ID: 959933194

View in Genome Browser
Species Human (GRCh38)
Location 3:112004199-112004221
Sequence CTTGGAAAACAGAAGGTGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 420}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959933192_959933194 -8 Left 959933192 3:112004184-112004206 CCTGGGAAGTCTTCTCTTGGAAA 0: 1
1: 0
2: 3
3: 21
4: 255
Right 959933194 3:112004199-112004221 CTTGGAAAACAGAAGGTGAATGG 0: 1
1: 0
2: 2
3: 47
4: 420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959933194 Original CRISPR CTTGGAAAACAGAAGGTGAA TGG Intronic
900725957 1:4216455-4216477 CTTGGAGAAGAGGAGGTGATGGG + Intergenic
901941517 1:12665982-12666004 CTTGGAAAAGGGCAGGGGAATGG - Exonic
902724491 1:18325746-18325768 CTGGGAAAACAGATGGAGACAGG - Intronic
903912996 1:26742226-26742248 CTGGGAAAACAGAAGTAAAATGG - Intronic
904847003 1:33427619-33427641 CTTAGTAAACAGAAGGTCATTGG - Intronic
904923347 1:34026294-34026316 CTTGGTAACCATAAGGGGAAAGG - Intronic
906252493 1:44321452-44321474 CTTGGGGAACAGAAGGTCCAGGG - Intronic
906276885 1:44523367-44523389 CTAGGCAAAGAGGAGGTGAAAGG - Intronic
906562586 1:46770136-46770158 CTTGGCAAATGGAAGGAGAAGGG - Intronic
906980909 1:50628239-50628261 CTGAGAAAATAGAAGGTGATGGG + Intronic
907680601 1:56559857-56559879 CTTAGAATACAGGAGATGAAGGG - Intronic
907895036 1:58680124-58680146 TTTGGAAATAAGAGGGTGAATGG - Intronic
909830346 1:80181432-80181454 ATTGAAAATCAGAAGGTGAAGGG - Intergenic
910298853 1:85682889-85682911 GTGGGCAAACAGAAGTTGAAGGG + Intronic
910697007 1:90029983-90030005 ACTTGAAAACAGAAGTTGAAAGG - Intronic
910965519 1:92804269-92804291 GATGGAAAACAGAAGTTCAAAGG + Intergenic
911266586 1:95751762-95751784 CATGGGAAACAGAAGATGATAGG - Intergenic
911352775 1:96774384-96774406 CCTGGAACACAGAAAATGAATGG - Intronic
911370307 1:96988086-96988108 CTGGGAACACAGATGGGGAAGGG - Intergenic
911647992 1:100356022-100356044 CTTGGAAAACAGCAAGTGTGAGG + Intronic
911703651 1:100985470-100985492 CTTTGAAAAAAGAATGTTAAAGG + Intergenic
911999488 1:104812716-104812738 CTTGGAAAAAAAAAGGTTCACGG + Intergenic
912222797 1:107697402-107697424 CGTATAAAACAGAAGGGGAATGG + Intronic
912355332 1:109050120-109050142 TCTGGAAAAAAGAAGGTGGAAGG + Intergenic
912393413 1:109320696-109320718 GTTGCAAAACAGAAGGTGCCAGG - Intronic
912674035 1:111660621-111660643 GTTGTAAAAGAGAAGGTCAAGGG - Intronic
916014230 1:160734348-160734370 CTTGGCAAACAGAATGAGGATGG - Intergenic
917127086 1:171696572-171696594 CTGGAAAAACAGAGGGTAAAGGG + Intergenic
917303850 1:173607278-173607300 CTTAGAAAATAGAAGGTCAGAGG + Intergenic
917355107 1:174119344-174119366 TTGGGAAAAGTGAAGGTGAAAGG + Intergenic
917787761 1:178477177-178477199 CTTGAAAAAGGGAAGGAGAATGG - Intronic
918279014 1:182984546-182984568 CTTTGAACCCAGAAGGTGGATGG + Intergenic
920219566 1:204386874-204386896 ATTGGAAAACAGGATGTGGATGG - Intergenic
921283813 1:213591411-213591433 GGTGGGAAACAGAAGGAGAATGG - Intergenic
922222256 1:223617749-223617771 CTTGGAACACAGAGTGTGTAGGG - Intronic
923197466 1:231682346-231682368 CTTGAAAAACAGCAAGTGCAGGG - Intronic
923852058 1:237806927-237806949 CTTGAAAAATAGCAAGTGAACGG - Intronic
1063145808 10:3294198-3294220 CATGGAAGACAGAAAGTGAGAGG + Intergenic
1064068876 10:12208017-12208039 TTTGGAAAACAGAAAGTCAAGGG - Intronic
1064244784 10:13659744-13659766 CTTGGAAAACAAAAACTGTAAGG - Intronic
1064314396 10:14241533-14241555 CTTGGAAAGCAGAAGTACAATGG + Intronic
1065208396 10:23378962-23378984 CTTAGAAAATACAAGGTGAAAGG - Intergenic
1067164979 10:43858277-43858299 TTTGGAAAACATATGTTGAAAGG + Intergenic
1067519444 10:46985681-46985703 CTTAGAAAACAGAAAAGGAATGG + Intronic
1067563080 10:47317553-47317575 CTTGGAACACAGAGGTTGCATGG + Intergenic
1067642804 10:48066158-48066180 CTTAGAAAACAGAAAAGGAATGG - Intergenic
1068282130 10:54886816-54886838 CTTGGAAAACAGATTTTGAAAGG + Intronic
1068979934 10:63051540-63051562 ATTGTGAAACAGAGGGTGAATGG + Intergenic
1069054857 10:63834126-63834148 CTTGGAAAAAGGAAGATGATGGG + Intergenic
1069844884 10:71364091-71364113 CATGGAAATCAGAGGATGAATGG - Intergenic
1069906888 10:71737273-71737295 CTGAGCAAACAGAAAGTGAAGGG - Intronic
1070247032 10:74742531-74742553 CTTGCAAAGCAGAAGGAAAAAGG + Intergenic
