ID: 959944825

View in Genome Browser
Species Human (GRCh38)
Location 3:112115350-112115372
Sequence GAGAGGCCCAGGGCCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 913
Summary {0: 1, 1: 2, 2: 8, 3: 103, 4: 799}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959944825 Original CRISPR GAGAGGCCCAGGGCCCTGGG AGG Intronic
900139685 1:1134488-1134510 GAGACACCCAGGGCCCTGCGAGG - Intergenic
900191976 1:1355822-1355844 GGGAGGGGCAGGGCCCTGGTGGG + Intronic
900414003 1:2526771-2526793 GAGAGGCCCGGGGCTGCGGGCGG + Intergenic
900427060 1:2585723-2585745 GACAGCTCCAGGGGCCTGGGCGG - Intergenic
900466280 1:2827012-2827034 GAGAGGCCCAGGGCCAGGCCTGG + Intergenic
900467879 1:2834700-2834722 GTGTGGCCCAGGGCTCTGGGGGG + Intergenic
900611006 1:3544643-3544665 GAGAGGCCCAAGACCCTGCTGGG - Intronic
900619031 1:3578520-3578542 GACAGGGCAGGGGCCCTGGGGGG + Intronic
900648091 1:3718045-3718067 GGGAGGCCCAGGCCTCAGGGTGG - Intronic
900772278 1:4554657-4554679 GAGAGGCAGAGGGCCGTGGCTGG + Intergenic
901006480 1:6174070-6174092 GAGAGGCCCAGGGCATGGGTGGG + Intronic
901031650 1:6310509-6310531 GAGAGGTCCAGGGACATGGGTGG + Intronic
901195782 1:7439109-7439131 GAGGGGCCCTCGGCCCTGGGAGG - Intronic
901511927 1:9721861-9721883 GTGAGGCCCAAGGCCCTGGGGGG + Intronic
901635824 1:10669718-10669740 CTGAGACCCAGGGCCATGGGCGG - Intronic
902215590 1:14932422-14932444 GGGAAGCCAAGGGGCCTGGGAGG + Intronic
902243116 1:15101775-15101797 GTGAGGACCAGGGCACAGGGTGG + Intronic
902815420 1:18913710-18913732 GAAAGGCCCAGGGCCCCGCCTGG + Intronic
902864396 1:19268865-19268887 GAGGGGCCCAGCATCCTGGGTGG - Intergenic
902869633 1:19306311-19306333 GAGGGGCCCAGCATCCTGGGTGG - Intronic
902926180 1:19697227-19697249 GAGAGGCCCAGGGCACTCCCTGG - Intronic
903277200 1:22229714-22229736 GAGAGAGTCAGTGCCCTGGGAGG - Intergenic
903292889 1:22325907-22325929 GCAAGACCCAGGGCCCTGGAAGG - Intergenic
903372780 1:22847592-22847614 GAGGGGCCCAGGGCCCAGGCAGG + Intronic
903658782 1:24964483-24964505 CAATAGCCCAGGGCCCTGGGTGG - Intronic
903668657 1:25022746-25022768 CAGAGGCCCAGAGCCCACGGTGG - Intergenic
903694646 1:25197787-25197809 GACAGGTCGAGGGCCCTCGGCGG + Intergenic
903816328 1:26066958-26066980 AAGAGGCCCAGAGCTTTGGGAGG - Intronic
903861737 1:26368513-26368535 CATAGGCCCATGGCCCTGGGAGG - Exonic
904499648 1:30906876-30906898 GAGAGGAAGAGGTCCCTGGGAGG - Intronic
905012121 1:34754919-34754941 TCGAGGCTCAGCGCCCTGGGAGG + Intronic
905350009 1:37338939-37338961 TCCTGGCCCAGGGCCCTGGGCGG - Intergenic
905453379 1:38071311-38071333 GAGAGACCCAGGGCCTGGAGCGG + Intergenic
905519807 1:38589142-38589164 GAGAGGCCCTGGGACCTGGCTGG + Intergenic
