ID: 959944632

View in Genome Browser
Species Human (GRCh38)
Location 3:112113860-112113882
Sequence ATTGCTTTGTAGTGAAGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959944628_959944632 -5 Left 959944628 3:112113842-112113864 CCCTCAAAATATCCTTCCATTGC 0: 1
1: 0
2: 0
3: 23
4: 249
Right 959944632 3:112113860-112113882 ATTGCTTTGTAGTGAAGCTCTGG 0: 1
1: 0
2: 1
3: 7
4: 131
959944629_959944632 -6 Left 959944629 3:112113843-112113865 CCTCAAAATATCCTTCCATTGCT 0: 1
1: 0
2: 0
3: 25
4: 308
Right 959944632 3:112113860-112113882 ATTGCTTTGTAGTGAAGCTCTGG 0: 1
1: 0
2: 1
3: 7
4: 131
959944627_959944632 10 Left 959944627 3:112113827-112113849 CCAAATGGCTTCAAGCCCTCAAA 0: 1
1: 0
2: 2
3: 19
4: 116
Right 959944632 3:112113860-112113882 ATTGCTTTGTAGTGAAGCTCTGG 0: 1
1: 0
2: 1
3: 7
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959944632 Original CRISPR ATTGCTTTGTAGTGAAGCTC TGG Intronic
908456394 1:64308735-64308757 ATGGCTTTGCTCTGAAGCTCTGG + Intergenic
909829028 1:80162003-80162025 ATTGCTTGATAGTTAAGCTGAGG - Intergenic
911702804 1:100974152-100974174 ATTGCGTAGTAGTGAAGTTTGGG + Intronic
916642837 1:166749749-166749771 ATTTCTTTGTATTCAAGCTGAGG - Intergenic
916894104 1:169143497-169143519 ATTGCTGTGTAGTGAAAGACAGG - Intronic
919608466 1:199715735-199715757 ATAACATTGTAGAGAAGCTCTGG - Intergenic
919648057 1:200116218-200116240 ATTGCTTTATAGTGACCCTTTGG + Intronic
923363800 1:233239114-233239136 TTTTGTTTGTAGTGAAGTTCTGG - Intronic
924141736 1:241031025-241031047 ATTGCATAGTGGTGAAGCCCCGG + Intronic
1066714759 10:38274643-38274665 ATTGCTTTGTTGTGAAGGGGAGG + Intergenic
1068342985 10:55733140-55733162 ATTACTTTGCAGTGAACCTCTGG + Intergenic
1070243378 10:74706140-74706162 ATTTTTTTGTAGAGATGCTCAGG - Intronic
1071787504 10:88918245-88918267 CTTGCTTTATAGAGAAGCACTGG + Intronic
1076554903 10:131314908-131314930 ATTGCTTTGGAAAGAAGTTCTGG - Intergenic
1081402805 11:42662292-42662314 GTTGCTTTGGAGTGAAGCAAAGG - Intergenic
1081890475 11:46537578-46537600 ATTTCTTTGTAGTGAAGCAAAGG + Intronic
1088181340 11:107115905-107115927 ACTGCTTTGAAGTGATGCTCAGG - Intergenic
1088745081 11:112798269-112798291 ACTGCTTTGAAATGCAGCTCAGG + Intergenic
1094008119 12:25777249-25777271 ATGGCTTTGAAGTCAGGCTCGGG + Intergenic
1094657801 12:32437531-32437553 ATATCCGTGTAGTGAAGCTCTGG - Intronic
1097659873 12:62417719-62417741 CTTCCCTTGTAGTGTAGCTCAGG - Intergenic
1097810087 12:64009668-64009690 CTTGATTTGAAATGAAGCTCTGG + Intronic
1099037649 12:77609340-77609362 ATTGCTTTGTAGCCAGGCTCTGG - Intergenic
1099488043 12:83252310-83252332 ATTGCATTGTAGTAAAGATATGG - Intergenic
1099536310 12:83849320-83849342 TGTTCTTTGTAGTGAAGCTAAGG - Intergenic
