ID: 959944328

View in Genome Browser
Species Human (GRCh38)
Location 3:112111409-112111431
Sequence GTTCTAGCTGGGCCAGTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 95}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959944328_959944338 28 Left 959944328 3:112111409-112111431 CCCTGGACTGGCCCAGCTAGAAC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 959944338 3:112111460-112111482 TGCTAGACTCACTCCAGTGGTGG 0: 1
1: 1
2: 1
3: 4
4: 67
959944328_959944333 -4 Left 959944328 3:112111409-112111431 CCCTGGACTGGCCCAGCTAGAAC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 959944333 3:112111428-112111450 GAACCTGGAAAAATGCCCTTTGG 0: 1
1: 0
2: 0
3: 15
4: 179
959944328_959944337 25 Left 959944328 3:112111409-112111431 CCCTGGACTGGCCCAGCTAGAAC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 959944337 3:112111457-112111479 AGCTGCTAGACTCACTCCAGTGG 0: 1
1: 0
2: 1
3: 11
4: 137
959944328_959944339 29 Left 959944328 3:112111409-112111431 CCCTGGACTGGCCCAGCTAGAAC 0: 1
1: 0
2: 1
3: 7
4: 95
Right 959944339 3:112111461-112111483 GCTAGACTCACTCCAGTGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959944328 Original CRISPR GTTCTAGCTGGGCCAGTCCA GGG (reversed) Intronic
900285747 1:1899576-1899598 GTTCAGGCTGGGTCAGGCCAAGG - Intergenic
902739101 1:18422166-18422188 GTTCAAGCTGGCCCAGTCAGGGG + Intergenic
904445847 1:30572393-30572415 GCTCTGGCTGGGCATGTCCATGG + Intergenic
904458624 1:30662358-30662380 GTTCCTGCTGGGCCTGTCCCTGG - Intergenic
904663461 1:32102345-32102367 GTTCTGGGTGGGCCAGTGAAGGG - Intronic
905262425 1:36729242-36729264 GTTGTAGCTGGGCCAGTCTTAGG - Intergenic
905494284 1:38372324-38372346 GTACTGGATGGGCCTGTCCATGG - Intergenic
906479104 1:46188813-46188835 GCCCCAGCTGGGCCTGTCCATGG + Exonic
909725309 1:78827985-78828007 GTTCTGGATGGGCAAGGCCAAGG + Intergenic
919741254 1:200982838-200982860 GCTCTAGCTGGCGCAGTCCAAGG + Intronic
919745999 1:201009509-201009531 CTTCTAGCTGGGCCTGACCCAGG - Intronic
919771144 1:201159416-201159438 TTTCTAGCTGGGCAAGGCCCTGG + Intronic
920045564 1:203130042-203130064 GTCCCAGCAGGGCCAGTCCCTGG - Intronic
1063375863 10:5553793-5553815 GTTCAAGCTGGGGCTGCCCAAGG - Intergenic
1063535045 10:6875347-6875369 GCTCTTGCCTGGCCAGTCCACGG - Intergenic
1070397772 10:76026629-76026651 CTTCTAGCTGGGACTGTGCAAGG - Intronic
1076875208 10:133212581-133212603 GCTCTGGCTGGGCCAGTCTGAGG + Intronic
1077744254 11:4882814-4882836 GTTCCAGCTGCTCCAATCCAAGG + Exonic
1078211901 11:9276569-9276591 GATATAGCTGGGCCACTCCTTGG + Intergenic
1083670910 11:64299551-64299573 GTTCTCGCTGGGATAATCCAGGG - Exonic
1083920363 11:65779010-65779032 GGTACAGCTGGGCCAGTCCGTGG + Exonic
1085338156 11:75713189-75713211 GTGTTAGCAGAGCCAGTCCATGG - Intergenic
1088686258 11:112286811-112286833 GTTATAGCTGGGCCAGGCCAAGG + Intergenic
