ID: 959943255

View in Genome Browser
Species Human (GRCh38)
Location 3:112101798-112101820
Sequence CTGAGAAAGGCGTAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 909
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 874}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959943255_959943269 27 Left 959943255 3:112101798-112101820 CCTCCCACCTACGCCTTTCTCAG 0: 1
1: 0
2: 2
3: 32
4: 874
Right 959943269 3:112101848-112101870 ACCAGCTGGTGAGGCTGTTGTGG 0: 1
1: 0
2: 2
3: 34
4: 381
959943255_959943265 4 Left 959943255 3:112101798-112101820 CCTCCCACCTACGCCTTTCTCAG 0: 1
1: 0
2: 2
3: 32
4: 874
Right 959943265 3:112101825-112101847 AGAGAGGTAGTCTCCTGTGTGGG 0: 1
1: 0
2: 0
3: 18
4: 135
959943255_959943264 3 Left 959943255 3:112101798-112101820 CCTCCCACCTACGCCTTTCTCAG 0: 1
1: 0
2: 2
3: 32
4: 874
Right 959943264 3:112101824-112101846 CAGAGAGGTAGTCTCCTGTGTGG 0: 1
1: 1
2: 0
3: 7
4: 167
959943255_959943268 18 Left 959943255 3:112101798-112101820 CCTCCCACCTACGCCTTTCTCAG 0: 1
1: 0
2: 2
3: 32
4: 874
Right 959943268 3:112101839-112101861 CTGTGTGGGACCAGCTGGTGAGG 0: 1
1: 0
2: 1
3: 24
4: 251
959943255_959943266 13 Left 959943255 3:112101798-112101820 CCTCCCACCTACGCCTTTCTCAG 0: 1
1: 0
2: 2
3: 32
4: 874
Right 959943266 3:112101834-112101856 GTCTCCTGTGTGGGACCAGCTGG 0: 1
1: 0
2: 0
3: 10
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959943255 Original CRISPR CTGAGAAAGGCGTAGGTGGG AGG (reversed) Intronic
900901806 1:5522023-5522045 CTGTGGGAGGCCTAGGTGGGTGG - Intergenic
900975220 1:6012340-6012362 GTGATGAAGGCGGAGGTGGGTGG + Intronic
900975257 1:6012483-6012505 GTGATGAAGGCGGAGGTGGGTGG + Intronic
901073512 1:6536582-6536604 CTGTGGGAGGCTTAGGTGGGAGG + Intronic
901486265 1:9564641-9564663 CTTAGTAAGGCCAAGGTGGGTGG + Intronic
901496462 1:9625312-9625334 CTTTGGAAGGCTTAGGTGGGAGG - Intergenic
901509089 1:9706245-9706267 CTTAGAGAGGCCGAGGTGGGAGG + Intronic
901778487 1:11576803-11576825 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
901864026 1:12092285-12092307 CTCAGAAAGGCTGAGGTGGGAGG - Intronic
902864951 1:19271837-19271859 CTGAGAGAGGCCCAGGAGGGTGG + Intergenic
902906032 1:19558002-19558024 CTAAGGAAGGCTGAGGTGGGAGG - Intergenic
903143887 1:21357416-21357438 GTGTGAAAGGCTGAGGTGGGAGG - Intergenic
903495321 1:23762568-23762590 ATGTGAAAGGCTGAGGTGGGAGG + Intergenic
903699875 1:25239192-25239214 CTTTGTAAGGCCTAGGTGGGCGG + Intergenic
903765953 1:25734370-25734392 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
903893180 1:26583830-26583852 CTGAGAAAAGCTGAGGTGGGAGG + Intergenic
904036236 1:27560522-27560544 CAGAGAAAGGCAGAGGTGGGAGG - Intronic
904064867 1:27741635-27741657 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
905073238 1:35246463-35246485 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
905153411 1:35951630-35951652 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
905790585 1:40787143-40787165 CTGTGAGAGGCTGAGGTGGGAGG + Intronic
906053296 1:42892881-42892903 CTGTGGAAGGCCGAGGTGGGCGG + Intergenic
906561222 1:46758465-46758487 CTGAGGAATGCATTGGTGGGAGG + Intronic
906561322 1:46759499-46759521 CTCAGGAAGGCTGAGGTGGGAGG + Intronic
906674730 1:47685092-47685114 TTGTAAAAGGAGTAGGTGGGAGG + Intergenic
907479386 1:54734313-54734335 CTTTGAAAGGCGGAGGTGAGTGG - Intronic
907496447 1:54848370-54848392 GTGAGAAAGGTGTTTGTGGGAGG - Intergenic
907672527 1:56489362-56489384 CTTAGAGAGGCTGAGGTGGGTGG + Intergenic
907717126 1:56936834-56936856 CTGTGAGAGGCCAAGGTGGGTGG - Intronic
908108997 1:60876149-60876171 CTCAGAGAGGCTGAGGTGGGAGG - Intronic
908227215 1:62068036-62068058 CTGTGTAAGGCCGAGGTGGGTGG - Intronic
908279185 1:62512652-62512674 CTGTGAGAGGCCAAGGTGGGAGG + Intronic
909551706 1:76905219-76905241 CTGAGAAAGGATGAGGTGGCGGG + Intronic
909643073 1:77888466-77888488 GTGATAACGGCGGAGGTGGGGGG + Intergenic
909663656 1:78110617-78110639 CTGAGAGTTGCCTAGGTGGGAGG + Intronic
910413273 1:86968647-86968669 CTTAGGAAGGCGGAGGTAGGAGG - Intronic
910473139 1:87576919-87576941 CTTAGAGAGGCCGAGGTGGGCGG - Intergenic
910741672 1:90525863-90525885 CTGGGAATGGTGTAGGTGTGGGG + Intergenic
910936641 1:92488350-92488372 CGCAGAAAGGAGCAGGTGGGAGG + Intergenic
910946991 1:92604104-92604126 CTGTGGAAGGCAGAGGTGGGCGG + Intronic
911031757 1:93496360-93496382 AGGTGAAAGGCGGAGGTGGGAGG - Intronic
911047774 1:93642773-93642795 AAGAGAGAGGCTTAGGTGGGTGG + Intronic
911210479 1:95133630-95133652 CTGAGAATGGGGTAGATGGATGG + Intronic
911476070 1:98373944-98373966 CTGAGAAATGCGTTGTTAGGTGG + Intergenic
911828863 1:102524773-102524795 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
911887092 1:103316609-103316631 CTTTGAGAGGCCTAGGTGGGAGG - Intergenic
912437214 1:109670078-109670100 TTGGGAAGGGCGGAGGTGGGGGG + Intronic
912580464 1:110716705-110716727 CTGAGAAAGTCCTAGGTGTCAGG + Intergenic
912788745 1:112630149-112630171 ATTAGAAAGGCTGAGGTGGGAGG - Intronic
912971566 1:114288686-114288708 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
913182049 1:116331557-116331579 CTTAGAAAGGCGTTGGTAGAAGG + Intergenic
915478248 1:156167119-156167141 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
915732211 1:158061731-158061753 CTGAGACAGGCTCATGTGGGAGG + Intronic
915820410 1:159017229-159017251 CTGAGAAAGGCTATGGTGGTGGG + Intronic
915822582 1:159041091-159041113 CTGAAAAAGTGGTAGGTGAGAGG - Intronic
916702688 1:167314531-167314553 CTTAGGAAGGCTGAGGTGGGAGG + Intronic
916776871 1:167975794-167975816 CTGTGAGAGGCCAAGGTGGGAGG - Intronic
917091491 1:171358002-171358024 CTCAGAAAGGCAGAGGAGGGAGG - Intergenic
917102264 1:171458543-171458565 CTGTGAAAGTCCAAGGTGGGAGG + Intergenic
917106489 1:171497710-171497732 CTTTGAAAGGCGAAGGTGGGAGG - Intronic
917124071 1:171670521-171670543 CTGGGAACGCCGAAGGTGGGAGG + Intergenic
917428837 1:174944025-174944047 CTATGGAAGGCTTAGGTGGGCGG + Intronic
917865859 1:179194675-179194697 CTGAGAGTGGCTTAGCTGGGTGG - Intronic
917992623 1:180397807-180397829 CTTTGAAAGGCCGAGGTGGGTGG + Intronic
918032485 1:180828951-180828973 CTTTGAGAGGCGGAGGTGGGAGG + Intronic
918368621 1:183836510-183836532 CTTTGGAAGGCCTAGGTGGGTGG - Intronic
918579949 1:186114500-186114522 CTGTGGAAGGCTGAGGTGGGCGG - Intronic
919676880 1:200392796-200392818 CTGGTAAAGGCGGAGGAGGGAGG - Intergenic
919710615 1:200723878-200723900 CTTTGAGAGGCCTAGGTGGGAGG - Intergenic
920257470 1:204665381-204665403 CTTTGGAAGGCGGAGGTGGGAGG - Intronic
920975276 1:210780042-210780064 TTGAGAAAGCTGAAGGTGGGTGG + Intronic
921057498 1:211554690-211554712 CTGAAAGAGGCTGAGGTGGGAGG + Intergenic
921201825 1:212814061-212814083 CTTAGGAAGGCCGAGGTGGGAGG - Intronic
921204619 1:212837691-212837713 CTTTGGAAGGCCTAGGTGGGAGG + Intronic
921448845 1:215278959-215278981 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
922224376 1:223632611-223632633 CTTAGAGAGGCCAAGGTGGGAGG - Intronic
922444923 1:225689102-225689124 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
922466532 1:225848744-225848766 ATGGGAAAGGCGTGGGTGGTTGG - Intronic
922509817 1:226155172-226155194 CTTTGAGAGGCGGAGGTGGGTGG + Intronic
923095021 1:230768353-230768375 CTGAGAAACGGGTGGGAGGGAGG - Intronic
923785975 1:237070137-237070159 CTTTGAGAGGCCTAGGTGGGAGG - Intronic
923801504 1:237214162-237214184 CTTTGGAAGGCCTAGGTGGGTGG - Intronic
924335590 1:242983904-242983926 GTGAGAATGGCTTAGCTGGGTGG - Intergenic
924532325 1:244903930-244903952 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
1062997259 10:1878495-1878517 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
1063488114 10:6438839-6438861 CTTTGAAAGGCTAAGGTGGGAGG - Intronic
1063641913 10:7838623-7838645 CTTTGAGAGGCCTAGGTGGGTGG - Intronic
1064080336 10:12303003-12303025 CCTAGAAAGGCTGAGGTGGGAGG + Intergenic
1064430537 10:15266620-15266642 CTGTGGAAGGCTGAGGTGGGCGG + Intronic
1064469692 10:15623440-15623462 CTTTGAAAGGCTGAGGTGGGTGG + Intronic
1064479009 10:15720953-15720975 CTGTGGGAGGCTTAGGTGGGAGG - Intergenic
1064539880 10:16394669-16394691 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
1064598129 10:16966690-16966712 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1064642657 10:17430047-17430069 CTCAGAAAGGGGAAGATGGGAGG - Intronic
1064734769 10:18370541-18370563 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1065262133 10:23934858-23934880 CTGTGGGAGGCCTAGGTGGGCGG - Intronic