1070660252 10:78300585-78300607 CTGGGGAAACAGAAAGTGAAGGG - Intergenic
1071465103 10:85932508-85932530 TTTGGAAAATAGAAAGTGGATGG - Intronic
1072874952 10:99162733-99162755 CTTGGTAAACTGAAGGGGCAGGG - Intronic
1073727838 10:106255005-106255027 CTTGAAAAACGTAAGGAGAATGG + Intergenic
1074757760 10:116638398-116638420 TCTGGAAAAGAGAAAGTGAATGG + Exonic
1075211516 10:120495198-120495220 GTTGGAAAGCAGCAAGTGAAGGG + Intronic
1076025744 10:127111540-127111562 CTTGGAAAACACCTGGTGAGTGG - Intronic
1076091087 10:127686281-127686303 CTTGGAAAGCAGAAGGTGGGTGG + Intergenic
1076192546 10:128492806-128492828 CTTGGAAAACAGCAAAGGAAAGG + Intergenic
1076863522 10:133155272-133155294 CTGGCAAAACGGAGGGTGAAGGG + Intergenic
1077298257 11:1835970-1835992 TTTGGAAGCCAGGAGGTGAAGGG + Exonic
1078493800 11:11796048-11796070 CTTGGAGTACAGAAGGGAAATGG - Intergenic
1079011307 11:16830684-16830706 CTTGGTAAATACATGGTGAATGG - Intronic
1079604195 11:22344082-22344104 CTTGGCCACCAGAAGGTGAGGGG + Intronic
1080431894 11:32207210-32207232 CTTGGAATAGAAAAGGTAAAGGG - Intergenic
1080498791 11:32848657-32848679 CTTGGAAAACAAAAAAAGAAAGG + Intronic
1081284759 11:41254286-41254308 CTTTGAAAAATGAAGGTGATGGG - Intronic
1085380859 11:76116568-76116590 CTTTGAAAAGAGAAGGAGAGAGG + Intronic
1086380846 11:86252057-86252079 TTTGGAAAAAAGAAGGGGATAGG + Intronic
1086800525 11:91169398-91169420 ATTAGACAACAGAAGATGAAAGG + Intergenic
1086876252 11:92099122-92099144 AATGGAAAACAGAAGGTCAATGG + Intergenic
1087096362 11:94322767-94322789 CTTGGAACACAGGATGTGCAAGG + Intergenic
1087150885 11:94858588-94858610 ACTGGAAAACAGGAGGGGAATGG + Intronic
1087166246 11:95006605-95006627 CTTGAAAAACACAAGATGCAAGG + Intergenic
1087562811 11:99813176-99813198 CTTGGAAAAAAGAATGTTAGAGG + Intronic
1088526269 11:110759260-110759282 CCAGGAAAACAGAAAGAGAAAGG - Intergenic
1089367089 11:117927483-117927505 CTTGGAAAAGAGGTGGAGAAGGG - Intronic
1089685664 11:120145163-120145185 CTTGGAAAACAGGACCTGAGAGG + Intronic
1090615748 11:128513000-128513022 CATGGAAAAGGGAAGCTGAAAGG + Intronic
1090627595 11:128619787-128619809 CCAGGAAAACAGATGGGGAAGGG + Intergenic
1091348825 11:134876436-134876458 CTTGGAAACCAGAACGGGAAAGG + Intergenic
1091440906 12:511382-511404 GGTGGAAGACAGAAGGTGGAAGG - Intronic
1091440976 12:511680-511702 GGTGGAAGACAGAAGGTGGAAGG - Intronic
1093582575 12:20800156-20800178 CTTGAAAAAATGTAGGTGAAAGG + Intergenic
1093673688 12:21908227-21908249 CATGGAAAAGAGAAGATGAATGG + Intronic
1093903802 12:24665564-24665586 CTGGGGAAACAGAAGCAGAAAGG + Intergenic
1094294968 12:28895375-28895397 CGTGGCAAGCTGAAGGTGAAAGG + Intergenic
1095502777 12:42858956-42858978 CTTGCTAAACAGCAGTTGAATGG + Intergenic
1097586029 12:61517198-61517220 CTTGGGAGACAGAATGTGACTGG - Intergenic
1098422186 12:70310805-70310827 TGTGGAAAACAGAACATGAAGGG - Intronic
1099517599 12:83616848-83616870 CTTGAAAAACAGCAGATGCAAGG - Intergenic
1100152631 12:91759187-91759209 CTTGCAAGGCAGAAGGTTAAGGG + Intergenic
1102457886 12:113082160-113082182 CCTGGAAAACAGAAGATGTGGGG + Intronic
1102571722 12:113830846-113830868 GTTGGAAAGCAGAGGCTGAAAGG + Intronic
1104211819 12:126696221-126696243 CTTTGAGAAGGGAAGGTGAAGGG - Intergenic
1104380323 12:128301688-128301710 CTTGGCAAACAGATGCAGAATGG + Intronic
1104707599 12:130959039-130959061 CTTGGAAAACAGCAGCCGAGTGG + Intronic
1106794298 13:33188350-33188372 CCTGGAAAACAGTAGGTGTATGG + Intronic
1107040258 13:35940515-35940537 CTAGGAAACCAGAAGGTTAATGG - Intronic
1107255490 13:38421222-38421244 CTTGAAAAATGGAAGATGAAGGG - Intergenic
1108348613 13:49569969-49569991 CTTACAAAACAGATGGAGAAAGG + Intronic
1108464813 13:50704838-50704860 CTTGAAAATGAGAAGGTGATTGG + Intronic
1108532875 13:51343879-51343901 CTGGGAAAACAGCAGGTCCAGGG - Intronic
1108852925 13:54757497-54757519 TTTGGAAGACAGAAGGTATATGG - Intergenic
1110528126 13:76563489-76563511 CTTGGAATGCCAAAGGTGAAGGG - Intergenic
1110682084 13:78326003-78326025 CTTTAAACTCAGAAGGTGAATGG + Intergenic
1110688601 13:78404664-78404686 CCTGGAAAACAGAAGTGGAAAGG + Intergenic
1110911617 13:80972713-80972735 TTTGGAACACAAAAGGTGGAAGG - Intergenic
1110971750 13:81771586-81771608 TATGAAAAACAGAAGGTAAATGG + Intergenic