906083456 1:43109085-43109107 CACAGGCCCAGAGGCCTGGGAGG - Intergenic
906141313 1:43535373-43535395 TAGAAGCCCAGGGCCCAGGGAGG - Intronic
906300770 1:44680073-44680095 GAGATGCAGAGGGCCCTGGAAGG + Intronic
906375340 1:45292189-45292211 GAGTAGCCCAGAGCCCTGGAAGG - Intronic
906480873 1:46198249-46198271 GGGCGGCTCCGGGCCCTGGGAGG - Intronic
906759372 1:48360728-48360750 GAGGGGCCAAGGGCCCTGGGAGG + Intronic
906992645 1:50755407-50755429 GAGCTGCCCAAGGCCATGGGAGG - Intronic
907276938 1:53321886-53321908 AACAGGCCTAGGGCCCTAGGAGG - Intronic
907305053 1:53508638-53508660 GGGAGGCCCAGGGCCCTGCAGGG + Intronic
907459147 1:54594802-54594824 GAGAGGCCCAGGGCCACCAGTGG - Intronic
907735034 1:57104024-57104046 GAGAGGCCCAGGACCCTCCAGGG - Intronic
908386867 1:63651249-63651271 GAGAAGCCCAGGGAGCTTGGAGG + Intronic
909250193 1:73344078-73344100 CACAGGCCCAGGGGCCTAGGAGG + Intergenic
909431315 1:75590560-75590582 GAGGAGCCCAGTGCCCTGAGGGG + Intronic
909561764 1:77015889-77015911 GAGAGACCCAGGGGCCTGTTCGG + Intronic
910004734 1:82382510-82382532 TAGAGGGCCAGGCCCCTGCGTGG - Intergenic
911069682 1:93822889-93822911 GAGAAGCACAGGGCCATGGGTGG - Intronic
911512713 1:98827448-98827470 CACAGGCCCAGAGGCCTGGGAGG + Intergenic
911600268 1:99840874-99840896 GAGAGGCCCAGGTAGGTGGGAGG + Intergenic
911907498 1:103588556-103588578 CACAGGCCCAGAGGCCTGGGAGG - Intergenic
912209247 1:107540786-107540808 CAGAGGCACAGGGTCCAGGGAGG - Intergenic
912365999 1:109134398-109134420 GAGAGGCCCACAGCCCTGTGAGG - Intronic
912504957 1:110150227-110150249 GTGAGGCCCAGGGTCCAGGAGGG + Intergenic
912546252 1:110453761-110453783 GGGAGGCTCAGGGCTCAGGGGGG - Intronic
912546501 1:110455208-110455230 GAGAGGGGCAAGGCCCAGGGAGG - Intronic
912624940 1:111199049-111199071 AAATGGCCCAGGCCCCTGGGAGG + Intronic
913319459 1:117578156-117578178 GTGAGGCCCAGGGCCCTGCCTGG + Intergenic
915117136 1:153608244-153608266 GAGGGACCCAGGGCCTAGGGTGG - Intronic
915285027 1:154847043-154847065 GAGGAGCCCAGGGCTCAGGGAGG - Intronic
915762766 1:158331574-158331596 AAGAGGCTCAGGGCTGTGGGAGG - Intergenic
915895724 1:159809345-159809367 GAGGGAGCCAGGGTCCTGGGTGG + Intronic
916144299 1:161726092-161726114 GAGAGACCAGGGGCCCCGGGAGG + Intronic
916302727 1:163293967-163293989 GAGCTGCCCAAGGCCTTGGGAGG - Intronic
916370921 1:164093168-164093190 GACAAGCCCAGAGGCCTGGGAGG - Intergenic
918045246 1:180937353-180937375 AACAGGCCCAGGGGCCAGGGAGG - Intronic
919461713 1:197884624-197884646 TTGAAACCCAGGGCCCTGGGTGG + Intergenic
920306437 1:205021076-205021098 GAGGAGACCAAGGCCCTGGGAGG + Exonic
920506394 1:206518294-206518316 GCGAGGCCCAGGGCCCTCCCCGG + Intronic