1065357149 10:24853366-24853388 CTTTGAGAGGCTTAGGTGGGTGG + Intronic
1065399202 10:25277192-25277214 CTTGGAAAGGCTGAGGTGGGAGG - Intronic
1065491088 10:26282184-26282206 CTTTGAAAGGCTGAGGTGGGCGG - Intronic
1065611537 10:27476001-27476023 CTGAGGCAGGCCCAGGTGGGTGG + Intergenic
1065722450 10:28640085-28640107 CTTTGGAAGGCCTAGGTGGGTGG - Intergenic
1065834114 10:29641325-29641347 CTTTGGAAGGCGGAGGTGGGAGG + Intronic
1065930076 10:30471577-30471599 CTTTGAAAGGCTGAGGTGGGCGG - Intergenic
1066000666 10:31101872-31101894 CTTTGAAAGGCCGAGGTGGGCGG - Intergenic
1066570911 10:36770633-36770655 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
1066972764 10:42329347-42329369 CTGTGGGAGGCGGAGGTGGGGGG - Intergenic
1067112585 10:43410585-43410607 CTCTGGGAGGCGTAGGTGGGCGG - Intergenic
1067556674 10:47277892-47277914 CAGAGAGAGGGGTAGGGGGGTGG + Intergenic
1068030920 10:51703893-51703915 CTTTGGAAGGCGGAGGTGGGTGG + Intronic
1068696473 10:59972890-59972912 CTGTGGAAGGCCGAGGTGGGCGG - Intergenic
1069384283 10:67870339-67870361 TTGGGAAAGGCTGAGGTGGGTGG + Intergenic
1069514795 10:69069072-69069094 CTTTGAAAGGCCGAGGTGGGTGG - Intergenic
1069563794 10:69450172-69450194 CTGAGAAAAGGCCAGGTGGGAGG + Intergenic
1069587432 10:69617647-69617669 CTTTGGAAGGCCTAGGTGGGTGG - Intergenic
1070130259 10:73651009-73651031 CTGAGAAAGGCGGTGTTGGCTGG + Intronic
1071529656 10:86379306-86379328 CTTTGAAAGGCCGAGGTGGGTGG - Intergenic
1072626082 10:97112935-97112957 CTTTGAAAGGCCGAGGTGGGAGG - Intronic
1072628054 10:97126969-97126991 CTGAGAATGGCGTAGATGGGAGG - Intronic
1073255936 10:102151367-102151389 CTTTGGAAGGCCTAGGTGGGAGG - Intergenic
1073273745 10:102289864-102289886 TTGAGAGAGGCCTAGGCGGGAGG + Intronic
1073557693 10:104468455-104468477 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1074131778 10:110585530-110585552 CTTAGGAAGGCTGAGGTGGGTGG - Intronic
1074855840 10:117472861-117472883 CTCAGCAAGGGGTAGGTGGAGGG + Intergenic
1075061129 10:119257478-119257500 CTTTGGAAGGCGGAGGTGGGTGG + Intronic
1075069203 10:119309379-119309401 CTCAGTAAGGCCTTGGTGGGAGG + Intronic
1075071172 10:119320823-119320845 CTGAGCACGGGGGAGGTGGGAGG + Intronic
1075487833 10:122840405-122840427 CTGGGACAGGCGTAAGAGGGGGG + Intronic
1075499562 10:122960512-122960534 CTGTGGAAGGCCCAGGTGGGTGG - Intronic
1075708158 10:124515043-124515065 CTGTGGAAGGCTGAGGTGGGAGG - Intronic
1080013052 11:27477400-27477422 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1080823120 11:35825856-35825878 CTGAGAGGGGTGGAGGTGGGTGG - Intergenic
1081728972 11:45355264-45355286 CTGAGAAAGGAGAGGGAGGGGGG + Intergenic
1081814239 11:45929643-45929665 CTGGGGAAGGGGTAGGGGGGTGG + Intronic
1081903227 11:46647678-46647700 CTTGGAAAGGCTGAGGTGGGAGG - Intronic
1083307945 11:61770522-61770544 CTGAGTAAGACGTGGGTGGCTGG + Exonic
1083468780 11:62867722-62867744 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
1083644277 11:64163712-64163734 CTGAGAGAAGCTTAGCTGGGTGG - Intronic
1084341726 11:68508371-68508393 CTGTGAGAGGTGGAGGTGGGTGG - Intronic
1084390953 11:68876477-68876499 CTTTGAGAGGCGGAGGTGGGAGG + Intergenic
1085494908 11:76960165-76960187 CTTTGAGAGGCGGAGGTGGGTGG + Intronic
1087070022 11:94069362-94069384 CTTTGAAAGGCTAAGGTGGGAGG - Intronic
1087088782 11:94246515-94246537 CTGAGAAATGCATTGTTGGGTGG + Intergenic
1087277137 11:96171849-96171871 CTGAGAATGGAGAAGGTGGCAGG - Intronic
1088267104 11:107998224-107998246 CTCAGGAAGGCTGAGGTGGGAGG + Intergenic
1088297101 11:108311216-108311238 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
1088481935 11:110302685-110302707 CTTTGAAAGGCTGAGGTGGGCGG + Intergenic
1088571946 11:111231049-111231071 CTTTGAAAGGCTGAGGTGGGCGG - Intergenic
1088687702 11:112298622-112298644 CTGAGAGAGGCCGAGGTGGCTGG - Intergenic
1089664632 11:120010345-120010367 TTTAGAAAGGCAGAGGTGGGGGG + Intergenic
1089705348 11:120273770-120273792 CTTAGGGAGGCCTAGGTGGGTGG + Intronic
1090019592 11:123115882-123115904 CTGAGCATGGCTTAGCTGGGTGG + Intronic
1090456967 11:126858370-126858392 CTGAGAAGGGTGTGTGTGGGAGG + Intronic
1090602034 11:128382624-128382646 CTTTGAGAGGCCTAGGTGGGAGG - Intergenic
1091536873 12:1418955-1418977 CTTTGGGAGGCGTAGGTGGGAGG - Intronic
1091575319 12:1728351-1728373 CTTTGAAAGGCTGAGGTGGGCGG - Intronic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1091774278 12:3174308-3174330 CTTTGGAAGGCTTAGGTGGGAGG - Intronic
1091957310 12:4657437-4657459 CTTAGTAAGGAGTAGTTGGGTGG + Intronic
1092186443 12:6483108-6483130 CTGTGAGAGGCAGAGGTGGGCGG + Intergenic
1092187293 12:6490072-6490094 CTTTGGAAGGCCTAGGTGGGCGG - Intergenic
1092317677 12:7436526-7436548 CTTTGAAAGGCAGAGGTGGGAGG + Intronic
1092809960 12:12263597-12263619 CTCCGAGAGGCGGAGGTGGGAGG + Intronic
1092988859 12:13875283-13875305 CTGTGAGAGGCCAAGGTGGGTGG + Intronic
1093178086 12:15935821-15935843 TTGAGAATGGCTTAGCTGGGTGG + Intronic
1094188766 12:27675083-27675105 CTTTGAAAGGCAGAGGTGGGAGG - Intronic
1094190606 12:27694255-27694277 CTTTGAAAGGCTGAGGTGGGAGG - Exonic
1094582163 12:31743591-31743613 CTTTGAGAGGCGGAGGTGGGCGG + Intergenic
1094639815 12:32262898-32262920 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
1094747720 12:33365217-33365239 CTTTGAAAGGCTGAGGTGGGCGG + Intergenic
1095303929 12:40618987-40619009 CTGAGACAGGAGTAGGTTAGAGG + Intergenic
1095363679 12:41375196-41375218 CTGAGAACAGCTTAGCTGGGTGG - Intronic
1095446076 12:42283741-42283763 CTGAGAGAGGCCAAGGTAGGAGG - Intronic
1095447197 12:42294143-42294165 CTCTGAAAGGCCGAGGTGGGAGG + Intronic
1095821634 12:46485150-46485172 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
1096134804 12:49190574-49190596 CTAAGAAGGGCGTGGGAGGGAGG + Intronic
1096592482 12:52670157-52670179 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1096957274 12:55539489-55539511 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
1096969627 12:55655357-55655379 CTTTGAGAGGCCTAGGTGGGAGG + Intergenic
1096983480 12:55742524-55742546 CTGGGAAAGGGGTGGGGGGGGGG - Intergenic
1096989580 12:55788688-55788710 ACGAGAAAGGCTGAGGTGGGAGG + Intronic
1097292547 12:57930513-57930535 CTTCGAAAGGCCAAGGTGGGTGG - Intergenic
1097745173 12:63293694-63293716 CTTTGAGAGGCGGAGGTGGGTGG - Intergenic
1098103893 12:67049066-67049088 CTGTGTAAGGCTGAGGTGGGAGG - Intergenic
1098114090 12:67156160-67156182 CTTTGGAAGGCTTAGGTGGGAGG - Intergenic
1098336847 12:69413167-69413189 CTGTGAGAGGCCAAGGTGGGAGG + Intergenic
1098467154 12:70800649-70800671 CTGTGGGAGGCGGAGGTGGGTGG + Intronic
1100245359 12:92751906-92751928 ATGTGAAAGGCTGAGGTGGGAGG + Intronic
1100277360 12:93083219-93083241 CTTTGGAAGGTGTAGGTGGGTGG - Intergenic
1100577998 12:95910616-95910638 CTTGGAAAGGCCAAGGTGGGAGG + Intronic
1101143228 12:101817510-101817532 CTTTGAGAGGCTTAGGTGGGTGG - Intronic
1101442487 12:104714044-104714066 CTGAGCTATGCTTAGGTGGGAGG - Intronic
1101815485 12:108143055-108143077 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1101863494 12:108501809-108501831 CTGTGAGAGGCCAAGGTGGGAGG + Intergenic
1101879511 12:108616854-108616876 CTGTGGAAGGCCAAGGTGGGCGG - Intergenic
1102169140 12:110828891-110828913 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
1102666669 12:114580072-114580094 CTGTGGGAGGCGAAGGTGGGGGG + Intergenic
1103444478 12:120985323-120985345 CTTTGAAAGGCCGAGGTGGGAGG - Intronic
1103523414 12:121551264-121551286 CTTAGAAAAGCAGAGGTGGGAGG + Intronic
1103629228 12:122246249-122246271 CTTTGAGAGGCTTAGGTGGGAGG + Intronic
1103950231 12:124546654-124546676 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1103984712 12:124759600-124759622 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1104023054 12:125006451-125006473 CTAAGAAAGGTGTAGGTCAGAGG - Intronic
1104839656 12:131816867-131816889 CTTAGGAAGGCCCAGGTGGGAGG + Intergenic
1105046409 12:133007541-133007563 GTGAGAAAGAGGAAGGTGGGAGG + Intronic
1105318446 13:19291030-19291052 CAGAGAAATGGGTACGTGGGAGG + Intergenic
1105363975 13:19747438-19747460 CTTGGGAAGGCTTAGGTGGGAGG - Intronic
1105372199 13:19811975-19811997 CTTTGAAAGGCCGAGGTGGGCGG + Intergenic
1105784853 13:23738556-23738578 CTGAGGAAGGCGGAGGTGGAAGG - Intronic
1105935470 13:25094603-25094625 CTTTGGCAGGCGTAGGTGGGCGG + Intergenic
1106632554 13:31491430-31491452 CTTTGAAAGGCCGAGGTGGGTGG + Intergenic
1107049371 13:36031049-36031071 CTGGGAAAAGCGTAGGAGTGAGG - Intronic