1111831644 13:93337796-93337818 CTTGGAAAACATAACCAGAAGGG - Intronic
1112580976 13:100675628-100675650 CTGGAAAAACAGAAGGTGGGGGG - Intergenic
1112694270 13:101930128-101930150 CTTTGAAAACAGGAAGGGAAGGG - Intronic
1112950328 13:104987784-104987806 ATTGGAAAACACCTGGTGAATGG - Intergenic
1114197158 14:20488774-20488796 GGTGGTAAACAGAAGATGAAAGG + Intergenic
1115794073 14:36912971-36912993 CTGGGAAAAAAAAAGGAGAAAGG - Intronic
1117147817 14:52852696-52852718 TTTGGAAAACAGAAGAGCAAGGG - Intergenic
1117978904 14:61322506-61322528 TTTGAAAAACATAAGGGGAACGG - Intronic
1118686667 14:68298319-68298341 CTGGGAGAACAAAAGGAGAAAGG + Intronic
1119162487 14:72464645-72464667 CAGGGAAAACAGTAGATGAATGG - Intronic
1119914864 14:78388718-78388740 CTTGGAAAACAGAAGTACAAAGG + Intronic
1119982459 14:79097380-79097402 CTTGGAAAGCAGAAAGAGAATGG - Intronic
1121114987 14:91337203-91337225 CTGGGAAAAATGTAGGTGAAAGG - Intronic
1121639275 14:95474498-95474520 CTTCCCAGACAGAAGGTGAAGGG + Intronic
1121751354 14:96360093-96360115 CTTTGTAAAGAGAAAGTGAATGG + Intronic
1122218191 14:100218216-100218238 CTTGGCAAGCAGAAGGGGCACGG - Intergenic
1123163960 14:106308009-106308031 CTTGGAAGACAGAAAGTAAAGGG + Intergenic
1123196056 14:106617674-106617696 CTTGGAGGACAGAAAGTAAAGGG + Intergenic
1123223481 14:106878246-106878268 CTTGGAGGACAGAAAGTAAAGGG + Intergenic
1123507122 15:20954250-20954272 GATGGAATACAGAATGTGAAGGG - Intergenic
1123564349 15:21527997-21528019 GATGGAATACAGAATGTGAAGGG - Intergenic
1123600602 15:21965280-21965302 GATGGAATACAGAATGTGAAGGG - Intergenic
1124615711 15:31240604-31240626 CTTGTAAAACACAAGGTTACAGG + Intergenic
1125365702 15:38913294-38913316 GGTGGAAAACACAAGGTAAACGG - Intergenic
1125425087 15:39540484-39540506 CTATCAAAAGAGAAGGTGAAAGG + Intergenic
1126256563 15:46634058-46634080 TTTGTAAAACAGAATGTGAACGG - Intergenic
1127702661 15:61516198-61516220 CTTGAAAAACAAAAAGTTAAAGG + Intergenic
1128927188 15:71668445-71668467 CCTGGAAGACAGCAGGTAAAAGG + Intronic
1129427450 15:75474158-75474180 TATGGGAAACAGAAGGTTAATGG - Intronic
1130655358 15:85788786-85788808 CTTGGAAATCTGAGGGAGAAAGG - Intronic
1130822309 15:87508516-87508538 CTAGGAAATCAGGAGGTGGAAGG + Intergenic
1131341923 15:91610631-91610653 CTTGGAAATCAGATGGTGCTAGG - Intergenic
1131382357 15:91974496-91974518 GCTGGAAACTAGAAGGTGAAGGG + Intronic
1132037571 15:98499502-98499524 CTGGGAAAAGAGAAGGGAAAAGG - Intronic
1132097237 15:98996727-98996749 CTGGGCAAGCAGAAGGTAAAGGG - Intronic
1202972710 15_KI270727v1_random:255101-255123 GATGGAATACAGAATGTGAAGGG - Intergenic
1135339453 16:21633703-21633725 CTAGGAATACAGAAACTGAACGG - Intronic
1136382606 16:29902813-29902835 CTTTTAAAAAAGAAGGTGTAGGG - Intronic
1136872222 16:33817772-33817794 CATGGAAGACAGAAAGTAAAGGG - Intergenic
1137394256 16:48105846-48105868 CTTGGGAAAAAGAAAGGGAAGGG - Intronic
1137577553 16:49612093-49612115 TTTGGAAAACAGAAGAGGAAAGG + Intronic
1138537412 16:57667322-57667344 CTTGGCAATTGGAAGGTGAAGGG - Intergenic
1139271231 16:65685023-65685045 CCTAGAAAACAGACGGTGAGAGG + Intergenic
1140234606 16:73147050-73147072 CTTGGAAAAGAACAGGTTAAAGG + Intergenic
1140331782 16:74064689-74064711 TTAAAAAAACAGAAGGTGAAGGG + Intergenic
1140551581 16:75871604-75871626 ATTAGAAAACAGAATGTTAATGG - Intergenic
1142415501 16:89938989-89939011 CCTGGAGCACTGAAGGTGAAGGG + Intergenic
1203099950 16_KI270728v1_random:1298296-1298318 CATGGAAGACAGAAAGTAAAGGG + Intergenic
1143487400 17:7262344-7262366 CTAGGCAAACAAAAGGTGGAGGG + Exonic
1144069095 17:11651310-11651332 ACTGGAAAACAGAAGGTAACAGG + Exonic
1144461851 17:15464660-15464682 GTTTGAAAGCAGAAGGGGAAGGG - Intronic
1144483343 17:15645345-15645367 CTTCGAATACAGAACATGAATGG - Intronic
1144915344 17:18719681-18719703 CTTCGAATACAGAACATGAATGG + Intronic
1145823640 17:27859895-27859917 CTTAGATAGCAGAAGGTGCATGG - Intronic
1146147592 17:30434684-30434706 CTTGGCAATTAGATGGTGAATGG + Intronic
1146316785 17:31813581-31813603 CTTGGAAAAGAGAAAGCTAATGG + Intergenic
1147446989 17:40480507-40480529 CCTGTAAAACAGAAGATGAGAGG - Intronic
1147639174 17:41983939-41983961 CTTAGAAAAGACAATGTGAAGGG + Intronic
1149068722 17:52513444-52513466 AATGCACAACAGAAGGTGAAAGG + Intergenic