1100782696 12:98046456-98046478 AATGTTTTGTTATGAAGCTCAGG + Intergenic
1101087728 12:101253627-101253649 ATGGGTTTGTCATGAAGCTCAGG - Intergenic
1101397382 12:104360225-104360247 GTTGCTCTGTGGTTAAGCTCTGG + Intergenic
1103262196 12:119597053-119597075 ATTGATATATAGTGCAGCTCTGG + Intronic
1104077681 12:125404830-125404852 TTTGCTTTGGAGTGAAACACTGG - Intronic
1107201445 13:37723725-37723747 ATTCCTTTGTAGAGAAGATGAGG + Intronic
1107929466 13:45295067-45295089 CTTTCTTTGTAGTCAACCTCAGG - Intergenic
1108115737 13:47125728-47125750 ATTTCTCTTTAGTGAAACTCAGG - Intergenic
1109132487 13:58604857-58604879 GTTACTTAATAGTGAAGCTCTGG + Intergenic
1109592044 13:64498196-64498218 ATGGCTTTTTGGTGAATCTCTGG - Intergenic
1117083693 14:52178017-52178039 GCTTCTTTTTAGTGAAGCTCTGG + Intergenic
1117591881 14:57278585-57278607 TTTGCTATGTAGAGAAGCCCAGG - Intronic
1117823876 14:59679824-59679846 ATTGTTCTGTATGGAAGCTCTGG - Intronic
1118073585 14:62272914-62272936 TTTGCTGTGTAGAGAAGCACAGG - Intergenic
1118257317 14:64216301-64216323 ATTTGCTTGTAGTGATGCTCGGG - Exonic
1123027352 14:105432957-105432979 ATCGCTTTCGACTGAAGCTCAGG - Intronic
1123917984 15:25051363-25051385 ATTGCTCAGTGGTGCAGCTCTGG + Intergenic
1125743286 15:41982365-41982387 ATTGCTTCCTAATGAATCTCTGG - Exonic
1126152291 15:45534178-45534200 CTTGCTTTGTAGTTTAGTTCAGG - Intergenic
1127060174 15:55174376-55174398 ATTACTTTTTAAAGAAGCTCTGG - Intergenic
1127314094 15:57778112-57778134 ATTGCTTTGTAGTTCAAATCGGG - Intronic
1133152404 16:3845204-3845226 ATTGCTCTGTAGTGGGGTTCAGG + Intronic
1135008376 16:18849223-18849245 ATCGCTTAGTAGTGAATCCCAGG - Exonic
1139306276 16:65988864-65988886 ATTGGTTTCTAGGGAACCTCAGG - Intergenic
1141236116 16:82218563-82218585 ACTGCATTGTTGTGAAGATCTGG - Intergenic
1141343582 16:83225701-83225723 ATTGGTTTGGAGTGCAGCTTGGG - Intronic
1146885148 17:36465386-36465408 CTTGTTTTGTTGAGAAGCTCAGG - Intergenic
1149683725 17:58522894-58522916 TTTGCTTTGTAGTGAAGAGAAGG - Intronic
1149958914 17:61085246-61085268 CTTGCTTTATAGTGCAGCTGGGG + Intronic
1153442332 18:5133676-5133698 ATTGCATTGTGGTGAAGTTAGGG - Intergenic
1158608983 18:58921590-58921612 TTTGTTTTGTAGTGAAGTGCAGG + Intronic
925401530 2:3576372-3576394 ATTAGTTTGTAGTGCAGCTACGG + Intronic
926418894 2:12678140-12678162 AATGCTTTGTATAGAAGCTGTGG - Intergenic
928077302 2:28276967-28276989 ATTGCTTTGTTCTGAGGCGCAGG + Intronic
930977354 2:57479418-57479440 ATTGCTTTGTAATAAATCACTGG - Intergenic
933225973 2:79750138-79750160 ATTTCTTCATATTGAAGCTCTGG + Intronic
937376540 2:121340145-121340167 ATTCCTTTGCATGGAAGCTCTGG + Exonic
937590980 2:123612897-123612919 ATTGGTTTGTAGTGATCTTCTGG + Intergenic