1090176735 11:124656744-124656766 GGAGAAGCTGGGCCAGTCCAGGG - Intronic
1098194509 12:67985588-67985610 TGTCAAGCTGGGCCAGGCCAAGG - Intergenic
1102949843 12:117024126-117024148 GCTCTTCCTGGGCCTGTCCAGGG + Exonic
1103332537 12:120164245-120164267 GTTTTGGCTGGGCCACTCCCTGG - Intronic
1117548009 14:56808994-56809016 GTTCTTACTGGGCCGATCCATGG + Intronic
1118608707 14:67522834-67522856 GTTCTAGCAGGTCCAGGACAAGG - Intronic
1124585574 15:31002970-31002992 CTTCTAGCTGAGCAAGTCGAAGG + Exonic
1125518764 15:40336974-40336996 GTGCTAGCTTTGCCACTCCATGG + Intronic
1126122967 15:45269805-45269827 TTTACAGCTGGGGCAGTCCAGGG + Intronic
1127627706 15:60796360-60796382 GGTCAGGCTGGGCCAGCCCATGG + Intronic
1128698955 15:69789961-69789983 GTCCTGGCTGGGCCACTCCCTGG - Intergenic
1131047227 15:89323895-89323917 CTTCTACCTGGAGCAGTCCAAGG + Exonic
1131515674 15:93074710-93074732 TTTCAAGCTTGGCCAGTCCTGGG + Intronic
1132090912 15:98947439-98947461 ATTCTAGCTGGACCTGTCCTGGG - Intronic
1134888662 16:17818707-17818729 ATTATAGCTGGGCCCCTCCATGG - Intergenic
1135620386 16:23950419-23950441 CTTTTAGCTGGCCCAGTCCTGGG - Intronic
1137932225 16:52600012-52600034 GTTCTAGCTGCATCATTCCATGG + Intergenic
1139465047 16:67150005-67150027 GTTCTTGCTGGGCGTGCCCAGGG - Exonic
1141398847 16:83728898-83728920 GTTCTAGCTGGTTCAGTCTCTGG + Intronic
1143881857 17:10035947-10035969 GTTCTAGCTGGGGCATTGTAAGG - Intronic
1147668962 17:42165799-42165821 GTTGAAGGTGGGCCAGTCAATGG + Intronic
1148133106 17:45274174-45274196 GTACTACCTGGGCCAGGCCCTGG - Exonic
1151344859 17:73495235-73495257 GCTCCAGCTGGGAGAGTCCAGGG + Intronic
1151991169 17:77575328-77575350 GTTCTAACTGGGCATGACCAGGG - Intergenic
1156185050 18:34652817-34652839 GTTCTAGGTGGCCAAGTCCAGGG + Intronic
1157491146 18:48124715-48124737 GTGCTATCTGAGCCAGCCCAGGG + Intronic
1158343788 18:56494149-56494171 GTTTTGGCTGGGCCAGGCCTGGG - Intergenic
1159438388 18:68446867-68446889 GTTTTAGCAGGTCCAGGCCACGG - Intergenic
1160744260 19:703493-703515 GTTTGAGCTGGGGCAGGCCAGGG + Intergenic
1165826742 19:38709943-38709965 GTCCCAGCTGGGGCAGTGCATGG - Intronic
928065474 2:28160303-28160325 TTTTTAGCTGGGCCCGTGCATGG + Intronic
928992757 2:37252234-37252256 TTTTTAGCAGGGCCAGTGCAGGG - Exonic
934503015 2:94873841-94873863 GTTCTGGGTGGGCCTGTCCCGGG - Intronic
936361912 2:111811680-111811702 CTTCTAGCTGGGCCAAGCCTTGG - Intronic
938060343 2:128249672-128249694 CTACTAGCTGGGCCTGGCCAGGG - Intronic
940722596 2:157298426-157298448 GTCCCTGCTTGGCCAGTCCAAGG - Intronic
941966559 2:171306242-171306264 CTTCTTGCTGTGCCATTCCATGG - Intergenic
942302526 2:174575414-174575436 GGTTTACCTGGGCCAGACCAGGG - Intronic
946413439 2:219527054-219527076 CCTCTTCCTGGGCCAGTCCATGG + Intronic
948246737 2:236492591-236492613 ATTCAAGCTGGGACACTCCAGGG - Intronic
948651158 2:239444800-239444822 GTTCCAGCCAGGCCAGTCCACGG + Intergenic