1149979717 17:61300354-61300376 TTTAGAAAACTGAAGTTGAAGGG - Intronic
1150974548 17:70069831-70069853 CCTGGAAGACAGTAGGTGAGAGG - Intronic
1151333383 17:73424394-73424416 CTTGCAAAACAGCCAGTGAAAGG + Intronic
1152037253 17:77881025-77881047 CTTGGCACACAGTAGGTGCACGG + Intergenic
1152247235 17:79191407-79191429 CTCGGGAAACAGAATGTGAGGGG + Intronic
1152318689 17:79595890-79595912 AATGGAAAACAGAAGTGGAATGG - Intergenic
1152905025 17:82965298-82965320 CTGGGACAACAGAGGGAGAAGGG - Intronic
1153012317 18:550060-550082 CTTGAAAAAAGGATGGTGAAGGG - Intergenic
1155382129 18:25235373-25235395 CTGGGGAAGCAGAAGGTAAAGGG + Intronic
1155835636 18:30580531-30580553 TTTTGAAAATAGAAGGTGCATGG + Intergenic
1157300984 18:46479014-46479036 CTTGGAAAAGAGCAGGTGACAGG - Intronic
1157407647 18:47436618-47436640 CTAGTAAAACAGTGGGTGAAGGG + Intergenic
1157513471 18:48295011-48295033 CTTGAAAAATAGGAGGTGAGAGG + Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1158473455 18:57759214-57759236 CTTGGAAAACAGAGAAAGAAAGG - Intronic
1159742871 18:72194634-72194656 ATTGGAAAACAGAAGTTAAAAGG + Intergenic
1160781781 19:880590-880612 CATGGAAAAGAGAATATGAAAGG + Intronic
1161021237 19:2012733-2012755 CTTGGAGAAAAGTAGGTGAGGGG - Intronic
1161512644 19:4679946-4679968 CCTGGAAAACAGATGGGGAAGGG + Exonic
1161612716 19:5251915-5251937 CTGGGAATACAGGAGGTGAGGGG + Intronic
1162119422 19:8453680-8453702 CTGGGGAAGCAGAAGGTGCAAGG + Intronic
1164111385 19:22162646-22162668 CTCAGAAAACAGAAAGGGAAGGG + Intergenic
1165426188 19:35746681-35746703 CATGGGAAACAGAAGCTGGAAGG - Intronic
1166272991 19:41728895-41728917 GTTGAGAAACAGAAGCTGAATGG + Intronic
1166443546 19:42838032-42838054 CTTGAGAAACAGAAGCTGAACGG - Intronic
1166463237 19:43008694-43008716 CTTGAGAAACAGAAGCTGAATGG - Intronic
1166469381 19:43065252-43065274 CTTGAGAAACAGAAGCTGAACGG - Intronic
1166480511 19:43168790-43168812 CTTGAGAAACAGAAGCTGAATGG - Intronic
1166530709 19:43541630-43541652 CCTGGAATATAGAAGGTGAATGG + Intergenic
1167781221 19:51600696-51600718 CTTGGTATACAGTAGGTGGATGG + Intergenic
925615419 2:5740615-5740637 CTTTGAGAGCAGAAGGTGAGCGG - Intergenic
925671398 2:6313237-6313259 CTTGTCAAAGAAAAGGTGAATGG + Intergenic
925766533 2:7241776-7241798 CTTGGAGAACAGAAGACTAAAGG - Intergenic
925801503 2:7606635-7606657 CTTGGAAAATAAAAGGTGCTGGG - Intergenic
927194288 2:20537166-20537188 CATGGACAACAGAGGGTTAACGG + Intergenic
927229420 2:20806425-20806447 CTTGGAAAATATATGGTGACTGG + Intronic
927502788 2:23593520-23593542 CTTGGACAGCAGAATGTGTATGG + Intronic
928336432 2:30402396-30402418 CCCGGAAAAGAGAAGGTTAAAGG + Intergenic
928712874 2:34027239-34027261 ATAGGAAAACAGAAGTTAAAAGG - Intergenic
928839571 2:35588398-35588420 TTTGTAAAACAGAAGGCAAATGG - Intergenic
930380413 2:50621016-50621038 GTTGGAAAACAGAAGTTGACAGG + Intronic
931319579 2:61163139-61163161 CTTAGAAAACAGAAGGGACATGG + Exonic
931341011 2:61400741-61400763 CTTAGGACACTGAAGGTGAAGGG + Intronic
931484799 2:62679896-62679918 CTTGGCAGACCTAAGGTGAAAGG + Intronic
931820617 2:65947852-65947874 ATTGGAGAGCAGAAGGTAAATGG - Intergenic
932800607 2:74739401-74739423 CTTGGAAATAAGCAGGGGAAGGG + Intergenic
933583215 2:84150704-84150726 CTAAAAAAACAGAAGGTGAATGG + Intergenic
934792486 2:97073446-97073468 CTTGGAAGAAAGAAGGACAAAGG + Intergenic
934814129 2:97310258-97310280 CTTGGAAGAAAGAAGGACAAAGG - Intergenic
934823566 2:97398223-97398245 CTTGGAAGAAAGAAGGACAAAGG + Intergenic
935976722 2:108585675-108585697 CTTGCAAAAGAGATGGTGATGGG + Intronic
936065157 2:109325685-109325707 CTTGGAAACCAGGAGATGAGTGG - Intronic
938108277 2:128547860-128547882 CCTGGGAAGCAGAAGGGGAAAGG + Intergenic
940571456 2:155440728-155440750 TTTTGAAAACAGAAGATGAATGG + Intergenic
940806412 2:158192400-158192422 CTTGGAAAGCAGCTGGGGAAGGG + Intronic
941585715 2:167355608-167355630 CATGGACAATAGATGGTGAAAGG - Intergenic
942590200 2:177536033-177536055 GCTGGAAAACAGAAGGTGCTTGG - Intronic
942977311 2:182033668-182033690 GTTGGAAAAGAGAAGGGTAACGG - Intronic
943011956 2:182460937-182460959 CAAGGAAAACAAAAGGTGGAGGG + Intronic
943676561 2:190721514-190721536 CTGAGAAAAAAGCAGGTGAAAGG - Intergenic
945136835 2:206638666-206638688 CCTTGAAAACAGAGGGAGAAAGG - Intergenic