1107247320 13:38311420-38311442 CTTTGAGAGGCGGAGGTGGGCGG + Intergenic
1107254713 13:38410581-38410603 CTTTGAAAGGCCGAGGTGGGCGG - Intergenic
1108010702 13:46005848-46005870 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
1108371851 13:49777752-49777774 CTTTGAGAGGCCTAGGTGGGAGG - Intronic
1108621727 13:52191517-52191539 CTTAGGGAGGCCTAGGTGGGTGG - Intergenic
1108922333 13:55691709-55691731 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
1108931866 13:55835169-55835191 CTTTGAGAGGCCTAGGTGGGTGG + Intergenic
1109217918 13:59611023-59611045 CTTAGGAAGGCTGAGGTGGGAGG - Intergenic
1109981399 13:69913089-69913111 GGGAGAAAGGCATAGCTGGGTGG - Intronic
1110211480 13:72978949-72978971 CTCAAAAAGGCCAAGGTGGGAGG + Intronic
1110267721 13:73557476-73557498 CAGAGAAAGGCTGAGGCGGGGGG - Intergenic
1110508242 13:76315276-76315298 CTTTGAAAGGCTTAGGCGGGTGG - Intergenic
1112009784 13:95284293-95284315 CTCAGGAAGGCTGAGGTGGGAGG - Intronic
1112462174 13:99612766-99612788 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
1113406378 13:110044659-110044681 CTGGGAGAGGTGGAGGTGGGGGG - Intergenic
1113778630 13:112963170-112963192 CTGAGAGTGGTGGAGGTGGGTGG - Intronic
1114259280 14:21025528-21025550 TTAAGAAAGGAGGAGGTGGGCGG + Intronic
1114315371 14:21505057-21505079 CTGTGAGAGGCCAAGGTGGGAGG + Intronic
1114959525 14:27867599-27867621 CTAAGAATGGAGTAGGTGAGAGG - Intergenic
1115319856 14:32068188-32068210 CTTCGAAAGGCTGAGGTGGGAGG + Intergenic
1115387361 14:32813392-32813414 CTGGGAAAGGGGTTGGGGGGGGG - Intronic
1115475554 14:33809901-33809923 TTGAGAAAGATGGAGGTGGGGGG + Intergenic
1115986440 14:39107176-39107198 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1116019013 14:39439492-39439514 CTATGAAAGGCTAAGGTGGGAGG - Intergenic
1116199677 14:41775330-41775352 CTTTGGAAGGCGGAGGTGGGCGG - Intronic
1116456727 14:45128091-45128113 CTTTGGAAGGCCTAGGTGGGCGG + Intronic
1117063953 14:51989886-51989908 CCGAGACAGGAGTAGGTGAGAGG - Intronic
1117811006 14:59546994-59547016 CTTTGAGAGGCGGAGGTGGGAGG + Intronic
1118008108 14:61583450-61583472 CTTTGGAAGGCGGAGGTGGGAGG - Intronic
1118027318 14:61782664-61782686 CTTTGAGAGGCCTAGGTGGGCGG + Intronic
1118191857 14:63588079-63588101 CTTTGGAAGGCCTAGGTGGGTGG + Intergenic
1118379288 14:65204651-65204673 CTGAGAAAGGTTCAGCTGGGTGG + Intergenic
1118591996 14:67408969-67408991 CTTAGAGAGGCCAAGGTGGGAGG + Intronic
1119185872 14:72642187-72642209 CTGGGAATGGCTTGGGTGGGTGG - Intronic
1119667358 14:76494548-76494570 CTGTGAGAGGCTGAGGTGGGTGG - Intronic
1120112419 14:80573166-80573188 CTTTGAGAGGCCTAGGTGGGTGG - Intronic
1120207773 14:81604554-81604576 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1121505249 14:94472246-94472268 CTGAGCAAGGGGTAGGTGAGTGG - Intronic
1121650762 14:95556205-95556227 CTGAGAAACGCTCAGGTAGGTGG - Intergenic
1122218176 14:100218139-100218161 CTGAGAAGGGCAGAAGTGGGGGG - Intergenic
1122987000 14:105217109-105217131 CTGAGGAAGGAGGATGTGGGTGG - Intronic
1123106609 14:105844771-105844793 CTGAGGAATGAGCAGGTGGGTGG + Intergenic
1123162626 14:106293943-106293965 CTGAGGAAGGCACAGGTGTGGGG + Intergenic
1123634856 15:22293977-22293999 CTTTGAGAGGCCTAGGTGGGTGG - Intergenic
1124041812 15:26112347-26112369 TTGAGAGAGGCCGAGGTGGGAGG - Intergenic
1125750788 15:42026727-42026749 CTGTGAGAGGCCGAGGTGGGAGG + Intronic
1126151809 15:45529983-45530005 CTGAGAATGGCTTAGCTGGGTGG - Intergenic
1126479676 15:49104173-49104195 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
1126562265 15:50056967-50056989 CTGTGAGAGGCCGAGGTGGGAGG - Intronic
1126964685 15:54038374-54038396 CTTTGAAAGGCAGAGGTGGGCGG - Intronic
1127441116 15:59009200-59009222 CTTTGAAAGGCCAAGGTGGGCGG - Intronic
1127604449 15:60572287-60572309 CTGAGAAATGTGTATGTTGGGGG + Intronic
1127768000 15:62206857-62206879 CTTTGAAAGGCCGAGGTGGGAGG - Intergenic
1128434804 15:67636167-67636189 CTTTGAAAGGCTGAGGTGGGCGG + Intronic
1128465149 15:67904327-67904349 CTTTGAGAGGCCTAGGTGGGTGG - Intergenic
1128755762 15:70182607-70182629 GAGAGAAAGGGGTGGGTGGGTGG + Intergenic
1129315089 15:74737759-74737781 CTTTGGAAGGCGTAGGAGGGCGG + Intergenic
1129474341 15:75774859-75774881 CTTTGGGAGGCGTAGGTGGGTGG - Intergenic
1129731664 15:77935868-77935890 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1131109730 15:89757819-89757841 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
1131601429 15:93853180-93853202 CTTAGGAAGGCTGAGGTGGGAGG + Intergenic
1131835032 15:96381799-96381821 CTGAGAGTGACGTAGCTGGGTGG - Intergenic
1132392156 15:101447114-101447136 CCTAGAAGGGCTTAGGTGGGTGG - Intronic
1133845847 16:9453202-9453224 CTTTGAGAGGCGGAGGTGGGAGG + Intergenic
1133934160 16:10255443-10255465 CTTTGGAAGGCGGAGGTGGGAGG - Intergenic
1133963582 16:10515552-10515574 CTTTGAAAGGCGGAGGCGGGAGG + Intergenic
1134009984 16:10844716-10844738 CTTTGAAAGGCGGAGGTGGGAGG - Intergenic
1134060058 16:11194027-11194049 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1134259126 16:12636754-12636776 CTTTGAAAGGCCGAGGTGGGAGG - Intergenic
1134465815 16:14476584-14476606 CTTTGAGAGGCGGAGGTGGGAGG + Intronic
1134601200 16:15535104-15535126 CTTTGAGAGGCTTAGGTGGGAGG + Intronic
1134630735 16:15753960-15753982 CTGTGGAAGGCCAAGGTGGGTGG + Intronic
1134648337 16:15888689-15888711 CTGAGAGGGGCGGAAGTGGGCGG - Intergenic
1134694623 16:16214396-16214418 CAGAGACAGGCATAGGTAGGTGG + Exonic
1134977213 16:18580241-18580263 CAGAGACAGGCATAGGTAGGTGG - Intergenic
1135255452 16:20938146-20938168 CTTTGAAAGGCAGAGGTGGGTGG + Intronic
1135345213 16:21683447-21683469 CTTTGAGAGGCATAGGTGGGAGG + Intronic
1135548909 16:23383620-23383642 CTGAGGGAGGCTGAGGTGGGAGG - Intergenic
1135768166 16:25195887-25195909 CTGTGAGAGGCCGAGGTGGGCGG + Intergenic
1135899629 16:26444944-26444966 CTGAGAAAGCCTTCGGTGGGAGG - Intergenic
1135923461 16:26671916-26671938 CTGAGAAAGGTGGTGGGGGGGGG - Intergenic
1136126685 16:28188183-28188205 CTTTGAGAGGCATAGGTGGGAGG - Intronic
1136402019 16:30024374-30024396 CTGGGAAGGGAGGAGGTGGGGGG - Exonic
1136787791 16:32945993-32946015 CTGAGAAGGACTTAGGTTGGAGG + Intergenic
1136881992 16:33907796-33907818 CTGAGAAGGACTTAGGTTGGAGG - Intergenic
1137637603 16:50000541-50000563 CTTTGGAAGGCCTAGGTGGGAGG - Intergenic
1137645362 16:50068381-50068403 CTTTGAGAGGCCTAGGTGGGAGG - Intronic
1137774383 16:51043235-51043257 TTGAGACAGGGGAAGGTGGGTGG - Intergenic
1138295886 16:55884833-55884855 CTTTGGAAGGCCTAGGTGGGCGG - Intronic
1138340496 16:56286015-56286037 CTGAGAAAGGGTTAGGTTTGAGG + Intronic
1138423169 16:56912986-56913008 GTGAGCAAGGCGAGGGTGGGAGG + Intronic
1139226321 16:65235961-65235983 CTGAGAAAGGGGTGGGGAGGAGG - Intergenic
1139716781 16:68819953-68819975 CTTAGAGAGGCTGAGGTGGGAGG + Intronic
1140381598 16:74493318-74493340 ATGAGACAGGGGTAAGTGGGTGG + Intronic
1141449826 16:84091240-84091262 CTTTGAAAGGCTGAGGTGGGTGG + Intronic
1141520052 16:84572567-84572589 ATTAGGAAGGCGGAGGTGGGAGG - Intronic
1141838633 16:86559869-86559891 AGGAGAAAGGGGGAGGTGGGGGG + Intergenic
1141957184 16:87380509-87380531 CTGTGGAAGGCTGAGGTGGGAGG - Intronic
1142378123 16:89717202-89717224 ATTAGAAATGCGTGGGTGGGGGG - Intronic
1142411659 16:89920141-89920163 CTGTGGAAGGCGTAGATGAGGGG - Exonic
1203090020 16_KI270728v1_random:1207650-1207672 CTGAGAAGGACTTAGGTTGGAGG + Intergenic
1142523623 17:522144-522166 CTGAGGAAGACTGAGGTGGGTGG + Intronic
1142594706 17:1023779-1023801 CTGTGGGAGGCCTAGGTGGGAGG + Intronic
1142791681 17:2271468-2271490 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
1142842782 17:2646986-2647008 CTCAGAGAGGCCGAGGTGGGTGG + Intronic
1143173950 17:4945906-4945928 CTGGGAACGCCGAAGGTGGGAGG + Exonic
1143221226 17:5263799-5263821 CTCTGAAAGGCCCAGGTGGGTGG + Intergenic
1143571498 17:7761726-7761748 CTGAGGGAGGCTAAGGTGGGTGG - Intronic
1143895246 17:10130837-10130859 CTAAGGAAGGCGTGGTTGGGGGG + Intronic
1144521094 17:15952759-15952781 CCGAGGAAGGTGCAGGTGGGAGG - Intronic
1144758860 17:17695763-17695785 CTTAGGGAGGCGAAGGTGGGAGG - Intronic
1145056239 17:19705840-19705862 CTTTGAAAGGCCGAGGTGGGTGG - Intronic
1145115661 17:20208906-20208928 CCCAGAAAGGCTGAGGTGGGAGG - Intronic
1145189679 17:20828082-20828104 CTTTGGGAGGCGTAGGTGGGTGG + Intergenic
1145792578 17:27637216-27637238 CTGAGAGAGATGAAGGTGGGGGG + Intronic
1146168793 17:30616282-30616304 CAGAGAATGGGGTGGGTGGGTGG - Intergenic
1146170769 17:30631166-30631188 CAGAGAATGGGGTGGGTGGGTGG + Intergenic