948708605 2:239811198-239811220 GTTCCAGCTTGGCCAGGACAGGG + Intergenic
1169037293 20:2463769-2463791 GGACTTGCTGGGCCAGTCCGTGG - Exonic
1170244237 20:14203832-14203854 GGTCCAGGTGGGCCAGTCCTTGG + Intronic
1175210953 20:57354365-57354387 GTCCTGGCTGGGCCAGGCCCTGG - Intronic
1175703729 20:61160087-61160109 CTTCTATCTGGGCCAGTCCTCGG + Intergenic
1177715251 21:24832120-24832142 CCACTAGCTGGGCCACTCCATGG - Intergenic
1177803640 21:25852903-25852925 GATATAGATGGGCCAGTTCATGG - Intergenic
1182329017 22:29537187-29537209 GTGCTAACCAGGCCAGTCCATGG - Intronic
954249233 3:49355464-49355486 GTTCTACCTGGGTCACCCCAAGG + Intergenic
954587580 3:51749532-51749554 GTTTTAGGTGGGCTAGTCCACGG - Intergenic
959944328 3:112111409-112111431 GTTCTAGCTGGGCCAGTCCAGGG - Intronic
960632965 3:119751862-119751884 TTTGTAGCTGGGCAAATCCATGG - Intronic
966499777 3:180626361-180626383 GTTCTGGCTGTGACAGTCAAAGG + Intronic
980901678 4:138911145-138911167 GTTCTAGCTGGCAAAGTACACGG + Intergenic
983726668 4:170937515-170937537 ATGCTAACTGGGCCAGACCAAGG + Intergenic
984518058 4:180766782-180766804 ATTCTAGCTGCCCCAGTGCATGG - Intergenic
986162142 5:5239807-5239829 GTACCGGCCGGGCCAGTCCACGG - Exonic
988029151 5:25739657-25739679 GCTCCAGCTGGGCCAGTCCTTGG - Intergenic
994942202 5:106339322-106339344 GTACTTGCTGGGTCAGTCCTGGG + Intergenic
996738463 5:126777820-126777842 GATCGAGCTGGGCAAGTGCAAGG + Exonic
998391005 5:141786998-141787020 GTTCTAGGTGGGCTCCTCCAGGG + Intergenic
1001750968 5:174131179-174131201 GTTCAAACTGGGACAGTCCCAGG - Intronic
1006021162 6:31118416-31118438 GCTCTCGCTGGCCCAGCCCAGGG + Intronic
1007078900 6:39085064-39085086 GTTCCAGCTAGGCCTCTCCAGGG + Intronic
1015836546 6:137426385-137426407 GATCTAGGTGGGCCAAGCCAGGG - Intergenic
1019799422 7:3077479-3077501 GTGTCAGCTGGGCCAGGCCATGG - Intergenic
1023829149 7:44029044-44029066 GTTCTGGCTGGGTCTGTCCTAGG + Intergenic
1029739451 7:102483301-102483323 GTTCTGGCTGGGTCTGTCCTGGG + Exonic
1029757452 7:102582480-102582502 GTTCTGGCTGGGTCTGTCCTGGG + Exonic
1029775392 7:102681541-102681563 GTTCTGGCTGGGTCTGTCCTGGG + Intergenic
1036563180 8:9914610-9914632 GTTCTAGCAGGGCCGGGCTAAGG - Intergenic
1039079796 8:33723001-33723023 GTTCTGGGAGAGCCAGTCCACGG + Intergenic
1049176072 8:141193453-141193475 GTTCTAGCTGCGCAGGTTCACGG - Intronic
1052956538 9:34256838-34256860 GTTCTCTCTGCTCCAGTCCACGG + Exonic
1060987478 9:127828156-127828178 CTTCTAGATGGGCCATTCTAGGG - Intronic
1061132409 9:128715325-128715347 GCTCCAGGTGGGCCAGACCAGGG - Intronic
1061682590 9:132250318-132250340 GTTCCTGCTGGGCCAAGCCAGGG - Intergenic
1062496313 9:136833296-136833318 GATCCAGCTGGGGCAGCCCAGGG - Intronic
1062555907 9:137113395-137113417 GTTCTAGCTGTGGCAGGCCTCGG - Exonic
1062656738 9:137607492-137607514 GCTCAGGCTGGCCCAGTCCAGGG + Intronic