763 3:111979328-111979350 CCCCAGTTCTAGGCGCTTTGTAG 0: 1
1: 0
2: 0
3: 4
4: 74
Right 959930770 3:111979373-111979395 AGAGCTCTGCCGCGGCCCTGCGG 0: 1
1: 0
2: 1
3: 7
4: 169
959930765_959930770 20 Left 959930765 3:111979330-111979352 CCAGTTCTAGGCGCTTTGTAGAC 0: 1
1: 0
2: 0
3: 23
4: 218
Right 959930770 3:111979373-111979395 AGAGCTCTGCCGCGGCCCTGCGG 0: 1
1: 0
2: 1
3: 7
4: 169
959930764_959930770 21 Left 959930764 3:111979329-111979351 CCCAGTTCTAGGCGCTTTGTAGA 0: 1
1: 0
2: 0
3: 9
4: 86
Right 959930770 3:111979373-111979395 AGAGCTCTGCCGCGGCCCTGCGG 0: 1
1: 0
2: 1
3: 7
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959930770 Original CRISPR AGAGCTCTGCCGCGGCCCTG CGG Intronic
900362311 1:2294942-2294964 AGAGCCCTGCCACCACCCTGAGG - Intronic
900550020 1:3250033-3250055 AGCGCTGGGCCGTGGCCCTGGGG + Intronic
900564874 1:3327339-3327361 GGAGCTCTGCAGCAGCCCTCGGG + Intronic
902089680 1:13893216-13893238 AGAGCGCTGCCCAGGCCCCGCGG - Intergenic
902219789 1:14957706-14957728 ACAGCTCTGCGGAGGCCCTGAGG + Intronic
902578334 1:17392520-17392542 AGAGCTGGGCCACTGCCCTGGGG + Intronic
903550297 1:24153318-24153340 AGAGCTCTCCAGGGGCACTGAGG + Intergenic
905477508 1:38239355-38239377 GGAGCTCTGAGGCTGCCCTGAGG + Intergenic
906707592 1:47906079-47906101 CCAGCTCTGCCGCAGGCCTGAGG - Intronic
907555164 1:55337074-55337096 AGAGCTCAGCCCCGGCACTCTGG - Intergenic
907840754 1:58155086-58155108 AGAGGTCTGGGCCGGCCCTGAGG - Intronic
910899477 1:92104542-92104564 AGAGCTCTGCTGTGGCTCTATGG + Intronic
914490424 1:148147642-148147664 AGAGCTGTGCCTGGTCCCTGCGG - Intronic
917979245 1:180259227-180259249 AGAGCTGTGCTGCAGCCCAGCGG - Intronic
917979709 1:180261222-180261244 AGAGCTGTGCTGCAGCCCAGCGG - Intronic
919070691 1:192751498-192751520 GCAGCTCCGCCGCAGCCCTGGGG + Intergenic
920356999 1:205381111-205381133 ACAGCTCTGCCTGGTCCCTGAGG + Intergenic
921390107 1:214607572-214607594 AGAGCTATGCCTGGTCCCTGCGG + Intronic
922167709 1:223129524-223129546 AGGGCTCTGCCGCAGTCCCGGGG + Intronic
922842175 1:228651337-228651359 AGAGCTCAGCAGGAGCCCTGTGG + Intergenic
923281351 1:232445755-232445777 AGAGCTCTGCCGGATCCCTATGG - Exonic
923429351 1:233905412-233905434 AGAGCGCGGCCGGGGCCCTCCGG - Intronic
1063997753 10:11637182-11637204 AGAGCTGTTCCGCAGACCTGGGG + Intergenic
1064561557 10:16599399-16599421 AGAGAGCTGCAGTGGCCCTGAGG - Intronic
1067427991 10:46223802-46223824 AGGGCTGTGCCCAGGCCCTGTGG + Intergenic
1069682733 10:70296754-70296776 AGGGCTCTGCCGAGGCCTTCTGG + Intergenic
1069778701 10:70941661-70941683 AGAGCTCTCCTGATGCCCTGAGG - Intergenic
1069999843 10:72368122-72368144 AGGGCTCTGCCGAGACTCTGCGG + Exonic