1146344216 17:32047185-32047207 CAGAGAATGGGGTGGGTGGGTGG + Intronic
1146394235 17:32450202-32450224 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1146519910 17:33518346-33518368 CTGAAAAAGGCTAAGGTTGGTGG + Intronic
1146775367 17:35609716-35609738 CTGAGGAAGGCCAAGGTGGGAGG - Intronic
1147001677 17:37367822-37367844 CTGTGAGAGGCCAAGGTGGGTGG + Intronic
1147037378 17:37691865-37691887 CTGACAAGGGGGCAGGTGGGTGG - Intronic
1147049300 17:37779140-37779162 CTTAGAGAGGCCGAGGTGGGAGG - Intergenic
1147148151 17:38498111-38498133 CTGAGAAGGACTTAGGTTGGAGG + Intronic
1147257256 17:39189119-39189141 CTTTGAAAGGCTAAGGTGGGTGG + Intronic
1147432370 17:40380228-40380250 CTTTGGAAGGCGGAGGTGGGAGG - Intergenic
1148534080 17:48423863-48423885 CTTTGAGAGGCGGAGGTGGGAGG - Intronic
1148579952 17:48736660-48736682 CTTAGGAAGGCCGAGGTGGGAGG + Intergenic
1148606405 17:48932501-48932523 CTTAGAGAGGCTAAGGTGGGTGG + Intronic
1148792820 17:50183292-50183314 CTTAAAAAGGAGTAGGCGGGAGG + Exonic
1149210816 17:54298241-54298263 CTTTGAGAGGCCTAGGTGGGTGG + Intergenic
1149244439 17:54688789-54688811 CTGAGTAAGACGTAGGTGCTGGG - Intergenic
1149582928 17:57763756-57763778 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1149678449 17:58487547-58487569 CTGAGAACGGCGGCGGTGGCGGG + Intronic
1149773623 17:59340656-59340678 CTTTGAAAGGCCGAGGTGGGCGG - Intronic
1150018597 17:61586881-61586903 CTTTGAGAGGCCTAGGTGGGAGG - Intergenic
1150139287 17:62714988-62715010 CTTTGAAAGGCCGAGGTGGGTGG - Intronic
1150362651 17:64550534-64550556 CTGTGGAAGGCCGAGGTGGGTGG + Intronic
1150719945 17:67605743-67605765 CTGATAACGGCGCAGGTGGCTGG - Intronic
1150781745 17:68128822-68128844 CAGAGAATGGGGTGGGTGGGTGG - Intergenic
1151196633 17:72436301-72436323 CTGTGGGAGGCTTAGGTGGGAGG - Intergenic
1151325192 17:73375488-73375510 CTTTGAAAGGCCGAGGTGGGTGG - Intronic
1151831126 17:76551895-76551917 CTGTGAAATGGGAAGGTGGGGGG + Intronic
1152980700 18:273496-273518 CTTTGAAAGGCTGAGGTGGGCGG - Intergenic
1153072090 18:1117112-1117134 CTGGGACAGGCCGAGGTGGGCGG - Intergenic
1153170577 18:2311519-2311541 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1153208949 18:2737475-2737497 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
1153412791 18:4812311-4812333 CTGAAAAAGTCTTAAGTGGGAGG + Intergenic
1153518926 18:5933710-5933732 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
1153819676 18:8822783-8822805 CTGTGAACGGGGAAGGTGGGAGG - Intronic
1154102497 18:11489206-11489228 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
1154132603 18:11750242-11750264 CTGAGAAAGGAGCAGGTAGAAGG + Intronic
1154506485 18:15045454-15045476 AGGAGAAAGACGTAGGTTGGAGG - Intergenic
1154965710 18:21354030-21354052 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1154991072 18:21599227-21599249 CTCAGGGAGGCGGAGGTGGGAGG + Intronic
1155115153 18:22757859-22757881 CTGCGAGAGGCTGAGGTGGGTGG + Intergenic
1155976141 18:32133793-32133815 CTGTGGAAGGCTGAGGTGGGCGG - Intronic
1156245944 18:35298261-35298283 CTCAGAAAGGCTGAGGTGGGAGG - Intergenic
1156475111 18:37401021-37401043 CTGAGAATAGAGTAGGTGTGGGG + Intronic
1157171386 18:45409633-45409655 CTGGGAAAGGGGTGGGTAGGAGG - Intronic
1157619333 18:49007061-49007083 CTGAGAGAGGAGTGGGTGGAAGG - Intergenic
1157648481 18:49302595-49302617 CTGTTGAAGGCGGAGGTGGGGGG + Intronic
1157730166 18:49997020-49997042 CTTAGAAAGGCCTAGGTGGGTGG + Intronic
1158267552 18:55677012-55677034 CTGAGAAATGTGGTGGTGGGGGG + Intergenic
1158823394 18:61187041-61187063 CTTTGGAAGGCGGAGGTGGGAGG + Intergenic
1159675745 18:71282831-71282853 CTCAGGAAGGCCGAGGTGGGTGG - Intergenic
1160753670 19:747189-747211 CAGAGAAAGGCACAGGTAGGAGG - Exonic
1160768315 19:818774-818796 CTTTGGAAGGCCTAGGTGGGCGG - Intronic
1161188306 19:2937998-2938020 CTTTGGAAGGCCTAGGTGGGTGG - Intronic
1161191756 19:2961267-2961289 CTGAAAAAGTCTTAGGTTGGGGG + Intergenic
1161262101 19:3343824-3343846 CTGGGACAGGGGTGGGTGGGTGG - Intergenic
1161330090 19:3682826-3682848 CTGGGAGCGGCGTAGCTGGGTGG - Intronic
1161437164 19:4270529-4270551 CTGAAAAAGGGGGAGGGGGGTGG + Intergenic
1161544874 19:4874346-4874368 CTTTGAGAGGCGGAGGTGGGAGG + Intergenic
1161555228 19:4937905-4937927 CTTGGAGAGGCGGAGGTGGGCGG + Intronic
1161819859 19:6523390-6523412 CTCAGAGAGGCTGAGGTGGGAGG - Intergenic
1161913363 19:7211308-7211330 CTTAGAGAGGCCAAGGTGGGAGG - Intronic
1162314326 19:9928559-9928581 CTGAGGGAGGCCAAGGTGGGTGG + Intronic
1163223574 19:15939141-15939163 CTGTGAGAGGCCGAGGTGGGTGG + Intergenic
1163282991 19:16328404-16328426 CTGAGAATGGGGAAGGTGAGGGG - Intergenic
1163450621 19:17375063-17375085 CTGTGAGAGGCCAAGGTGGGTGG - Intronic
1163454126 19:17396026-17396048 ATGGGAAAGGCGGGGGTGGGGGG - Intergenic
1163468752 19:17484923-17484945 CTGAAACAGGGGCAGGTGGGTGG + Intronic
1163913683 19:20219169-20219191 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1164009550 19:21188013-21188035 CTGAGATAGGCCAAGGAGGGTGG + Exonic
1164647293 19:29868686-29868708 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1164847860 19:31449749-31449771 CTGTGAGAGGCCAAGGTGGGTGG + Intergenic
1164982257 19:32623033-32623055 CTGTGAGAGGCTGAGGTGGGAGG - Intronic
1165263800 19:34643411-34643433 CTGGGAAGGGTGTGGGTGGGGGG + Intronic
1165530478 19:36396147-36396169 CTTTGAAAGGCAGAGGTGGGAGG - Intronic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1166189351 19:41165475-41165497 CTTTGTAAGGCGAAGGTGGGCGG + Intergenic
1166193009 19:41188212-41188234 CTGGGAAAGGCGTATGGGTGGGG + Intergenic
1166329506 19:42069975-42069997 AAGAGAAAGGCGGAGGAGGGTGG + Intronic
1166470926 19:43079094-43079116 CTGGGGAAGGCCTAGGTGTGAGG + Intronic
1166502201 19:43350074-43350096 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
1166507907 19:43383375-43383397 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
1166645242 19:44526631-44526653 CTTTGGAAGGCGGAGGTGGGTGG + Intronic
1166821121 19:45580857-45580879 CTTTGGAAGGCGGAGGTGGGTGG - Intronic
1166884294 19:45950402-45950424 CTTTGAAAGGCCGAGGTGGGTGG - Intronic
1167004246 19:46765268-46765290 CTTTGGGAGGCGTAGGTGGGAGG + Intronic
1167082847 19:47289065-47289087 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
1167310943 19:48737660-48737682 CTGAGCAGGGCCTATGTGGGTGG - Intronic
1167523266 19:49969527-49969549 CTGTGAAAGGAGAAGTTGGGAGG + Intergenic
1167793514 19:51694602-51694624 CTAAGAAATGGGTATGTGGGAGG + Intergenic
1167917932 19:52757238-52757260 CTTAGAAAGGCAAAGGCGGGCGG + Intergenic
1167925543 19:52818467-52818489 CTCTGAAAGGCCGAGGTGGGTGG + Intronic
1167929787 19:52854779-52854801 CTCTGAAAGGCCAAGGTGGGTGG + Intronic
1168486034 19:56762881-56762903 CTTTGGAAGGCCTAGGTGGGAGG - Intergenic
1168625810 19:57916847-57916869 CTTTGGAAGGCGGAGGTGGGCGG + Intergenic
926009437 2:9396518-9396540 CTCTGAAAGGCCAAGGTGGGAGG - Intronic
926186793 2:10696912-10696934 CTTTGAAAGGCCGAGGTGGGAGG + Intergenic
926646695 2:15297415-15297437 CTGAAAAAGGCCCTGGTGGGAGG + Intronic
927541132 2:23912251-23912273 CTTAGGAAGGCCAAGGTGGGAGG + Intronic
927773688 2:25885491-25885513 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
927902760 2:26833123-26833145 CTTAGAGAGGCTGAGGTGGGAGG + Intergenic
929091544 2:38222486-38222508 CTGTGAGAGGCCGAGGTGGGTGG + Intergenic
929752671 2:44732195-44732217 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
929766908 2:44851741-44851763 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
929860482 2:45672780-45672802 CTGTGAGAGGCTGAGGTGGGAGG + Intronic
930083824 2:47478038-47478060 CTTTGGAAGGCGGAGGTGGGAGG - Intronic
930616588 2:53600371-53600393 CTTTGAAAGGCTCAGGTGGGCGG - Intronic
931003593 2:57820636-57820658 CTGTGAGAGGCTGAGGTGGGAGG + Intergenic
931287769 2:60847090-60847112 GTCAGAAAGGTGTAGGTGGGTGG - Intergenic
932233991 2:70106503-70106525 CTTTGAAAGGCCAAGGTGGGCGG + Intergenic
932988925 2:76762714-76762736 CTTTGGAAGGCCTAGGTGGGAGG + Intronic
933407312 2:81877193-81877215 CTGAGAAAGGCATTGTTAGGGGG - Intergenic
933674783 2:85045001-85045023 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
933884482 2:86705396-86705418 CTGTGAGAGGCCGAGGTGGGTGG - Intronic
934668293 2:96189459-96189481 CTCAGAAAGGCCGAGGCGGGCGG + Intronic
934927425 2:98391344-98391366 CTGAGCAAGCAGCAGGTGGGCGG + Intronic
935296630 2:101655451-101655473 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