921346505 1:214191336-214191358 CAGAGGCCCAAGTGCCTGGGAGG + Intergenic
922097852 1:222457940-222457962 CATAGGCCCAGGGACCTAGGAGG + Intergenic
922767463 1:228163377-228163399 CTGAGGCCCAGGGACCTTGGGGG + Intergenic
924642849 1:245850212-245850234 GAGAGCCCCAGGACCGTGTGGGG - Intronic
924708850 1:246518445-246518467 GGGAGGACAAGGGCCCTGTGGGG + Intergenic
924778425 1:247126888-247126910 GAGAGGCCCAGCGCGGTGTGCGG + Intronic
924783233 1:247171532-247171554 GAGAGGCCCAGCGCGGTGTGCGG - Intronic
1062996412 10:1870793-1870815 AGGTGGCCCTGGGCCCTGGGGGG + Intergenic
1063231139 10:4066836-4066858 GAGAGCCCCAGGGCCGCTGGTGG - Intergenic
1063565590 10:7170524-7170546 GAGAGTCCCAGTTCCCTGGCTGG - Intronic
1063664127 10:8051609-8051631 CCGAGGCCCAGGTACCTGGGAGG + Intergenic
1063903770 10:10762490-10762512 GAGACACCCAGGGTCCTGGAAGG + Intergenic
1064436185 10:15313137-15313159 TAGAGTCCCAGGGCACTGGATGG + Intronic
1064584147 10:16822893-16822915 CACAGGCCCAGAGGCCTGGGAGG + Intergenic
1064628127 10:17282481-17282503 GACAGGCCCAGAGGCCTAGGAGG + Intergenic
1066298320 10:34075445-34075467 CAGCAGCCCAGGTCCCTGGGAGG - Intergenic
1066367518 10:34791617-34791639 TAGAGTCCCAGTGCCTTGGGAGG + Intronic
1066760433 10:38742738-38742760 GACAGGGCCAGGGCCATGGCAGG - Intergenic
1066961845 10:42232791-42232813 GACAGGGCCAGGGCCATGGCTGG + Intergenic
1066962032 10:42233431-42233453 GGCAGGCCCAGGGCCATGGCAGG + Intergenic
1067091107 10:43266308-43266330 GAGAGGTCCAGGGCCATGCCAGG - Intronic
1067111675 10:43405912-43405934 GACAGGGCAAGGGCCCTGGCAGG + Intronic
1067445608 10:46341779-46341801 GAGAAGCCCATGGCTCTGGAAGG - Intergenic
1067502824 10:46821047-46821069 GAGAAGCCCATGGCTCTGGAAGG - Intergenic
1067561937 10:47310348-47310370 GAGGGGCCCAGTGGCCTGCGCGG - Exonic
1067591766 10:47518964-47518986 GAGAAGCCCATGGCTCTGGAAGG + Intronic
1067638881 10:48027038-48027060 GAGAAGCCCATGGCTCTGGAAGG + Intergenic
1067659562 10:48224235-48224257 GAGTGGCCCAGGGCACTGGAGGG - Intronic
1067957216 10:50805477-50805499 AAGAGGCCTAGGACTCTGGGGGG + Exonic
1069577592 10:69541864-69541886 CAGAGGCCCAGGGGCTTAGGAGG - Intergenic
1069688948 10:70337068-70337090 GCAAGGCCCAAGGCCCTGGCAGG - Intronic
1069729672 10:70602602-70602624 GGGGGGCCTGGGGCCCTGGGTGG - Intronic
1069848525 10:71390173-71390195 GAGAGGCAGAGGGCCCTGGACGG + Intergenic
1069930524 10:71878579-71878601 GTGGGGCCCGGGGACCTGGGGGG + Intergenic
1069996450 10:72344838-72344860 GGGCAGCACAGGGCCCTGGGAGG - Intronic
1070633551 10:78105944-78105966 GAGCTGCCCAAGGCCATGGGAGG + Intergenic
1070702262 10:78612781-78612803 GAGAGGCCAGGGGCCCAGAGGGG + Intergenic
1070828687 10:79405726-79405748 GTGAGGGCCACAGCCCTGGGAGG + Intronic