940049200 2:149443784-149443806 ATTGCTTTGTTGTGGTGGTCTGG - Intronic
941105877 2:161352255-161352277 ATTGCTCTGGATTGAGGCTCAGG - Intronic
941265905 2:163361795-163361817 ATTGTTTTGAAGTGAAGCAGTGG + Intergenic
946861559 2:224004389-224004411 ATTGTTTTACAATGAAGCTCTGG - Intronic
947319475 2:228900037-228900059 ATTTCTTTGCAGAAAAGCTCTGG - Intronic
1170382352 20:15775219-15775241 ATTTTTTTGTAGTGAGACTCAGG - Intronic
1172935724 20:38618727-38618749 GTTGCTATGTTGAGAAGCTCAGG - Intronic
1175552858 20:59828252-59828274 AATGCTTCTTGGTGAAGCTCTGG - Intronic
1179357518 21:40674573-40674595 ATTGTTTTGAAGTAAATCTCAGG + Intronic
1180920328 22:19518350-19518372 TTTGCTTTGTGGTGAGGGTCTGG + Intronic
1181481489 22:23202082-23202104 ATTACTTTGTAGTGGAGTTATGG + Intronic
1181717140 22:24739660-24739682 ATTTCTTTGTAGGGCAGATCTGG - Intronic
1184625079 22:45720555-45720577 ATTGCTGTGCAGTGAACCTCTGG + Intronic
949861791 3:8512119-8512141 ATGGCTTCAGAGTGAAGCTCAGG - Intronic
952285744 3:31967759-31967781 ATTTCATTGTAGTTAATCTCTGG + Intronic
953124209 3:40076164-40076186 ATTGCTTTCCAGTGTTGCTCTGG + Intronic
957014042 3:75043062-75043084 TTTGTTTGGTAGTGAAACTCAGG + Intergenic
958518494 3:95154263-95154285 ACTACTTTGTAGTGAAGCTAGGG + Intergenic
959279155 3:104316265-104316287 GTTGCTGTGGAGTGCAGCTCTGG + Intergenic
959944632 3:112113860-112113882 ATTGCTTTGTAGTGAAGCTCTGG + Intronic
960233137 3:115252513-115252535 ATTGCCTTGTACTGCAGCTATGG - Intergenic
960533535 3:118792341-118792363 TTTGCTTTGTAATGAATCTTAGG + Intergenic
962415419 3:135177549-135177571 ATTGCTTAGATGTGAATCTCAGG + Intronic
963266083 3:143241467-143241489 ATTGGTTTGGGGTGAAGCCCAGG + Intergenic
967673179 3:192263567-192263589 ATTGGTTTGGAGTGTGGCTCAGG - Intronic
974594457 4:63998120-63998142 AGTGCTTTGAAGTGATGCTGGGG + Intergenic
980378684 4:131980045-131980067 ATTGCTTAGTAGTGAAGTCTGGG - Intergenic
983867058 4:172780141-172780163 GCTGCTAGGTAGTGAAGCTCTGG + Intronic
984018280 4:174452319-174452341 ATTACTTGGTACTGAAACTCTGG + Intergenic
987816209 5:22903834-22903856 ATTACTTTGCAGTTAAGATCAGG - Intergenic
991438521 5:66621305-66621327 GTGGCTTTGTAGTGAGGTTCTGG + Intronic
993222810 5:85123685-85123707 ATTGTATTGTAGTGAAGCCTAGG - Intergenic
993698725 5:91093397-91093419 ATTTCTTTTTAGAGAAGCCCTGG - Intronic
993832281 5:92775270-92775292 AATGCTTTGGAGTTGAGCTCTGG - Intergenic
994850214 5:105045458-105045480 ATGGCTTTGTAGTGAAACCCAGG + Intergenic
995231011 5:109763424-109763446 ATTTCTTTGTATTGTAGCTTTGG + Intronic
996484919 5:124021699-124021721 ATTGCTTACTAATGAAGCTTGGG + Intergenic
997772024 5:136564009-136564031 ATTGCATTATGGTGAAGTTCGGG + Intergenic
997830968 5:137149598-137149620 ATTGCATTAAAGTGAAGCACAGG - Intronic