935302144 2:101702321-101702343 CTTTGAGAGGCGCAGGTGGGCGG + Intronic
935302799 2:101707942-101707964 CTTAGAGAGGCCGAGGTGGGCGG - Intronic
936021396 2:108997646-108997668 CTGTGAGAGGCCGAGGTGGGTGG + Intergenic
937666923 2:124498543-124498565 CTTAGAACGGCTGAGGTGGGAGG - Intronic
937930190 2:127198846-127198868 CTGAGAAATGCGTTGTTGGGTGG - Intronic
938359032 2:130673899-130673921 CAGGGAAAGGCAGAGGTGGGGGG + Intergenic
938823123 2:134978442-134978464 CTTAGGAAGGCCGAGGTGGGGGG - Intronic
938861488 2:135374161-135374183 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
939821946 2:146968575-146968597 CTGAAAAAGGGATTGGTGGGAGG - Intergenic
940062196 2:149584803-149584825 CTTAGGGAGGCGAAGGTGGGTGG + Intronic
940079907 2:149788861-149788883 CTTTGAGAGGCCTAGGTGGGCGG - Intergenic
940179765 2:150918923-150918945 CTTAGGAAGGCCAAGGTGGGTGG + Intergenic
940237816 2:151529771-151529793 CTTTGAAAGGCTGAGGTGGGCGG - Intronic
940313721 2:152305792-152305814 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
941318780 2:164028918-164028940 TTCAGAAAGGCTTAGCTGGGAGG + Intergenic
941438353 2:165500699-165500721 CTTTGAGAGGCCTAGGTGGGAGG - Intronic
942238804 2:173939979-173940001 CTCAGAGAGGCGGAGATGGGAGG - Intronic
942715020 2:178882126-178882148 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
943577428 2:189647153-189647175 GTGAGAAAGGCCTAGTTGGGAGG - Intergenic
944215658 2:197252648-197252670 GTGAGACAGGCTGAGGTGGGCGG - Intronic
944219095 2:197284640-197284662 CTCTGGAAGGCCTAGGTGGGTGG + Intronic
944239540 2:197472558-197472580 CTTCGCAAGGCCTAGGTGGGTGG + Intronic
944294507 2:198047423-198047445 CTTTGAAAGGCCAAGGTGGGCGG - Intronic
944355570 2:198783647-198783669 TGGAGAAAGGAATAGGTGGGGGG - Intergenic
945102651 2:206275400-206275422 CTGGGAAAGGCCTAGGTCTGGGG - Intronic
945619493 2:212115750-212115772 CTTTGGAAGGCCTAGGTGGGAGG - Intronic
945844594 2:214929232-214929254 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
946349975 2:219143955-219143977 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
946787981 2:223268169-223268191 CTGAGAACAGAGTAGGTGGTGGG - Intergenic
947664969 2:231899745-231899767 CTTTGAGAGGCCTAGGTGGGAGG - Intergenic
947784860 2:232807813-232807835 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
947897071 2:233685274-233685296 CTTTGAAAGGCGGAGGCGGGCGG - Intronic
948280874 2:236747198-236747220 CAGAGAAATGCTTAGGTGAGGGG - Intergenic
948449306 2:238059218-238059240 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
948543378 2:238705597-238705619 CTGTGGAAGGCCAAGGTGGGTGG - Intergenic
948665505 2:239532256-239532278 CTGTGAAAGGCCTTGGTGAGAGG - Intergenic
948926706 2:241103379-241103401 CTGTGAGAGGCTGAGGTGGGGGG + Intergenic
948983181 2:241505407-241505429 CTTAGACAGGAGTAGATGGGAGG - Intronic
1169077460 20:2770037-2770059 CTGGGTAGGGGGTAGGTGGGAGG - Intergenic
1169405931 20:5321257-5321279 CAGAGAGAGGCGGTGGTGGGAGG + Intergenic
1169461409 20:5798859-5798881 CTGAGGGAGGCTGAGGTGGGCGG - Intronic
1169485166 20:6024197-6024219 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
1169731396 20:8789132-8789154 CTTTGAAAGGCCTAGGTGGGAGG + Intronic
1170104287 20:12736958-12736980 CTGAGAAGGTCGGGGGTGGGGGG - Intergenic
1172086773 20:32391131-32391153 CTTTGAGAGGCATAGGTGGGAGG - Intronic
1172397413 20:34618536-34618558 CTTTGAAAGGCAAAGGTGGGAGG + Intronic
1172726467 20:37046854-37046876 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1172948616 20:38707308-38707330 CTTTGAAAGGCCAAGGTGGGCGG - Intergenic
1172976837 20:38912422-38912444 CTGAGGGAGGCTGAGGTGGGAGG + Intronic
1173196028 20:40913484-40913506 CTGAGAAAGTCGTCCCTGGGCGG + Intergenic
1173341625 20:42157587-42157609 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1173346393 20:42204674-42204696 CTGAGGGAGGGGTAGGTGGCAGG + Intronic
1173474906 20:43352088-43352110 AAGAGAAAGGGGGAGGTGGGAGG + Intergenic
1173856175 20:46251934-46251956 GTGAGAAAGGCGTAGGAGATTGG - Intronic
1175112818 20:56660779-56660801 CTTTGGAAGGCGGAGGTGGGAGG - Intergenic
1175506560 20:59489910-59489932 CTTCGAAAGGCCGAGGTGGGTGG + Intergenic
1177169813 21:17642584-17642606 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1177796302 21:25782072-25782094 CAGCGAAAGGCTGAGGTGGGAGG - Intergenic
1178039954 21:28629255-28629277 ATTAGAAAGGAGGAGGTGGGTGG + Intergenic
1178270880 21:31188815-31188837 CTGTGAGAGGCTGAGGTGGGAGG - Intronic
1178282918 21:31299262-31299284 CTGCGAAAGGCATAGGGGAGGGG - Intronic
1178565067 21:33676469-33676491 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
1178567524 21:33701547-33701569 CTTTGAGAGGCATAGGTGGGTGG + Intronic
1178576638 21:33798341-33798363 CTCTGAAAGGCCAAGGTGGGAGG - Intronic
1178886754 21:36490776-36490798 CAGAGAAAGGCCCAGGTGGGAGG - Intronic
1178889245 21:36507518-36507540 CTTCGAAAGGCCAAGGTGGGTGG + Intronic
1178983666 21:37285237-37285259 CTTAGAAAGGCTGAGGTGGGTGG + Intergenic
1178994651 21:37387722-37387744 CTGAGAAAAGGGTACATGGGAGG + Intronic
1178996502 21:37405510-37405532 CTGAGAAAGTAATAGGTGGGTGG - Intronic
1179396998 21:41049704-41049726 CTCAGAAAGGAGAGGGTGGGAGG - Intergenic
1179708225 21:43194668-43194690 CTGAGAAATGAGGAGGGGGGAGG - Intergenic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180636957 22:17269240-17269262 CTAGGAAAGGTGAAGGTGGGGGG + Intergenic
1180718450 22:17888591-17888613 CTGAGAAAAGAGTAGGAGGTGGG + Intronic
1181063450 22:20293253-20293275 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1181153250 22:20900419-20900441 CTTTGAAAGGCAGAGGTGGGAGG - Intergenic
1181441506 22:22938237-22938259 GGGAGAAAGGGGTAGGTGGATGG + Intergenic
1181642238 22:24208640-24208662 CTTTGAAAGGCTTAGGTGGGTGG + Intergenic
1182191803 22:28468778-28468800 CTTAGAGAGGCAGAGGTGGGTGG - Intronic
1182310581 22:29402800-29402822 CTGAGAAAAGTGCAGGGGGGCGG - Intronic
1182366764 22:29784400-29784422 CTTTGAAAGACGGAGGTGGGTGG - Intergenic
1182690469 22:32157946-32157968 CTGAGAAAAGTGCAGGGGGGCGG + Intronic
1183449336 22:37883051-37883073 CTTTGAGAGGCGAAGGTGGGCGG + Intronic
1183631757 22:39037571-39037593 CTTTGAGAGGCCTAGGTGGGTGG + Intergenic
1183662763 22:39231176-39231198 TTGAGAAAGGCTCAGATGGGTGG - Intronic
1183753849 22:39740655-39740677 CTTTGAAAGGCCGAGGTGGGAGG - Intergenic
1184013210 22:41765257-41765279 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1184431198 22:44442317-44442339 CTGAGATGGGAGTGGGTGGGGGG + Intergenic
1184553753 22:45220822-45220844 CTTAGGAAGGCCTAGGTGGGAGG - Intronic
1184690915 22:46116876-46116898 GTGAGCGGGGCGTAGGTGGGCGG - Intergenic
1184775393 22:46620551-46620573 CTGAGACAGACGGAGGTAGGGGG + Exonic
949199580 3:1358825-1358847 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
949543849 3:5055280-5055302 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
950067526 3:10124938-10124960 GTGAGAAAGGCATAGGAAGGGGG - Intronic
950537529 3:13588349-13588371 CTGAGAAATGCGTGGTTAGGTGG - Intronic
950852950 3:16080242-16080264 CTTTGGAAGGCCTAGGTGGGTGG - Intergenic
951639635 3:24822293-24822315 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
951888428 3:27547049-27547071 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
951919469 3:27838603-27838625 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
952247279 3:31607841-31607863 CTTTGGAAGGCGGAGGTGGGAGG - Intronic
952318040 3:32248889-32248911 CTGTGAGAGGCCAAGGTGGGAGG - Intronic
952463401 3:33553981-33554003 CTTTGAAAGGCTGAGGTGGGCGG + Intronic
952848869 3:37711645-37711667 CTGTGAGAGGCTCAGGTGGGAGG - Intronic
953530027 3:43732185-43732207 CTGTGGAAGGCCGAGGTGGGTGG + Intronic
953724218 3:45383337-45383359 CTGGGAATGGCTTAGCTGGGTGG + Intergenic
954056489 3:48030143-48030165 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
954288373 3:49635729-49635751 CTTTGAGAGGCGAAGGTGGGAGG + Intronic
954347048 3:50008792-50008814 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
954835407 3:53462700-53462722 CTGAGAAAGGCTCAATTGGGTGG + Intergenic
955291231 3:57693963-57693985 CTAAGAAAGGAGGAGGTGGTAGG - Intergenic
956371495 3:68567805-68567827 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
957050907 3:75411146-75411168 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
957333209 3:78792854-78792876 CTTTGGAAGGCGAAGGTGGGAGG + Intronic
957823262 3:85406950-85406972 CTTTGGAAGGCGGAGGTGGGAGG + Intronic