1070846110 10:79523834-79523856 GAGGGAGCCTGGGCCCTGGGAGG + Intergenic
1070927688 10:80236476-80236498 GAGGGAGCCTGGGCCCTGGGAGG - Intergenic
1071197155 10:83175082-83175104 GAGACGCTCCAGGCCCTGGGTGG + Intergenic
1071618169 10:87094957-87094979 CGGAGGCCCGGCGCCCTGGGCGG - Intronic
1071816353 10:89235611-89235633 GAGAAGGCCAGTGCCTTGGGAGG - Intronic
1072035722 10:91561385-91561407 GAGCTGCCCAAGGCCATGGGAGG - Intergenic
1072680618 10:97503570-97503592 GACAGACCCAGGGCCCTGTTTGG + Intronic
1073102058 10:101011661-101011683 CAGAGTCCCAGAGCCCAGGGAGG - Intronic
1073447734 10:103591323-103591345 GGATGGGCCAGGGCCCTGGGTGG + Exonic
1073484011 10:103805248-103805270 GAGAAACCCAGGGGCCAGGGTGG + Intronic
1073706565 10:105990257-105990279 GTGATCCCCAGGCCCCTGGGTGG - Intergenic
1074016805 10:109542681-109542703 TTGAAGCCCAGGGCCCTGGTAGG + Intergenic
1074313550 10:112342785-112342807 GAGAGGCCCTGGGCCCAGAGCGG - Intergenic
1074531427 10:114301319-114301341 GAGAGGCCCAGGCCACTGCCTGG + Intronic
1074711750 10:116183640-116183662 GAAAGGCCCTGGGCTCTGGCAGG + Intronic
1074859775 10:117501571-117501593 GGCAGGGCCAGGGGCCTGGGCGG + Intergenic
1075089426 10:119435149-119435171 CACAGGCCCAGGGGCCTAGGAGG - Intronic
1075102416 10:119515765-119515787 GAGAGCCCCTGGGCTGTGGGGGG - Intronic
1075238663 10:120757109-120757131 GAGAAGCCCAGGGCCATAGATGG - Intergenic
1075581356 10:123620842-123620864 GAGAGTCCCAGGGCCCAGGTGGG - Intergenic
1076262418 10:129078330-129078352 GAGATGCCAAGGGCCCTGCCAGG + Intergenic
1076369464 10:129942093-129942115 GAGAGGCCTGGTGCCCTGAGTGG - Intronic
1076407153 10:130220244-130220266 GAGAGGCCATTGGCCCTGGAGGG + Intergenic
1076480113 10:130779406-130779428 GAGTGACCCAGGGCGCTGGTTGG + Intergenic
1076535353 10:131173672-131173694 GAGAAGCCCAGGGGCCTGAGGGG + Intronic
1076692881 10:132232735-132232757 GAAAAGCCCAGGGCTCCGGGTGG - Intronic
1076692896 10:132232791-132232813 GAAAAGCCCAGGGCTCCGGGTGG - Intronic
1076733605 10:132449502-132449524 GGAAGGCCCTGGGCCCTGGAAGG + Intergenic
1076790470 10:132774568-132774590 GAGAGACCAACGGGCCTGGGAGG - Intronic
1076799611 10:132814572-132814594 AGGAGGCCCAGGGCCCAGGTGGG - Exonic
1076820954 10:132939355-132939377 GAGAGGCCCAGACCCCTGAGAGG - Intronic
1077008203 11:369075-369097 GAGGGACCCGGGGTCCTGGGGGG - Intergenic
1077032001 11:472533-472555 GAGACCCTCAGGGCTCTGGGTGG + Intronic
1077091066 11:778501-778523 CAGGGGGCCAGGGACCTGGGCGG - Intronic
1077105513 11:840663-840685 GAAATGCCCAGAACCCTGGGTGG + Intronic
1077190871 11:1255580-1255602 GAGAGGCCGAGGGGTCTGGGGGG - Intronic
1077190893 11:1255639-1255661 GAGAGGCCGAGGGGTCTGGGGGG - Intronic