1070752596 10:78972952-78972974 GGAGGTCTGCTGGGGCCCTGGGG + Intergenic
1071086846 10:81875290-81875312 ATGCCTCTGCCGCGGCCCTCGGG + Intergenic
1074123500 10:110510384-110510406 AGAGCTCAGCAGAAGCCCTGTGG + Exonic
1076234871 10:128855903-128855925 AGACCTCTGCCACTGCCCTCCGG - Intergenic
1076806045 10:132859284-132859306 CAAGCCCTGACGCGGCCCTGGGG - Intronic
1077201376 11:1309225-1309247 AAAGCTCTGCCCCGGCACGGCGG + Intronic
1078546887 11:12253276-12253298 GCAGCTCTGCCTGGGCCCTGGGG - Intronic
1078652822 11:13211862-13211884 AGTGCTCTGCAAAGGCCCTGTGG + Intergenic
1081734310 11:45392528-45392550 AGGGCTCAGCCGCAGCCCAGAGG - Intergenic
1084476981 11:69394648-69394670 AGGGCTCTGCCTGGGTCCTGTGG + Intergenic
1084575549 11:69986012-69986034 GGAGGTCTGCGGCGGCTCTGGGG - Intergenic
1084861092 11:72018704-72018726 AGAGCTCAGCCCTGGGCCTGTGG - Intronic
1089666375 11:120022843-120022865 AGAGCACTGCCGCTGTGCTGTGG - Intergenic
1090428408 11:126626459-126626481 AGACCTCTGCTTCAGCCCTGTGG - Intronic
1090633990 11:128677180-128677202 TGAGCTCTAGCCCGGCCCTGTGG + Intergenic
1092070064 12:5624915-5624937 AGAGCTCTCCCCAGCCCCTGGGG - Intronic
1092160881 12:6314932-6314954 ACAGCCCTCCCGGGGCCCTGTGG + Intronic
1102188054 12:110965155-110965177 AGAGCTCCATCCCGGCCCTGTGG + Intergenic
1102994142 12:117335330-117335352 AGAGCCCTGCCTCCGCCCTCAGG + Intronic
1104854818 12:131896594-131896616 AGAGCTTTGCTGTGGCCTTGGGG + Intronic
1104971117 12:132531082-132531104 AGTGCTCTTCCCCGGCACTGAGG + Intronic
1111965720 13:94859520-94859542 AGAGCTCTGCAGCTGCACTTGGG - Intergenic
1113087054 13:106579620-106579642 ATAGCTCTGCTGAGGACCTGTGG - Intergenic
1113788760 13:113016405-113016427 ACAGCTCTGCCAAGCCCCTGGGG + Intronic
1114531237 14:23397663-23397685 AGAGCTCTGCCTCTGCCCAAGGG - Intronic
1114574698 14:23701302-23701324 AGTTCTCTGCCTGGGCCCTGAGG - Intergenic
1117341743 14:54797843-54797865 AGAGCTCTGCCCTGGTCCTCGGG + Intergenic
1118820775 14:69344210-69344232 AGAGCTCTGCAGCTGGCCTCAGG + Intronic
1120241353 14:81953220-81953242 AGTTCTCTGCCTGGGCCCTGGGG + Intergenic
1122051747 14:99065577-99065599 AGAGCCCTGGTGAGGCCCTGGGG + Intergenic
1128672978 15:69588070-69588092 AGAGCTCAGCTGAGGCCCAGAGG - Intergenic
1128688369 15:69704348-69704370 AGAGCTCTGCCAAGGCCAAGAGG - Intergenic
1128838581 15:70831288-70831310 AGAGCCCTGGGGCTGCCCTGGGG + Exonic
1132590563 16:724583-724605 TGAGCAGTGCCGGGGCCCTGGGG + Intronic
1132754311 16:1475181-1475203 AGAGAATCGCCGCGGCCCTGAGG + Exonic
1134110214 16:11510666-11510688 TGAGCACTGCCGGGGCTCTGGGG - Intronic
1135539756 16:23320844-23320866 AGGGCCCTGCCCCGTCCCTGAGG - Intronic