958119416 3:89264454-89264476 CTGAGCAAGGGGTACGAGGGAGG - Intronic
959065067 3:101647828-101647850 CTCTGGAAGGCTTAGGTGGGAGG + Intergenic
959943255 3:112101798-112101820 CTGAGAAAGGCGTAGGTGGGAGG - Intronic
960262005 3:115578787-115578809 CTGTGGGAGGCCTAGGTGGGGGG + Intergenic
960614397 3:119583666-119583688 CTGTGAAAGGCCAAGGTGAGAGG + Intronic
961827730 3:129607431-129607453 CTGAGAAAGGTGGTGGAGGGAGG - Intergenic
961883197 3:130077581-130077603 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
962025737 3:131545818-131545840 CTTTGGAAGGCCTAGGTGGGCGG + Intronic
962144916 3:132830523-132830545 CTTTGGAAGGCCTAGGTGGGAGG - Intergenic
962778482 3:138687696-138687718 CTTTGAAAGGCTAAGGTGGGAGG - Intronic
963121445 3:141780289-141780311 ATGATAAAGGAGGAGGTGGGTGG - Intronic
963413649 3:144964687-144964709 CTTTGGAAGGCGGAGGTGGGCGG - Intergenic
963498885 3:146100122-146100144 CTTTGCAAGGCTTAGGTGGGTGG - Intronic
963856488 3:150258943-150258965 CTGGGGAAGGCTGAGGTGGGAGG - Intergenic
963880637 3:150524526-150524548 CTTTGGAAGGCTTAGGTGGGTGG - Intergenic
963984846 3:151580097-151580119 CTGTGAGAGGCTGAGGTGGGAGG + Intergenic
964231554 3:154476055-154476077 GTGAGAACGGCGGGGGTGGGGGG + Intergenic
964452316 3:156824122-156824144 CTCAGAAAGGCCTAGGTGAGAGG - Intergenic
964692153 3:159461964-159461986 CTTTGAAAGGCCGAGGTGGGCGG + Intronic
964790000 3:160445169-160445191 CTGTGGAAGGCCAAGGTGGGAGG + Intronic
965337181 3:167440637-167440659 CTTTGAGAGGCTTAGGTGGGAGG - Intergenic
965829793 3:172772437-172772459 CTGTGAGAGGCCGAGGTGGGCGG - Intronic
967301569 3:188019481-188019503 CTGAGAGAGGCGCAGGTGAAGGG + Intergenic
967489364 3:190072069-190072091 CTGAGAAAGGAGAACCTGGGAGG - Intronic
967738180 3:192976015-192976037 CTTTGAAAGGCCGAGGTGGGCGG + Intergenic
968242361 3:197101998-197102020 CTTTGGAAGGCCTAGGTGGGAGG - Intronic
968849572 4:3069822-3069844 CTGAGAGAGGAGCAGGTGTGAGG - Intergenic
969410995 4:7028082-7028104 CTGTGATAGGTGTATGTGGGGGG - Intronic
969413278 4:7043231-7043253 CTGGGAAAGGCGGCGGTGGCCGG + Intronic
971655532 4:29339849-29339871 CTTAGGAAGGCTGAGGTGGGTGG + Intergenic
971699384 4:29949997-29950019 CTGTGGAAGGCCGAGGTGGGCGG + Intergenic
972163962 4:36260060-36260082 CTTTGGAAGGCCTAGGTGGGTGG - Intergenic
972287315 4:37661521-37661543 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
973280687 4:48357940-48357962 CTGTGGAAGGCTGAGGTGGGAGG - Intronic
973639384 4:52887821-52887843 CTGAGAAAGGAGTTGGGGGATGG - Intronic
973722722 4:53741663-53741685 TGGAGAAAGGTGCAGGTGGGTGG - Intronic
973778526 4:54266488-54266510 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
974006357 4:56560987-56561009 CTTTGAAAGGCCCAGGTGGGTGG - Intronic
974247315 4:59336344-59336366 CTTTGGGAGGCGTAGGTGGGCGG - Intergenic
974707546 4:65541046-65541068 ATGAGAAAGGGGAAGGAGGGAGG - Intronic
975157815 4:71091189-71091211 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
976189016 4:82471434-82471456 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
976218499 4:82736907-82736929 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
976324009 4:83750425-83750447 CTGAGGGAGGCCAAGGTGGGTGG + Intergenic
976934772 4:90616435-90616457 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
977336478 4:95706144-95706166 CTGTGGAAGGCTGAGGTGGGAGG + Intergenic
977509530 4:97945207-97945229 CTTAGAAAGGGGAGGGTGGGAGG - Intronic
978798820 4:112735139-112735161 CTGTGAGAGGCTGAGGTGGGTGG + Intergenic
978978857 4:114916776-114916798 CTTGGAAAGGCTGAGGTGGGAGG - Intronic
979241530 4:118451377-118451399 GTGAGAATGGCTTAGCTGGGTGG + Intergenic
979563198 4:122123154-122123176 CTTCGAAAGGCCCAGGTGGGAGG - Intergenic
980030463 4:127823390-127823412 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
980311092 4:131129726-131129748 CTTTGAAAGGCCTAGATGGGAGG - Intergenic
981008795 4:139903216-139903238 CTTTGAGAGGCTTAGGTGGGAGG - Intronic
981794384 4:148579676-148579698 CTGTGAGAGGCTGAGGTGGGTGG + Intergenic
982203177 4:152977549-152977571 CTGAGGGAGGCTGAGGTGGGAGG - Exonic
982436747 4:155389019-155389041 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
982516648 4:156359601-156359623 CTTTGGAAGGCGAAGGTGGGTGG - Intergenic
983301924 4:165936682-165936704 CTTTGAAAGGCTGAGGTGGGTGG + Intronic
983629578 4:169836456-169836478 CTTAGAGAGGCTTAGGTGGGAGG + Intergenic
983934514 4:173491884-173491906 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
984016147 4:174429183-174429205 CTCTGGAAGGCCTAGGTGGGAGG + Intergenic
984080143 4:175238021-175238043 CTTGGAAAGGCCGAGGTGGGCGG - Intergenic
984361073 4:178733369-178733391 CTTTGGAAGGCATAGGTGGGTGG - Intergenic
984473201 4:180203482-180203504 CTGAGAAAAGAGTAGGAGGGAGG + Intergenic
985237323 4:187890328-187890350 CTGTGAGAGGCCAAGGTGGGAGG + Intergenic
985812768 5:2102346-2102368 CTGTGAAAGGCCAAGGTGGCTGG - Intergenic
986157786 5:5193855-5193877 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
986732947 5:10648885-10648907 CTTTGGAAGGCGGAGGTGGGAGG + Intronic
987637690 5:20566616-20566638 CTTTGGAAGGCCTAGGTGGGCGG - Intronic
988719068 5:33858411-33858433 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
988924562 5:35976594-35976616 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
989141991 5:38210615-38210637 GTGAGAAAGGAGTAGGAAGGTGG + Intergenic
989385962 5:40854831-40854853 CTTTGAGAGGCCTAGGTGGGCGG - Exonic
989576919 5:42996724-42996746 CTTTGAGAGGCATAGGTGGGTGG - Intergenic
992030957 5:72721095-72721117 CTGAGAAAGGCTGAGGAGGGAGG - Intergenic
992564046 5:77980585-77980607 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
992710349 5:79446895-79446917 CTTTGATAGGCTTAGGTGGGAGG - Intronic
993251915 5:85538173-85538195 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
993449869 5:88060293-88060315 CCAAGAGAGGGGTAGGTGGGAGG + Intergenic
993654864 5:90564989-90565011 CTTTGAAAGGCCAAGGTGGGCGG + Intronic
994169466 5:96642790-96642812 CTTTGGAAGGCCTAGGTGGGCGG - Intronic
994178756 5:96740917-96740939 CAGAGAAAGGGGTTGGTGGGAGG + Intronic
994388678 5:99163531-99163553 CTCAGAAATGGGAAGGTGGGAGG + Intergenic
994389939 5:99180480-99180502 CTGAGAAAGGTGGGGATGGGAGG - Intergenic
994569193 5:101491894-101491916 CTTTGAAAGGCCGAGGTGGGTGG + Intergenic
995041912 5:107598176-107598198 CTGAGAGAGGGGTAGTGGGGAGG - Intronic
995235169 5:109820695-109820717 CTCAGGAAGGCTGAGGTGGGAGG + Intronic
995667355 5:114557661-114557683 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
995964128 5:117883529-117883551 CTGTGGGAGGCCTAGGTGGGTGG + Intergenic
996862366 5:128082115-128082137 CTTGGAGAGGCGGAGGTGGGCGG + Intergenic
997136264 5:131329633-131329655 CTGTGGGAGGCCTAGGTGGGCGG + Intronic
997264115 5:132485153-132485175 CTTTGGAAGGCGAAGGTGGGTGG - Intronic
997333863 5:133089768-133089790 CTTTGAAAGGCTAAGGTGGGAGG + Intronic
997651672 5:135526404-135526426 CTGAGGTAGGCTGAGGTGGGAGG + Intergenic
998016838 5:138739010-138739032 CTTTGAAAGGCTGAGGTGGGTGG + Intronic
998828464 5:146131732-146131754 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
999719462 5:154388133-154388155 CTTTGAAAGGCCGAGGTGGGTGG - Intronic
999764209 5:154726081-154726103 CTGTGGAAGGCCAAGGTGGGCGG - Intronic
1000794929 5:165653399-165653421 CTGTGGGAGGCCTAGGTGGGCGG + Intergenic
1000928511 5:167223339-167223361 CTGAGAAGGGTGTATGGGGGTGG - Intergenic
1001343934 5:170873152-170873174 CTTAGAGAGGCCAAGGTGGGTGG - Intronic
1001551323 5:172604097-172604119 GTGAGAAAGGCTTAGGTGAACGG + Intergenic
1001725952 5:173900160-173900182 CTGCGAGAGGCTGAGGTGGGCGG + Intronic
1002143400 5:177159525-177159547 CTTTGGAAGGCTTAGGTGGGCGG - Intronic
1002875846 6:1208132-1208154 ATGAGAACGGCATGGGTGGGGGG - Intergenic
1002929484 6:1623665-1623687 TTGAGAAAGCCCTTGGTGGGAGG - Intergenic
1003268010 6:4583568-4583590 CTTTGAAAGGCTGAGGTGGGAGG - Intergenic
1003599150 6:7501808-7501830 CTTTGGAAGGCCTAGGTGGGTGG + Intergenic
1003837559 6:10088029-10088051 CTCAGGAAGGGGTGGGTGGGAGG - Intronic
1004124427 6:12858547-12858569 CTTTGGAAGGCCTAGGTGGGAGG + Intronic
1004136693 6:12974161-12974183 CTTTGCAAGGCGGAGGTGGGTGG - Intronic
1004300356 6:14452152-14452174 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1004378726 6:15114138-15114160 CTTAGTAAGGCTGAGGTGGGAGG + Intergenic
1004386750 6:15179652-15179674 CTTAGGAAGGCCGAGGTGGGTGG + Intergenic
1004865522 6:19849784-19849806 CTCTGAGAGGCCTAGGTGGGAGG + Intergenic