945711974 2:213307994-213308016 CTTGGGAAAGAGAAGGCGAAAGG + Intronic
946084094 2:217153705-217153727 CTTAGAAAACAAAAGTTGAATGG - Intergenic
946116758 2:217469534-217469556 CTTGGCACCCAGAAGGGGAAAGG + Intronic
946572919 2:221043879-221043901 CTTGAAAAACAGAATTTCAATGG - Intergenic
947264422 2:228261231-228261253 ATTGAAAAACAGAAAGGGAATGG + Intergenic
947267379 2:228298681-228298703 CTGGGGATACAGAAGTTGAAAGG - Intergenic
1170468594 20:16645691-16645713 CTTGGAAAACATAAGCTGTAAGG + Intergenic
1170987717 20:21273759-21273781 CTTAGAAAAAAGAAGGCGAAAGG + Intergenic
1171403928 20:24897113-24897135 CTTGGAAATCAGAACATGCAAGG + Intergenic
1171459235 20:25289238-25289260 CTTCAAAAACAGCAGGTGACAGG - Intronic
1171478636 20:25434885-25434907 CTTGCATAGCAGAAGGTGGAAGG + Intronic
1172270212 20:33650943-33650965 ATTGCCCAACAGAAGGTGAAGGG - Intergenic
1172707038 20:36889463-36889485 TTTGAAACACAGATGGTGAAGGG + Intronic
1173338391 20:42131952-42131974 CTGGGAAAACAGAGTGTGAGGGG + Intronic
1173493859 20:43504907-43504929 ATGGGGAAACAGAAGGGGAATGG - Intergenic
1173890062 20:46500263-46500285 CATGGAAATCAGAACTTGAAAGG + Exonic
1176910146 21:14555235-14555257 TTTGGATAATAAAAGGTGAATGG - Intronic
1176982095 21:15394305-15394327 CATGTAAAACAAAAGGTAAAAGG + Intergenic
1177201853 21:17966365-17966387 CTAAGAAAACAGAAATTGAAGGG + Intronic
1177235552 21:18385449-18385471 CTTGGTCAACAGAATCTGAAGGG + Intronic
1177517494 21:22174706-22174728 CTTGGAAACAAAATGGTGAAAGG - Intergenic
1178568859 21:33716017-33716039 TTTTCAAAACAGAAAGTGAATGG + Intronic
1179992456 21:44955235-44955257 CTTGGAAAACAGAGAGAGACAGG + Intronic
1180818401 22:18807775-18807797 CTTAGAAAACACAAAGTGCAAGG - Intergenic
1181204623 22:21242230-21242252 CTTAGAAAACACAAAGTGCAAGG - Intergenic
1181623953 22:24109666-24109688 CTTGGGGAACACAAGGAGAAAGG - Intronic
1181731526 22:24850418-24850440 TGTGGAAAACAGCAGGTGAGAGG + Exonic
1181762431 22:25067521-25067543 CAGGGAACACAGAGGGTGAAAGG - Intronic
1181967853 22:26669092-26669114 CTTGGGGAACAGAAGGTGGCAGG + Intergenic
1181988354 22:26817653-26817675 GTTGGAAAACAGACTGTGGAAGG + Intergenic
1182537302 22:31014257-31014279 CTTGGAAATCCCAATGTGAAGGG - Intergenic
1183035161 22:35135576-35135598 TTTGGCAAACTGAGGGTGAAGGG + Intergenic
1183291366 22:37003790-37003812 GTTGGAAGACAGAAGGAAAAAGG - Intronic
1183295264 22:37025442-37025464 CTTGGAGAACTGAGGGTGGAAGG + Intronic
1203222301 22_KI270731v1_random:53185-53207 CTTAGAAAACACAAAGTGCAAGG + Intergenic
1203268530 22_KI270734v1_random:33629-33651 CTTAGAAAACACAAAGTGCAAGG - Intergenic
949229156 3:1730154-1730176 CTTGGACCCCAGAAGGTGAGTGG - Intergenic
949498382 3:4655170-4655192 CTTGAAATAAAGAAGGTGCAAGG - Intronic
949588317 3:5465729-5465751 CTTTGTAAACTGGAGGTGAAGGG + Intergenic
949864393 3:8535562-8535584 TTTGGAAAACAGTGGGTTAAGGG - Intronic
950467136 3:13162244-13162266 CTTGGAAGACAGAGGGAGAAGGG + Intergenic
951010997 3:17679254-17679276 CTCCTAAAACAGAAGGTAAATGG + Intronic
951163474 3:19455391-19455413 ATTGAAAAACATAAGGTGATGGG - Intronic
952355638 3:32580801-32580823 CTTGGAAAATGGATGATGAATGG + Intergenic
952521907 3:34169379-34169401 CTTACATAACAGAAGGTGGAAGG + Intergenic
952791102 3:37201366-37201388 CTTGGAAGAGAGAGTGTGAATGG - Intergenic
953252403 3:41258173-41258195 CTGAGAAAATAGAAGGTTAAAGG - Intronic
957011437 3:75010132-75010154 GTTGGAAAAGAGAAGAAGAAGGG - Intergenic
958188406 3:90153119-90153141 CTAGGGAAGCAGAAGCTGAAAGG + Intergenic
958454620 3:94315167-94315189 CTTGGAAAATACAAAGTCAAGGG - Intergenic
959496762 3:107060866-107060888 CTAGGTAAAAAGAAGGTGAAAGG - Intergenic
959539375 3:107523146-107523168 GTAGGAAAACAGAAAGTGAGGGG - Intronic
959630578 3:108502850-108502872 CTTGAAATACAGAAAGTGAAGGG - Intronic
959841459 3:110981759-110981781 CTAGGAAAACAGTAGGTTCAGGG - Intergenic
959933194 3:112004199-112004221 CTTGGAAAACAGAAGGTGAATGG + Intronic
960299941 3:115990557-115990579 CTGAGAAAACAGAAGCTGATTGG - Intronic
961414478 3:126747343-126747365 CTGGGAAAACCGAACGTGTATGG - Intronic
961500047 3:127325981-127326003 CTTGGCCAACAGAATGTGATGGG - Intergenic
964502406 3:157362934-157362956 CCTGGAACACAGTAGCTGAATGG + Intronic