1136922977 16:34346635-34346657 AGAGCTGGGCCCAGGCCCTGAGG + Intergenic
1136981596 16:35065171-35065193 AGAGCTGGGCCCAGGCCCTGAGG - Intergenic
1138487105 16:57352840-57352862 GGAGCCCTGCCGAGTCCCTGGGG + Intergenic
1141430986 16:83970063-83970085 GGAGCTCTGCGGGGGTCCTGAGG - Intronic
1142312820 16:89323760-89323782 AGAGAGCTGGTGCGGCCCTGAGG - Intronic
1143371860 17:6445220-6445242 AGACCTCTGTAGGGGCCCTGGGG + Exonic
1144022713 17:11251312-11251334 AGAGCTCTTTCACTGCCCTGAGG - Intronic
1145191017 17:20842245-20842267 AGAGCTGTGCCTGGTCCCTGCGG - Intronic
1146794910 17:35774024-35774046 AGAGCTCTCCAGAGTCCCTGAGG - Intronic
1147317135 17:39626467-39626489 AGGGGTGTGCCGGGGCCCTGTGG - Intergenic
1147808705 17:43151055-43151077 AGACCTCTGCAAAGGCCCTGAGG - Intergenic
1149998217 17:61416070-61416092 AGAGGTCTGCCCTGGCCTTGGGG - Intergenic
1150822947 17:68450433-68450455 AGAGCTCTGACCCATCCCTGCGG + Intronic
1151911884 17:77088845-77088867 AGAGCTCTGCCGGGGGCTGGAGG + Exonic
1152435441 17:80273523-80273545 GCAGCTCTGCTGCTGCCCTGTGG - Intronic
1152637822 17:81437372-81437394 AGAGCTCTGCCAGTGGCCTGGGG + Intronic
1153993712 18:10421993-10422015 AGAACTCTGCAGCTGCGCTGAGG + Intergenic
1154411070 18:14142641-14142663 AAAGCTGTGCAGAGGCCCTGGGG - Intergenic
1160261922 18:77302018-77302040 AGTGCTCTTCCCCAGCCCTGCGG - Intergenic
1160995184 19:1879178-1879200 AGAGCTGTGCCTGGTCCCTGTGG + Intronic
1161849080 19:6729723-6729745 AGGGCTCTGACCCGGCCTTGGGG - Intronic
1165410576 19:35658349-35658371 ACAGCTCTGCAGTGGGCCTGGGG + Intronic
1165476938 19:36036098-36036120 AGAGCTCAGACTCGGGCCTGGGG - Intronic
1165696815 19:37907053-37907075 AGAGCACTTCCGCAGCCCCGAGG - Intergenic
1167988783 19:53340384-53340406 AGAGGTCTGCAGGGGCCATGGGG - Intronic
931244099 2:60478378-60478400 AGGTTTCTGCCGCGGCCCTGAGG - Intronic
931309627 2:61066003-61066025 CGAGGGCAGCCGCGGCCCTGTGG + Exonic
931882046 2:66577921-66577943 AGACTTCTGCGACGGCCCTGAGG - Intergenic
932825218 2:74932877-74932899 TGTGCTCTGCCTCAGCCCTGGGG + Intergenic
934079041 2:88452262-88452284 AGGGCCCGGCCGCGGCCCCGGGG + Exonic
935545448 2:104395590-104395612 AGGGCTGTGCCCAGGCCCTGTGG - Intergenic
938238134 2:129722845-129722867 AGAGTTCTTTCCCGGCCCTGAGG - Intergenic
939189707 2:138902033-138902055 AGAGCTGTGCCCAGGCCCTGCGG - Intergenic
941452470 2:165676450-165676472 AGAGCTCTGCTGCGTGCCTCTGG + Exonic
946185098 2:217976349-217976371 AGAGCTCTGCTGTGGCTCTGTGG + Intronic
947912549 2:233810996-233811018 AGAGCTCTGCAGATGCCCTCAGG - Intronic
1168948330 20:1779698-1779720 GGGGCTCTGCCAGGGCCCTGTGG + Intergenic
1172357582 20:34290798-34290820 AGGGCTGTGCCCAGGCCCTGCGG - Exonic