1005098274 6:22142242-22142264 CTGTGGAAGGCCAAGGTGGGTGG - Intergenic
1005350463 6:24929828-24929850 CTTGGAGAGGCCTAGGTGGGAGG + Intronic
1005956424 6:30666562-30666584 CTTTGAAAGGCTGAGGTGGGTGG + Intronic
1006194870 6:32233608-32233630 CTTTGAGAGGCGGAGGTGGGCGG - Intergenic
1006482492 6:34308212-34308234 CTTAGGGAGGCGGAGGTGGGAGG + Intronic
1006648655 6:35533272-35533294 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1006971624 6:38051158-38051180 CTGGGAAAAGCCTAGGTGGTGGG - Intronic
1007171808 6:39869339-39869361 CTTTGAGAGGCCTAGGTGGGTGG + Intronic
1007525133 6:42485504-42485526 CTTTGAGAGGCCTAGGTGGGAGG - Intergenic
1008730440 6:54475688-54475710 CTCAGAAAGGGGAAAGTGGGAGG + Intergenic
1008963842 6:57294234-57294256 CTTTGGGAGGCGTAGGTGGGTGG + Intergenic
1009460630 6:63908692-63908714 CTGTGGGAGGCGTAGGAGGGCGG - Intronic
1009644989 6:66389502-66389524 CTTTGAGAGGCTTAGGTGGGAGG - Intergenic
1009934191 6:70214044-70214066 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1009960088 6:70509188-70509210 CTGTGGAAGGTGGAGGTGGGAGG + Intronic
1010221808 6:73454469-73454491 CTTTGGAAGGCGAAGGTGGGTGG + Intergenic
1010240683 6:73612806-73612828 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
1010562406 6:77366952-77366974 ATGGGAAAGGAGTAGCTGGGAGG + Intergenic
1011048033 6:83108419-83108441 CTTTGGAAGGCGGAGGTGGGAGG - Intronic
1011425148 6:87220068-87220090 CTATGAAAGGCTGAGGTGGGAGG - Intronic
1011679343 6:89767931-89767953 CTCAGGAGGGCCTAGGTGGGAGG + Intronic
1012602052 6:101110910-101110932 AAGAGAAAGGCGCAGCTGGGAGG + Intergenic
1012959790 6:105610182-105610204 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1013094844 6:106935270-106935292 CTTTGAAAGGTGGAGGTGGGAGG - Intergenic
1013827573 6:114232432-114232454 CTGTGAGAGGCTGAGGTGGGTGG - Intronic
1014028407 6:116674465-116674487 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1014258963 6:119194565-119194587 CTGTGAGAGGCCCAGGTGGGAGG - Intronic
1014795506 6:125719833-125719855 CTGAGAAAGGAGTTGGGGGTAGG + Intergenic
1014939523 6:127421905-127421927 CTTTGAAAGGCCCAGGTGGGAGG - Intergenic
1014972813 6:127839609-127839631 CTTTGAAAGGCTTAGGTGGGAGG - Intronic
1015017745 6:128434774-128434796 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
1015225610 6:130853625-130853647 CTGAGAAAGGTGGACTTGGGAGG + Intronic
1015436472 6:133195378-133195400 CTGAAAAAGTGGAAGGTGGGAGG + Intergenic
1015636269 6:135277808-135277830 CTCAGAAGGGGGAAGGTGGGAGG + Intergenic
1015812327 6:137173126-137173148 CTTTGGAAGGCGGAGGTGGGTGG + Intronic
1016087939 6:139937727-139937749 CTTTGGAAGGCCTAGGTGGGCGG - Intergenic
1016283962 6:142451795-142451817 CTGAGGAAGGGGTAGTGGGGAGG - Intergenic
1017046790 6:150354648-150354670 CTGAGAGTGGCTGAGGTGGGAGG - Intergenic
1017239963 6:152157068-152157090 CTTTGGAAGGCCTAGGTGGGTGG - Intronic
1017345267 6:153372178-153372200 CTTTGAGAGGCCTAGGTGGGTGG + Intergenic
1017430321 6:154364450-154364472 CTGAGAGAGGCCGAGGCGGGTGG + Intronic
1017749796 6:157480508-157480530 CTTAGGAAGGCTGAGGTGGGTGG - Intronic
1018068521 6:160140838-160140860 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
1018215306 6:161520469-161520491 CTTTGAAAGGCCGAGGTGGGTGG - Intronic
1018261996 6:161979515-161979537 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1018288198 6:162263708-162263730 CTTTGAGAGGCCTAGGTGGGTGG + Intronic
1018523381 6:164678862-164678884 CTTAGGAAGGCCGAGGTGGGTGG + Intergenic
1019446769 7:1075268-1075290 CTTAGGAAGGCCAAGGTGGGCGG + Intronic
1019824234 7:3270278-3270300 CAAAGAAAGGCTGAGGTGGGAGG - Intergenic
1019933199 7:4237133-4237155 CTGTGGAAGGCTGAGGTGGGAGG - Intronic
1020031339 7:4934940-4934962 CTTTGAAAGGCTGAGGTGGGCGG + Intronic
1020202524 7:6091331-6091353 TTGAGGGAGGCGGAGGTGGGAGG - Intergenic
1020357164 7:7290158-7290180 CTGAGAATGGCTTAGTTAGGTGG - Intergenic
1020434865 7:8151711-8151733 CTGAGAAATGTGGAGGTGGGTGG + Intronic
1020579406 7:9976068-9976090 CTGTGAAAGGCCAAGGTGAGCGG - Intergenic
1020674295 7:11162331-11162353 CTGTGGAAGGCCGAGGTGGGTGG - Intronic
1020849733 7:13336844-13336866 CTGTGGAAGGCTGAGGTGGGCGG - Intergenic
1021115695 7:16744505-16744527 CTGAGCAAGGCCCAGGTGAGGGG - Intergenic
1021712283 7:23427626-23427648 CTTTGGAAGGCGGAGGTGGGTGG + Intronic
1022355647 7:29612091-29612113 GTGAGAGAGTCGTAGGTTGGAGG + Intergenic
1022386879 7:29908665-29908687 CTTTGAGAGGCCTAGGTGGGTGG + Intronic
1022953584 7:35361743-35361765 CTTAGAAAGGCCGAGGCGGGAGG - Intergenic
1023160358 7:37291669-37291691 CTGTGGAAGGCCGAGGTGGGTGG + Intronic
1023270253 7:38455167-38455189 CTGAGGCAGGAGGAGGTGGGAGG - Intronic
1023393950 7:39734996-39735018 CTTTGAAAGGCCAAGGTGGGCGG + Intergenic
1023645023 7:42302513-42302535 CTTTGAAAGGCCGAGGTGGGCGG - Intergenic
1024148184 7:46538444-46538466 CTTTGAAAGGCCGAGGTGGGTGG - Intergenic
1024672874 7:51612552-51612574 CTGAGGTGGGGGTAGGTGGGAGG + Intergenic
1025034786 7:55587353-55587375 TTGAGAAAGACGGAGGTGAGAGG - Intergenic
1025802918 7:64804537-64804559 CAGGGAGAGGCGGAGGTGGGTGG + Intronic
1025934250 7:66021952-66021974 CTTTGAAAGGCTAAGGTGGGTGG + Intergenic
1025980727 7:66403186-66403208 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1026034553 7:66821642-66821664 CTTTGAAAGGCCGAGGTGGGCGG - Intergenic
1026051316 7:66949055-66949077 CTGTGGAAGGCTGAGGTGGGAGG + Intronic
1026196904 7:68181182-68181204 CTTAGGAAGGCTGAGGTGGGAGG + Intergenic
1026641356 7:72128625-72128647 CTTTGAAAGGCTGAGGTGGGCGG + Intronic
1026815648 7:73509474-73509496 CTTTGAAAGGCACAGGTGGGAGG + Intronic
1026999449 7:74642163-74642185 CTTTGAAAGGCCGAGGTGGGAGG + Intergenic
1027950132 7:84804667-84804689 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
1028399393 7:90408257-90408279 CTTTGAAAGGTGGAGGTGGGGGG + Intronic
1028623153 7:92846582-92846604 CTGTGGGAGGCCTAGGTGGGTGG - Intergenic
1028841866 7:95437389-95437411 CTTTGAAAGGCCCAGGTGGGAGG + Intergenic
1029062208 7:97810308-97810330 CTGAGAAGGGTGTATGGGGGAGG + Intergenic
1029112432 7:98220096-98220118 CTTAGGGAGGCGGAGGTGGGCGG + Intronic
1029225623 7:99026212-99026234 CTGTGGAAGGTGGAGGTGGGTGG + Intergenic
1029433789 7:100549933-100549955 CTTTGAAAGGCCGAGGTGGGTGG - Intronic
1029680516 7:102105754-102105776 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1031003328 7:116443164-116443186 CTGAGAGAGGTGAAGGAGGGAGG + Intronic
1031552685 7:123134134-123134156 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1032333766 7:131005222-131005244 CTTAGGAAGGCTGAGGTGGGAGG - Intergenic
1032800652 7:135314968-135314990 CTTTGAAAGGCCGAGGTGGGAGG + Intergenic
1032820335 7:135518529-135518551 CTTAGACAGGCCGAGGTGGGCGG - Intergenic
1033156970 7:138965432-138965454 CTGTGGAAGGCTGAGGTGGGCGG - Intronic
1033305414 7:140221956-140221978 CTTTGAAAGGCCGAGGTGGGCGG + Intergenic
1033454967 7:141494658-141494680 CTTTGAAAGGCCAAGGTGGGAGG + Intergenic
1033643577 7:143284990-143285012 CTGAGACAGGTGTGGGTGCGAGG + Exonic
1034095902 7:148407458-148407480 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
1034117708 7:148599104-148599126 CTTTGGGAGGCGTAGGTGGGTGG - Intronic
1034141499 7:148822696-148822718 CTGTGAGAGGCTGAGGTGGGTGG + Intronic
1034245073 7:149637823-149637845 CAGAGAAATGGGTATGTGGGAGG - Intergenic
1034281167 7:149855479-149855501 GTGGGAATGGCGTTGGTGGGTGG + Intronic
1034494870 7:151413977-151413999 CTGTGGGAGGCGGAGGTGGGCGG + Intergenic
1034616202 7:152418948-152418970 CTTTGAAAGGCCAAGGTGGGAGG + Intronic
1034681005 7:152927346-152927368 CTGTGGAAGGCTGAGGTGGGTGG + Intergenic
1034921803 7:155089319-155089341 CTTAGAGAGGCCGAGGTGGGCGG - Intergenic
1034940293 7:155226358-155226380 CTGAGAAAGCTGCAGATGGGAGG + Intergenic
1035199094 7:157248566-157248588 CTGGGAGAGGCGCAGGTGAGGGG + Exonic
1035215050 7:157359578-157359600 CTTCGAGAGGCCTAGGTGGGAGG + Intronic
1036604557 8:10293958-10293980 CTTCGAAAGGCCGAGGTGGGAGG + Intronic
1036997953 8:13681138-13681160 CTGTGGAAGGCTGAGGTGGGTGG - Intergenic
1037298975 8:17431626-17431648 CTCAGCAAGGCTGAGGTGGGAGG + Intergenic
1037330461 8:17738893-17738915 CTGTGGGAGGCCTAGGTGGGAGG + Intronic
1037512188 8:19594793-19594815 CTGTGGAAGGCCAAGGTGGGTGG - Intronic
1037784712 8:21895821-21895843 CTTTGAAAGGCCTAGGTGGGTGG - Intergenic
1037812720 8:22096495-22096517 CTGGGCAAGGCCGAGGTGGGAGG + Exonic
1037982327 8:23263120-23263142 CTCTGAGAGGCTTAGGTGGGAGG - Intergenic