964696429 3:159512976-159512998 CTTAAAATACAGCAGGTGAATGG + Intronic
964921621 3:161903641-161903663 CTAGGAAAAAAAAAGGTGGAGGG - Intergenic
965492446 3:169355375-169355397 TTTTGAAAACCAAAGGTGAAAGG - Intronic
966916613 3:184587770-184587792 CTTGGCAGAGAGAAGGAGAAAGG + Intronic
967912198 3:194551752-194551774 CTTGGAAATCTGAATCTGAAGGG - Intergenic
968378418 4:65296-65318 CCTGGAAAACGGAAGTAGAAAGG - Intronic
969081769 4:4624640-4624662 CTGGGAAGGCAGAAGGTGAAAGG + Intergenic
969664646 4:8550053-8550075 GGTGGAAGGCAGAAGGTGAAAGG - Intergenic
970732398 4:19121765-19121787 CTTGTAAACCAAAAGTTGAATGG - Intergenic
972292689 4:37704609-37704631 GGTGGAAAGCAGAAGGTGTAGGG - Intergenic
972395883 4:38659613-38659635 CTTGCATGGCAGAAGGTGAAGGG + Intergenic
973062945 4:45752024-45752046 CTTGGAATACAGAGTATGAAAGG + Intergenic
973932545 4:55807519-55807541 CTTTTAAAACAGAAAATGAAAGG + Intergenic
974018592 4:56673046-56673068 CATGGGAAACAGAAAGGGAAAGG - Intronic
975168796 4:71209295-71209317 CTTGGAAAAAAGAAGCAGCAGGG + Intronic
975172286 4:71245997-71246019 TTTGGCAAAAAGAAGGTGATTGG + Intronic
976107067 4:81630500-81630522 GTTGCAAAACTGAATGTGAAAGG - Intronic
977565507 4:98576606-98576628 CTTGGAAAACTGAGGATGGAGGG + Intronic
978629829 4:110731765-110731787 CTTGGAGAAAAGCAAGTGAATGG + Intergenic
979136335 4:117116496-117116518 TTTGGAAACCAGAAGCTAAAAGG - Intergenic
979336782 4:119472409-119472431 CTTGCAAGACAGAAATTGAAGGG - Intergenic
979505317 4:121488614-121488636 CTTGGAAAACACACAGGGAACGG - Intergenic
980059787 4:128116878-128116900 CTTGATAAAAAGAATGTGAATGG - Intronic
980543149 4:134220743-134220765 CTTGAAAAACAGGAGATTAATGG + Intergenic
980597519 4:134973229-134973251 CTTGGAAAAAAGGAGAGGAAAGG + Intergenic
980841715 4:138269444-138269466 CATTGAAAACAAAAGGAGAATGG + Intergenic
981082201 4:140646633-140646655 CTTCCAAAACAGAAAGTAAAAGG - Intronic
981646673 4:147006084-147006106 TTTGGAGAACAGAAGGTAAGGGG + Intergenic
983116760 4:163827777-163827799 TTTGCAAAACTGAAGTTGAATGG + Intronic
984050994 4:174865113-174865135 CATGGAGAACACAAGGAGAAAGG + Intronic
984876333 4:184371257-184371279 CTGGTAAAACAGAAAGGGAAGGG - Intergenic
986962057 5:13226076-13226098 TTTGTAACACAAAAGGTGAATGG + Intergenic
987097183 5:14560401-14560423 CTTGGAAAACAGCAGATGGTCGG + Intergenic
987233786 5:15922474-15922496 CTCGGAGAACAGAAGCTGCAGGG + Intronic
989005744 5:36810300-36810322 ATTGGAAAAAAGAAGTTAAATGG - Intergenic
989304468 5:39937006-39937028 TTTAGAAAACAGAAGATGGAGGG + Intergenic
990352712 5:54934851-54934873 CTGGGAGATCAGAAGGTGACAGG + Intergenic
990468226 5:56089127-56089149 CTGGGAACACAGGAGGAGAAAGG - Intergenic
990622221 5:57571852-57571874 TTTGGAAAACAGAAGGAATATGG + Intergenic
991329847 5:65482187-65482209 CTTGGAAAAATGAAGGGGGAGGG + Intergenic
991621530 5:68550297-68550319 CTAGGAAAACAGAAGAAGTAAGG + Intergenic
992163539 5:74025955-74025977 CTTGGAACAGAGCAGGAGAAGGG + Intergenic
992601145 5:78401457-78401479 CTTCCAAAACAGAAGGTAACAGG - Intronic
993490492 5:88540639-88540661 TTTGGAAGACAGAATCTGAAAGG + Intergenic
993865534 5:93190075-93190097 CTTGGAAGACAGATGGTTACAGG + Intergenic
994158290 5:96527428-96527450 CTTTGAGATCAGAGGGTGAAAGG - Intronic
994364538 5:98897670-98897692 CTTGGAATTCAGAAATTGAACGG - Intronic
994776616 5:104042543-104042565 GGAGGAAAAGAGAAGGTGAAGGG - Intergenic
995140106 5:108726704-108726726 CTGGGAGAACAGCAGATGAAAGG + Intergenic
995281774 5:110344048-110344070 TTTGTAAAACAGAATGTTAATGG + Intronic
996813616 5:127548100-127548122 CCTGGAAAACAAAAGGAGGAAGG - Intronic
997373153 5:133375178-133375200 TTTGGAAAACAGCAGGTAATGGG - Intronic
998510952 5:142713518-142713540 CCTGGGAAACAGGAGGAGAACGG - Intergenic
998620932 5:143793564-143793586 CCTGGTAAGCAGAAGGAGAATGG - Intergenic
998749544 5:145304014-145304036 CTTGGAAATATGCAGGTGAAGGG + Intergenic
998779351 5:145639340-145639362 CTTGAAAACCAGAGGGAGAAGGG + Intronic
1000215673 5:159153632-159153654 CTTGGGAAAGAGGAGGTGGAGGG + Intergenic
1000332076 5:160213527-160213549 CTTGGAAAACAGACAGAGACAGG - Intronic
1000448779 5:161358547-161358569 TGTGGAAAAGAGAGGGTGAATGG + Intronic
1000886153 5:166750152-166750174 CTTGGAGAAAAGAAGGAAAAAGG + Intergenic