997917436 5:137942162-137942184 ATTGGTTTGCAGTGGAGCTTAGG - Intronic
998023492 5:138792107-138792129 ATAACTGTGTAGTGAAGCTAAGG + Intronic
998181932 5:139951980-139952002 TTTAGTTTGTAGTGAAGCTTTGG + Intronic
998697318 5:144655014-144655036 ATTAGTTTGTTGTGAAGATCAGG - Intergenic
1000480883 5:161772374-161772396 TATGGTTTGTAGTCAAGCTCAGG - Intergenic
1000602033 5:163286607-163286629 AATGCTTTTAAATGAAGCTCTGG + Intergenic
1003276364 6:4656808-4656830 ACTACTTTGTAGTGATCCTCTGG - Intergenic
1006794932 6:36725901-36725923 AGTGCTTTGTGCTGCAGCTCTGG + Exonic
1007920106 6:45599696-45599718 CTTGCTTTGGAGTGAAGTGCAGG + Intronic
1018409224 6:163525097-163525119 ATTGTTTTGTTTTGAATCTCTGG + Intronic
1019569406 7:1703757-1703779 TTTGCTTTGGACTGAAACTCAGG - Intronic
1020516721 7:9130677-9130699 ATTGCCTGGTAGAGATGCTCTGG + Intergenic
1022064864 7:26843002-26843024 ATTGTTTTGTACTGAATCACTGG + Intronic
1023564814 7:41513625-41513647 ATTGCTTTCAAGGGTAGCTCAGG + Intergenic
1024459229 7:49643003-49643025 ATTGCTTGGTGGTGAAGTTAGGG - Intergenic
1024783425 7:52878209-52878231 GTTGCTTACTAGTGAAGCACTGG - Intergenic
1030356728 7:108551681-108551703 ATTGCTGTACAGTGAAACTCAGG - Intronic
1031988889 7:128182921-128182943 TATGCTTTGTTGAGAAGCTCTGG - Intergenic
1033246084 7:139717354-139717376 GTTGCTTTCTACTGAAACTCAGG + Intronic
1033446300 7:141425297-141425319 ATTGTTTTGTAGTAACCCTCTGG + Intronic
1040480322 8:47820066-47820088 GTTGCTTTGTAGAGAAGAGCAGG - Intronic
1041787168 8:61647996-61648018 TTGGCTTTGCAGTGCAGCTCAGG + Intronic
1041872760 8:62653527-62653549 ATTTCTTTGAAGTGAAGAGCTGG - Intronic
1042254951 8:66793076-66793098 ATTCTTTTGTACTGAACCTCTGG - Intronic
1045398216 8:101783471-101783493 ACTGGTTTGTAGTAAAGCTAGGG - Intronic
1047144745 8:122185823-122185845 AGTGCTTTGCACTGAATCTCTGG - Intergenic
1048124253 8:131615415-131615437 ATTGCATTGTAGTGAGGCTCTGG + Intergenic
1048673994 8:136756171-136756193 ATTGCTTTGTGGTGTAGGACTGG - Intergenic
1052087437 9:24284884-24284906 ATTGGTTTGTAGAGATTCTCAGG + Intergenic
1052159019 9:25232224-25232246 ATTGCTTAGTAGTGAAGTCAGGG + Intergenic
1056150966 9:83787877-83787899 TTTGATTTGTAGTGCAACTCTGG + Intronic
1057672903 9:97110737-97110759 AATGCTTTGCGGTGATGCTCAGG - Intergenic
1186607253 X:11105245-11105267 ATTGCTTTGGGGAGGAGCTCTGG - Intergenic
1187201312 X:17136060-17136082 ATTTCTTTGTAGTGAAATTGAGG + Intronic
1187820519 X:23283135-23283157 AGGGCTTTGCAGTGAAGCTGGGG + Intergenic
1190863074 X:54361654-54361676 ATAGCTTTGTGGTGTACCTCAGG - Intergenic
1193191350 X:78574398-78574420 ATTGCTTTGTGGTGTTGTTCTGG + Intergenic
1194427738 X:93760799-93760821 AAGGCTCTGTAGTCAAGCTCAGG + Intergenic