1038032137 8:23651699-23651721 CTTTGAGAGGCCTAGGTGGGTGG - Intergenic
1038229526 8:25687279-25687301 CTGATATAGGTATAGGTGGGTGG + Intergenic
1038765280 8:30422355-30422377 CTTTGAAAGGCTGAGGTGGGTGG - Intronic
1038843319 8:31206061-31206083 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1038946446 8:32366344-32366366 CTGAGATGGGTGGAGGTGGGGGG - Intronic
1039639006 8:39198619-39198641 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1039693881 8:39889766-39889788 CTTTGGAAGGCCTAGGTGGGTGG - Intergenic
1039885639 8:41652657-41652679 CTGACAAAGGCGTTGGTGTCTGG + Intergenic
1040453318 8:47570847-47570869 CTTTGGAAGGCCTAGGTGGGCGG + Intronic
1040696841 8:50009752-50009774 CTGTGGAAGGCCGAGGTGGGTGG + Intronic
1041502115 8:58550506-58550528 CTTCGGAAGGCTTAGGTGGGAGG - Intergenic
1041684211 8:60627758-60627780 CTTTGAGAGGCGGAGGTGGGAGG + Intergenic
1041881038 8:62750454-62750476 CTCAGAAAGGCGAAGACGGGCGG + Intronic
1042048478 8:64681796-64681818 CTGGGAAAGGCTGAGCTGGGTGG - Intronic
1042168306 8:65968194-65968216 CTTTGAAAGGCTGAGGTGGGCGG - Intergenic
1042245679 8:66706904-66706926 CTGTGGGAGGCCTAGGTGGGCGG - Intronic
1042557675 8:70047181-70047203 CTGTGGGAGGCGGAGGTGGGTGG - Intergenic
1043056166 8:75442463-75442485 CTGTGGAAGGCCAAGGTGGGAGG + Intronic
1043637373 8:82403136-82403158 CTGATAAAGAGGTAGGCGGGTGG + Intergenic
1044823791 8:96177635-96177657 CTTAGAAAGGCTAAGGTGAGAGG + Intergenic
1044962585 8:97545379-97545401 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1044998889 8:97863046-97863068 CTCAGAGAGGCTGAGGTGGGAGG - Intergenic
1045076959 8:98580719-98580741 CTTAGGAAGGCTGAGGTGGGAGG - Intronic
1045425519 8:102062158-102062180 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
1046885681 8:119364408-119364430 CTGAGAAAGGGGAAAGGGGGAGG - Intergenic
1046985683 8:120385794-120385816 CTCAGAAGGGTGAAGGTGGGAGG - Intronic
1047110472 8:121784073-121784095 CTCGGAAAGGCCAAGGTGGGTGG + Intergenic
1047274431 8:123395280-123395302 CTGAAAGAGGCCTAGGTGGAGGG - Intronic
1047976793 8:130138591-130138613 CTTTGAAAGGCTGAGGTGGGTGG + Intronic
1048010132 8:130448793-130448815 CAGAGAAGGGAGTAGGTGGTGGG + Intergenic
1048022085 8:130548587-130548609 CTGTGAGAGGCTGAGGTGGGTGG - Intergenic
1049043793 8:140132738-140132760 CTGGGAAAGGTGCAAGTGGGAGG + Intronic
1049081500 8:140446773-140446795 CTTTGGAAGGCGGAGGTGGGTGG - Intronic
1049120374 8:140731649-140731671 CTTTGAAAGGCCAAGGTGGGTGG + Intronic
1049142121 8:140964333-140964355 CTGAGGGAGGCTCAGGTGGGAGG - Intronic
1050515123 9:6435367-6435389 CTCAGGAAGGCTGAGGTGGGAGG - Intronic
1050736048 9:8764552-8764574 CTTAGGAAGGCCAAGGTGGGTGG + Intronic
1051425738 9:16929964-16929986 CTTAGAGAGGCAGAGGTGGGAGG + Intergenic
1051643710 9:19247777-19247799 CTGAGAAAAGGGTAGGTTTGAGG - Intronic
1051856710 9:21575701-21575723 TTGGGAAAGGCCAAGGTGGGCGG - Intergenic
1052029691 9:23614356-23614378 CTTTGAAAGGCCAAGGTGGGGGG + Intergenic
1052104247 9:24492640-24492662 CTTTGGAAGGCCTAGGTGGGTGG + Intergenic
1052728500 9:32258852-32258874 CTGGGTATGGGGTAGGTGGGTGG - Intergenic
1052762349 9:32605627-32605649 CTTTGAGAGGCCTAGGTGGGTGG + Intergenic
1055066836 9:72127393-72127415 CTTTGGAAGGCGGAGGTGGGCGG + Intronic
1055154139 9:73039850-73039872 CTGAGTAGTGAGTAGGTGGGAGG - Intronic
1055315488 9:75029363-75029385 CTTTGGAAGGCCTAGGTGGGCGG + Intergenic
1055340088 9:75272396-75272418 CTCAGAAGGGGGAAGGTGGGAGG - Intergenic
1055505671 9:76946069-76946091 CTTAGAGAGGCCAAGGTGGGTGG + Intergenic
1055531737 9:77191540-77191562 CTTTGCAAGGCTTAGGTGGGGGG - Intronic
1056744949 9:89292668-89292690 CTGTGAGAGGCTGAGGTGGGCGG - Intergenic
1057008537 9:91581973-91581995 CTGTGGAAGGCCGAGGTGGGTGG - Intronic
1057044516 9:91874690-91874712 CACAGAAAGGCCGAGGTGGGTGG + Intronic
1057722502 9:97544292-97544314 CTTAGGAAGGCCGAGGTGGGTGG + Intronic
1058057028 9:100458748-100458770 CTTGGGAAGGCGAAGGTGGGAGG + Intronic
1058346530 9:103970190-103970212 GTGAGAGAGGGGAAGGTGGGGGG - Intergenic
1058585749 9:106504594-106504616 CTTTGAAAGGCCAAGGTGGGTGG - Intergenic
1058587465 9:106525609-106525631 CTCAGAAGGGGGTGGGTGGGAGG + Intergenic
1058696365 9:107562535-107562557 CTCTGAAAGGCTGAGGTGGGAGG - Intergenic
1059584551 9:115591890-115591912 CTTAGGAAGGCCTAGGTGGGAGG + Intergenic
1060560317 9:124537328-124537350 CTTTGGAAGGCCTAGGTGGGCGG - Intronic
1060595384 9:124844728-124844750 CTTTGAGAGGTGTAGGTGGGTGG + Intergenic
1060959928 9:127673185-127673207 CTCAGCAAGGTGCAGGTGGGTGG - Exonic
1061023714 9:128033957-128033979 CTTTGGAAGGCGGAGGTGGGAGG - Intergenic
1061284865 9:129616457-129616479 CTTAGGAAGGCGAAGGGGGGTGG - Intronic
1061293221 9:129664209-129664231 CTGTGGAAGGCTGAGGTGGGTGG - Intergenic
1061538636 9:131265490-131265512 CTGTGAGAGGCTGAGGTGGGTGG - Intronic
1061564468 9:131428770-131428792 CTCAGGAAGGCTGAGGTGGGAGG - Intronic
1061613116 9:131761808-131761830 CTTTGGAAGGCCTAGGTGGGAGG - Intergenic
1061642010 9:131966117-131966139 CTTTGAAAGGCTGAGGTGGGAGG + Intronic
1061668527 9:132174676-132174698 CTGTGAGAGGCTGAGGTGGGCGG + Intronic
1061768637 9:132899785-132899807 CTGAGAGAAGCCTAGATGGGCGG - Intronic
1062346042 9:136115809-136115831 CGGAGAAGGGCTCAGGTGGGAGG - Exonic
1062566807 9:137167235-137167257 CAGAGGGAGGCGTGGGTGGGGGG + Intronic
1062594120 9:137290052-137290074 CTGAGGGAGGCCAAGGTGGGTGG - Intergenic
1185702283 X:2240047-2240069 CTTAGGAAGGCCGAGGTGGGCGG + Intronic
1185815563 X:3151974-3151996 CTTTGAGAGGCCTAGGTGGGAGG - Intergenic
1186457562 X:9722014-9722036 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
1187338392 X:18400469-18400491 CTTTGAAAGGCTGAGGTGGGAGG + Intergenic
1187341406 X:18425160-18425182 CTGAGAAAGGGGTGGCTGCGGGG - Intergenic
1187457700 X:19457366-19457388 CTTTGAGAGGCGGAGGTGGGTGG + Intronic
1187690248 X:21858960-21858982 CTGTGAGAGGCTGAGGTGGGTGG + Intronic
1187690367 X:21860162-21860184 CTGTGAGAGGCTGAGGTGGGTGG + Intronic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1188628769 X:32323984-32324006 CTGGGAAGAGTGTAGGTGGGCGG + Intronic
1188806346 X:34595161-34595183 CTTTGAAAGGCCGAGGTGGGCGG + Intergenic
1189455210 X:41181690-41181712 CTCAGGGAGGCGGAGGTGGGCGG - Intronic
1190077989 X:47332807-47332829 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
1190250881 X:48724346-48724368 CTTAGGAAGGCTGAGGTGGGCGG - Intergenic
1190377477 X:49803633-49803655 CTTTGAGAGGCGGAGGTGGGCGG + Intergenic
1190809676 X:53871096-53871118 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1190928946 X:54932482-54932504 GTGAGAGAGGCTGAGGTGGGAGG + Intergenic
1191635845 X:63375612-63375634 CTTTGGGAGGCGTAGGTGGGTGG - Intergenic
1192121366 X:68459358-68459380 CTGTGAGAGGCCTAGGCGGGTGG + Intergenic
1192217720 X:69175254-69175276 CTGATATAGGCCAAGGTGGGAGG - Intergenic
1192257433 X:69474250-69474272 CTCAGGGAGGCTTAGGTGGGAGG - Intergenic
1192375848 X:70560990-70561012 CTTTGAAAGGCCAAGGTGGGAGG - Intronic
1192415976 X:70981151-70981173 CTTTGAAAGGCCAAGGTGGGTGG + Intergenic
1193679631 X:84502297-84502319 GTGAGAAGGGCGAAGGAGGGAGG - Intronic
1193881368 X:86925542-86925564 CTTTGAAAGGCCTAGGTGGGTGG - Intergenic
1194023003 X:88717011-88717033 CTTTGGAAGGCCTAGGTGGGAGG - Intergenic
1195371864 X:104183706-104183728 CTTTGAGAGGCGGAGGTGGGTGG - Intronic
1195413908 X:104599489-104599511 CTTTGAAAGGCTGAGGTGGGAGG - Intronic
1195630160 X:107047500-107047522 CTGTGGGAGGCGGAGGTGGGAGG - Intergenic
1196681993 X:118478939-118478961 CTTTGAAAGGCCGAGGTGGGTGG - Intergenic
1198109734 X:133492448-133492470 CTTTGAAAGGCTGAGGTGGGTGG + Intergenic
1198374339 X:136023052-136023074 CTTTGAAAGGCCAAGGTGGGTGG - Intronic
1198383711 X:136107589-136107611 CTGTGGGAGGCCTAGGTGGGCGG + Intergenic
1198887579 X:141356152-141356174 CTTTGAGAGGCCTAGGTGGGTGG + Intergenic
1200216002 X:154368550-154368572 CTGAGGAAGAGGAAGGTGGGTGG + Intronic
1200396937 X:155996534-155996556 CTTAGGGAGGCTTAGGTGGGCGG + Intergenic
1200956894 Y:8958383-8958405 CTGTGAAAGGCTGAGGCGGGCGG + Intergenic
1201374187 Y:13298509-13298531 CTTTGAAAGGCCCAGGTGGGCGG + Intronic
1201380411 Y:13370803-13370825 CTTTGAAAGGCCGAGGTGGGTGG + Intronic
1201684925 Y:16690446-16690468 CTTTGAAAGGCCAAGGTGGGAGG - Intergenic
1201968178 Y:19761638-19761660 CTTTGAAAGGCTGAGGTGGGTGG - Intergenic
1202389245 Y:24353209-24353231 GTGAGAATGGCTTAGCTGGGTGG + Intergenic
1202481542 Y:25316915-25316937 GTGAGAATGGCTTAGCTGGGTGG - Intergenic