1172933299 20:38601175-38601197 GGAGCTCTGTAGGGGCCCTGGGG - Intergenic
1173823489 20:46032859-46032881 AGAGCTCTTCTGAGACCCTGGGG + Intronic
1173866223 20:46314130-46314152 GGCGCTCTGCAGCAGCCCTGGGG - Intergenic
1175243781 20:57568856-57568878 AGAGCTCTGCCGCTGGCCAGTGG + Intergenic
1178485841 21:33019883-33019905 CGAGCTCTGCAGCGGCGTTGCGG + Intergenic
1180950406 22:19718257-19718279 GGAGCCCTGCCGCGCCCCCGGGG - Intronic
1182826149 22:33266509-33266531 AGAGCCCTGGCTCGGCACTGTGG - Intronic
1183195891 22:36353048-36353070 GCAGCTCTGCTGCAGCCCTGTGG - Intronic
1185067584 22:48639849-48639871 AGAGCCCTGCCCAGACCCTGGGG - Intronic
953860815 3:46542863-46542885 AGAGATCTGCTGCGGCCCTTAGG - Intronic
953910943 3:46892776-46892798 GCAGCTCTGCCGCGGAGCTGAGG + Intronic
954291853 3:49654047-49654069 AGAACTCTGCTGTGGCCCTTGGG - Exonic
955353953 3:58215189-58215211 ACAGCTGTGCCAAGGCCCTGAGG - Intergenic
955696455 3:61642025-61642047 TGAGCCCTGCAGCGGCCTTGCGG - Intronic
956030312 3:65030198-65030220 AGAGCTGTGCAAAGGCCCTGTGG + Intergenic
959930770 3:111979373-111979395 AGAGCTCTGCCGCGGCCCTGCGG + Intronic
961562519 3:127740555-127740577 GGGGCTCTGCGGGGGCCCTGAGG + Intronic
961787878 3:129358335-129358357 AGAACTCTGCCCCTGGCCTGAGG - Intergenic
966823090 3:183940561-183940583 AAAGCCCTGCCTCGGCCCAGAGG - Intronic
967190577 3:186981191-186981213 AGAGCTCTGCTGCCGCAGTGAGG + Intronic
968657288 4:1784088-1784110 AGAGCTGTGCCTTGGCCTTGAGG - Intergenic
971375681 4:26054000-26054022 TGAGCTCTGCCACGGCCTTCAGG - Intergenic
971469798 4:27010521-27010543 AGAGCTCTGCCTCCACCCAGTGG + Intronic
974186800 4:58457148-58457170 AGACCTCAGCCGCCTCCCTGTGG + Intergenic
978110983 4:104963881-104963903 AGCACTCTGCCTCGGACCTGAGG - Intergenic
979069701 4:116186142-116186164 AGCTCTCTGCCTGGGCCCTGAGG + Intergenic
982234872 4:153242987-153243009 AGAGAGCTGCCCGGGCCCTGGGG - Intronic
983096780 4:163571849-163571871 AAAGCTCTTCTGCAGCCCTGAGG - Intronic
983163072 4:164441320-164441342 AGAGATCTGCTGCTTCCCTGTGG + Intergenic
985009409 4:185567223-185567245 AGAACACTGCAGAGGCCCTGTGG - Intergenic
985530501 5:431174-431196 ACAGCCCTGTCCCGGCCCTGGGG + Intronic
987069832 5:14325816-14325838 AGAACTCTGCAGCGGGACTGAGG + Intronic
992259640 5:74956902-74956924 AGAGCTCTGGCTGGGCCCGGTGG + Intergenic
993022274 5:82605777-82605799 AGCACTCTGCCAAGGCCCTGGGG + Intergenic
997595969 5:135107680-135107702 AGAGCACTGCCCTGGCTCTGGGG + Intronic
1002564011 5:180100002-180100024 AGGGCTCTGCCCAGGCCCTGCGG + Intergenic
1002762020 6:209666-209688 AGGGCTCTGGAACGGCCCTGTGG - Intergenic