1002162989 5:177327773-177327795 CTTGAACAACAGAAAGTGATTGG - Intergenic
1002362744 5:178686226-178686248 CTTGGAAAGCAGGAGCTGAGAGG - Intergenic
1003188576 6:3853422-3853444 CCTGGAAAACAGAAGGTAAGGGG + Intergenic
1003463545 6:6354448-6354470 CTTGCAAAGCTGAATGTGAATGG - Intergenic
1003509368 6:6766557-6766579 GTTGGAAAATACAAGTTGAAAGG - Intergenic
1003915282 6:10781042-10781064 CTAGTAACACAGGAGGTGAAGGG - Intronic
1004721404 6:18270597-18270619 CTTGGAGAACAAAGGATGAATGG + Intergenic
1005614436 6:27559104-27559126 TTTGGAAAACAGGAGGGGAAGGG + Intergenic
1007694843 6:43725511-43725533 CGTGGCAAACAGAAGGAGGAAGG - Intergenic
1008084807 6:47233309-47233331 TTTAGAATTCAGAAGGTGAATGG + Intronic
1008464464 6:51815052-51815074 CTTGGCAAACAAAGGGTGGATGG - Intronic
1009299624 6:61998675-61998697 TTTGGAAAGCAGAAGGACAAAGG - Intronic
1009885078 6:69616059-69616081 CTTGGGAAACAGAAGCTGGGAGG - Intergenic
1012398665 6:98827257-98827279 CTTTGAAAACAGTGTGTGAAGGG - Intergenic
1012720901 6:102743146-102743168 GTTGCAAAACTGAAGGTGGATGG + Intergenic
1013168469 6:107615410-107615432 CTTGGAAATCAGAGGGACAAAGG + Intronic
1013263432 6:108470096-108470118 ATGGGAAATCAGAAGGTGAGAGG - Intronic
1013326362 6:109048189-109048211 CTTGGAAGACAAAAGATTAAGGG - Intronic
1013642022 6:112094383-112094405 CATGGAAAACAGAAAATAAATGG - Intronic
1014233566 6:118930836-118930858 CTTTTAAAACAGAAAGTGAGGGG + Intronic
1014751335 6:125260143-125260165 ATTGCAAAAGAGAATGTGAATGG + Intronic
1016967167 6:149729630-149729652 CTGGGAAAACAAAAGGTAATAGG - Intronic
1017019360 6:150127827-150127849 CTTGCAAAAAGGAAGGTGGAGGG - Intergenic
1017187763 6:151619357-151619379 AATGGAAAACAGAAAGTGACAGG - Exonic
1018252042 6:161881168-161881190 CCTGGAAAACAGATGTTGGAGGG + Intronic
1018475449 6:164135668-164135690 CGTGGGAGACAGAGGGTGAAAGG - Intergenic
1019856836 7:3617647-3617669 CATGGAAGTCAGAAGGTCAAGGG + Intronic
1020671904 7:11126610-11126632 CTTGGAAATGTGAAGGAGAAAGG - Intronic
1020920430 7:14257329-14257351 CTTGGAAAACAGACTGTAAGTGG + Intronic
1022233312 7:28436279-28436301 ATTGGAAAACATAAGTGGAAAGG - Intronic
1022652766 7:32292734-32292756 CTTGGAACACAGCAGGAGGAGGG - Intronic
1022877608 7:34551530-34551552 ATTGGAAATCAGAAAGTCAAGGG + Intergenic
1023290375 7:38662117-38662139 TCTTGAAAACAGAAGATGAATGG - Intergenic
1023525108 7:41093946-41093968 GCTGGGAAACAGAAGATGAAAGG + Intergenic
1023626336 7:42118717-42118739 CTTGGAAATCAGAAGGCCACTGG - Intronic
1024574398 7:50752431-50752453 CTTGGAAAGAGAAAGGTGAAAGG + Intronic
1026307420 7:69154137-69154159 GGTGGAAGGCAGAAGGTGAAAGG + Intergenic
1026487000 7:70830247-70830269 CTTGTGAAGCAGATGGTGAAGGG - Intergenic
1029535203 7:101154022-101154044 CCTGGAAAACAGAAAGACAAAGG - Intergenic
1029953440 7:104611637-104611659 CTTGGAAATGAGAAGATGAAGGG - Intronic
1031464912 7:122097151-122097173 CTTGGAAAACATATAATGAAAGG - Intronic
1031663203 7:124453219-124453241 ATTGGAAAACAGAAAATGAATGG + Intergenic
1033132867 7:138760069-138760091 CAAAGAAAACAGAAGGTCAAAGG - Intronic
1033502591 7:141966594-141966616 CTTAGAAAAGGGAAGGGGAAGGG - Intronic
1033657730 7:143384348-143384370 TTTGGAGAACAGAAAGTGGAAGG + Intronic
1033859123 7:145603356-145603378 CTAGGAAAATAGAAAATGAAGGG - Intergenic
1035144294 7:156798379-156798401 CTTGGTAGAAAGAAGATGAAAGG - Intronic
1035766283 8:2108480-2108502 CTTGGAAGACGAAAGGTTAAAGG - Intronic
1036234032 8:7022713-7022735 GTTGGAACAAAGAAGATGAAGGG + Intergenic
1036681072 8:10874703-10874725 CTTGGAAATGAGAAGGAGAAAGG - Intergenic
1037170323 8:15884963-15884985 CTTGCAAATCAGAGGGTAAAAGG + Intergenic
1037197552 8:16209529-16209551 TTTGGAAAAGACAAGGAGAATGG - Intronic
1037855934 8:22370676-22370698 CTTGGAAACTAGAAGAGGAAGGG + Intronic
1038395750 8:27244306-27244328 CTTGGGAAAGGGAAGGTGAGAGG - Intronic
1039044320 8:33436046-33436068 CTGGGAGAACAGAACATGAATGG + Intronic
1039831745 8:41220971-41220993 CTTTGAAGACAGGTGGTGAAGGG - Intergenic
1040892438 8:52331127-52331149 CTTGGCAAACAAGAGGTTAAGGG - Intronic
1041433103 8:57806290-57806312 CTTGGAGAAGTGAAGGTAAAAGG + Intergenic
1041631305 8:60090660-60090682 CTTAGAAAAATGAAGGGGAAAGG + Intergenic
1042179134 8:66067268-66067290 CTTGGAGAACAGAAGCTGAAAGG + Intronic