1002782695 6:379524-379546 ACAGCTTTGGCGTGGCCCTGGGG - Intergenic
1005658580 6:27968560-27968582 AGAGCTATTCAGCAGCCCTGGGG - Intergenic
1006472644 6:34237293-34237315 CGAGCTCGGCCGCCGGCCTGCGG - Exonic
1006792836 6:36714896-36714918 ACAGCACTGCAGGGGCCCTGAGG - Intronic
1007406087 6:41637204-41637226 AGAGCGCTGCCGGCGCCGTGGGG + Intronic
1007594566 6:43043537-43043559 AAAGCTGGGCCGCGGCTCTGGGG + Exonic
1014769966 6:125449563-125449585 AGTGCTCTGCTGTGGCCCAGGGG + Intergenic
1019134415 6:169899291-169899313 ATCGCTCTGCTGAGGCCCTGTGG + Intergenic
1022514419 7:30966182-30966204 AGAGCTCTGCCGCAGATTTGTGG - Intronic
1023805020 7:43866828-43866850 AGATCTGTGCCGTGGTCCTGAGG - Exonic
1028772928 7:94647732-94647754 AGACCTCTGTAGAGGCCCTGGGG - Intronic
1033832132 7:145267479-145267501 AGTTCTCTGCCTGGGCCCTGTGG - Intergenic
1033864584 7:145673276-145673298 AGAGCTGTTCTGCAGCCCTGGGG - Intergenic
1034528798 7:151682885-151682907 ACAGGTCTGCCCCGGCCCAGGGG + Intronic
1035718363 8:1771281-1771303 AGAGCACAGCCGCAGGCCTGTGG + Exonic
1039948804 8:42152463-42152485 GGCGCCCTGCCGCGGCCCAGTGG + Intergenic
1044279172 8:90336755-90336777 AGAGCCCTGGAGAGGCCCTGTGG - Intergenic
1048755464 8:137733253-137733275 AGTCCTCTGCCTGGGCCCTGAGG - Intergenic
1048853783 8:138669310-138669332 AGGGCTCGGCCACGGCCGTGGGG + Intronic
1049145913 8:141001034-141001056 TGGGCTGGGCCGCGGCCCTGAGG - Intronic
1049614686 8:143570978-143571000 AGAGCTCGGCTGCTACCCTGAGG + Exonic
1049636274 8:143691245-143691267 AGAGCTCTGCCGCTGCCTCTGGG + Intronic
1049690948 8:143958650-143958672 ACAGCCCTGCCGCTGCCCTCTGG + Intronic
1056693194 9:88825415-88825437 AGGTCTCTGCCTTGGCCCTGTGG - Intergenic
1057312540 9:93951290-93951312 CGAGCTCTGCGGCGGACCTCTGG + Intergenic
1058671788 9:107366505-107366527 TGACCTCAGCCGTGGCCCTGGGG + Intergenic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060758556 9:126229788-126229810 AGAGCTGTGCAAAGGCCCTGAGG + Intergenic
1061217707 9:129231420-129231442 AGAGCTGTGCCGGGGCCGAGCGG - Intergenic
1061398101 9:130354400-130354422 AGAGCTCTGTCCCGGCCCTGGGG + Intronic
1061791450 9:133061334-133061356 AGGGCCCAGCCGAGGCCCTGGGG - Intergenic
1061994075 9:134175292-134175314 ACAGCTCTGCAAAGGCCCTGAGG + Intergenic
1062212738 9:135373365-135373387 TGAGCTCTGCTGCAGGCCTGTGG + Intergenic
1062435910 9:136546480-136546502 AGAGCCCTGCCCCGGGCCCGGGG - Intergenic
1062503475 9:136861223-136861245 AGGGCTCAGCCGCAGCCTTGAGG - Intronic
1185877570 X:3713148-3713170 CGCGCTCTGCCCCAGCCCTGAGG - Exonic
1186171577 X:6882799-6882821 AGAGTCCTGCAGCGGCACTGAGG + Intergenic
1186496576 X:10015979-10016001 CGAGCTCTGCCCGGGCCCGGGGG - Intronic