1043053857 8:75412938-75412960 CGTGGAAAACAGAAGCAAAAAGG + Intronic
1043285559 8:78525151-78525173 CTGGGTAAACAGATGGTGCATGG - Intronic
1043775260 8:84259310-84259332 CATGGAATACAGAAGTTGGAGGG - Intronic
1043941746 8:86204227-86204249 ATTGGAAACTAGAAAGTGAATGG + Intergenic
1044072149 8:87775492-87775514 CTAGGAAGACTGAAGGAGAAGGG - Intergenic
1044315993 8:90750798-90750820 CCTGGAAAACAGGATGTGATAGG - Intronic
1044549837 8:93499443-93499465 CAGAGAAAACAGGAGGTGAAAGG + Intergenic
1047225283 8:122951427-122951449 CTTGGAACGAATAAGGTGAAAGG - Exonic
1047596191 8:126380043-126380065 CCTGGAGAACAGAAGTTGGATGG + Intergenic
1048683476 8:136873825-136873847 CTTGCAAAAAAGAAGATGAAAGG + Intergenic
1048729383 8:137420468-137420490 CTTGGAAAAGAGAGAGAGAAGGG - Intergenic
1050014365 9:1218475-1218497 CTTTGAAAACAGAAGCTAGAAGG - Intergenic
1050292597 9:4171389-4171411 GTTGGAGAACAGAATGTGATAGG - Intronic
1050592516 9:7174766-7174788 GTTGGAAGAGAGAAGATGAAGGG + Intergenic
1050612147 9:7364046-7364068 CTGTGCTAACAGAAGGTGAAAGG + Intergenic
1050654249 9:7808572-7808594 CTTATAAAATAGAAGTTGAAAGG + Intronic
1051278378 9:15418215-15418237 CTTGGGAAACAGCAGGTGCAAGG + Intergenic
1051874548 9:21777662-21777684 CTTGGAAGATAGGAGATGAAGGG + Intergenic
1052070256 9:24073251-24073273 CGTGGAGTACCGAAGGTGAAAGG + Intergenic
1053120412 9:35542639-35542661 CTTGGAACACAGTAGGTGCCTGG - Intronic
1054752420 9:68921477-68921499 CTCAGAAAACAGGAGGGGAATGG - Intronic
1055126943 9:72730129-72730151 CTTGGTCAACAGTAGGTCAAGGG - Intronic
1055159504 9:73108340-73108362 ATGAGAAAAGAGAAGGTGAACGG - Intergenic
1055360605 9:75486008-75486030 GATGGAAAACAAAATGTGAAAGG + Intergenic
1056887560 9:90457823-90457845 CTAGGAAAACAGAAGTGAAAAGG - Intergenic
1057491710 9:95525303-95525325 CTTGGAATGCAGGAGGTGAAGGG + Intergenic
1057890308 9:98864888-98864910 CTTTGCAACCAGAAGCTGAAGGG + Intergenic
1058954686 9:109934684-109934706 CTTTCAAAACTGAAGCTGAAAGG - Intronic
1059391435 9:114001974-114001996 CCTGGAAAACAGAAGAGGAAAGG - Exonic
1059635478 9:116166213-116166235 CTTCCAAAACAGAAGGGGAAGGG + Intronic
1059873310 9:118602340-118602362 CTTGGAAAACAAAATGTCATAGG + Intergenic
1060540115 9:124423690-124423712 GTTGGAGAACAGAAGATGAGAGG + Intergenic
1061310809 9:129761069-129761091 CCTGGAAAACATGATGTGAAGGG + Intergenic
1062166901 9:135112489-135112511 CCTGGAAAATAGGAGATGAATGG + Intronic
1203570820 Un_KI270744v1:128954-128976 CCTGGAAAACGGAAGTAGAAAGG + Intergenic
1185716521 X:2347202-2347224 GGTGGAAAGCAAAAGGTGAAAGG + Intronic
1186688326 X:11948601-11948623 CTTGGAAAGGGGAAGGGGAAGGG + Intergenic
1187393983 X:18904215-18904237 AGTGGAAAACAGAAGGAGAAGGG + Intronic
1187502086 X:19847293-19847315 CATGTAAAACAGAAGCTGATGGG + Intronic
1187668397 X:21641902-21641924 GTGGGAGAACAGAAGGGGAAAGG + Intronic
1187855659 X:23634088-23634110 CTAGGACAACTGAAAGTGAAGGG + Intergenic
1188411962 X:29884209-29884231 CATGGAGAAAATAAGGTGAAAGG - Intronic
1188598513 X:31931264-31931286 GTTGTCAAGCAGAAGGTGAAAGG - Intronic
1190232068 X:48590031-48590053 CTTGGTAGATAGGAGGTGAATGG - Intronic
1192035161 X:67554988-67555010 CTAGGAAGAGATAAGGTGAAAGG + Intronic
1192161317 X:68790205-68790227 CTTGGAACACAGGACATGAAAGG + Intergenic
1192868704 X:75164257-75164279 GTTGGAAAGCAGAAGGTGAAAGG - Intergenic
1194403352 X:93464457-93464479 ATTGGAAGACAGAAGCTGTATGG - Intergenic
1194768933 X:97876944-97876966 CTAGGAAGACAGAAGATGAGTGG + Intergenic
1195732942 X:107983551-107983573 CTTGGAGAACAGAATGAGAGAGG + Intergenic
1195857326 X:109345322-109345344 CTTGGATAACAGATGAAGAATGG - Intergenic
1196654016 X:118198150-118198172 CTTGAAAAACAGGAGTTTAATGG - Intergenic
1197440112 X:126477130-126477152 CTGGAGAAAGAGAAGGTGAAGGG + Intergenic
1199685334 X:150260271-150260293 CTTTTAAAAGAGAAGGTAAAAGG + Intergenic
1199763134 X:150920764-150920786 CCTAGAAAACAGAAGGGCAAAGG - Intergenic
1201260027 Y:12149848-12149870 GTTGGGAAACAGAAGCTGGATGG + Intergenic
1201759426 Y:17520995-17521017 CTTGGAAGTCAGAAGTTGCAGGG - Intergenic
1201842128 Y:18384995-18385017 CTTGGAAGTCAGAAGTTGCAGGG + Intergenic
1201992336 Y:20041744-20041766 CTTGAAAAAGATTAGGTGAATGG - Intergenic
1202085087 Y:21128395-21128417 CTTGAAAAAAATTAGGTGAATGG - Intergenic