1077190915 11:1255698-1255720 GAGAGGCCGAGGGGTCTGGGGGG - Intronic
1077190937 11:1255757-1255779 GAGAGGCCGAGGGGTCTGGGGGG - Intronic
1077190959 11:1255816-1255838 GAGAGGCCGAGGGGTCTGGGGGG - Intronic
1077190981 11:1255875-1255897 GAGAGGCCGAGGGGTCTGGGGGG - Intronic
1077191003 11:1255934-1255956 GAGAGGCCGAGGGGTCTGGGGGG - Intronic
1077191025 11:1255993-1256015 GAGAGGCCGAGGGGTCTGGGGGG - Intronic
1077191047 11:1256052-1256074 GAGAGGCCGAGGAGTCTGGGGGG - Intronic
1077197437 11:1288464-1288486 CAGAGGGCAGGGGCCCTGGGTGG - Intronic
1077384376 11:2262043-2262065 GAAAGGCCTAGGGCCCCGTGTGG - Intergenic
1077399966 11:2350080-2350102 GAGTGGCCCAAGGCCTGGGGTGG + Intergenic
1080182564 11:29442616-29442638 GAGCTGCCCAAGGCCTTGGGAGG - Intergenic
1080385816 11:31810598-31810620 GAGCGGCGCAGGGCTCGGGGCGG - Intronic
1081112128 11:39149284-39149306 GAGGTTCCCTGGGCCCTGGGTGG - Intergenic
1081246378 11:40771410-40771432 CATAGGCCCAGAGCCCTAGGAGG - Intronic
1081633018 11:44702106-44702128 GAGAAGACCAGGGCTGTGGGAGG - Intergenic
1081650131 11:44818324-44818346 GTGAGGGTCAGGGCCCTGGGAGG - Intronic
1082807335 11:57459438-57459460 GATAGGCTCGGGGCCCTCGGGGG - Intergenic
1082970277 11:59012991-59013013 GAGATCCCCCAGGCCCTGGGTGG - Intronic
1083227756 11:61295308-61295330 GAGAGGCGCGGAGCCCGGGGCGG + Exonic
1083302627 11:61746758-61746780 GAGTCGCCCAGGCCCCTGGGAGG - Exonic
1083430745 11:62612654-62612676 GAGAGTCCGAGGGCCCGGGGGGG - Exonic
1083437570 11:62653172-62653194 GAGAGGCGCGGGACCGTGGGTGG + Exonic
1083681734 11:64354645-64354667 CAGAGGAACAGGGCCCTGGATGG - Intronic
1083710159 11:64543007-64543029 CGGAGGCCCCGGGCCCGGGGAGG + Intergenic
1083749562 11:64753783-64753805 CAGAGTCTCAGGGCCCTGGCTGG + Intronic
1084033678 11:66495285-66495307 CAGAGCCCCAGGGTACTGGGAGG + Intronic
1084313442 11:68330200-68330222 CAGAAGCTCAGGGGCCTGGGAGG - Intronic
1084358352 11:68653830-68653852 GGCAGGAGCAGGGCCCTGGGCGG + Intergenic
1084450607 11:69234580-69234602 CAGAGGTCCAGGGCGATGGGTGG - Intergenic
1084519790 11:69656188-69656210 GGCAGGGCCGGGGCCCTGGGTGG + Intronic
1084671793 11:70611401-70611423 GAGCAGCCCAGGGCTCTGGCTGG - Intronic
1087831769 11:102826426-102826448 CACAGGCCCAGAGGCCTGGGAGG - Intergenic
1088268418 11:108009247-108009269 GACGGGCCCTGGGCCCTGGTGGG + Exonic
1088595016 11:111434986-111435008 GAGAGTCCCAGGGCCAGGTGAGG - Intronic
1088821907 11:113463827-113463849 GAGAGGCCCTTGGCCCAGGTAGG + Intronic
1089349960 11:117816626-117816648 GAAAGGCCCAGGGCAGGGGGTGG - Intronic
1089502422 11:118940375-118940397 GAGAGGCCCCGGGGGGTGGGGGG + Intronic
1089818377 11:121197897-121197919 CAGAGGGCCAGGGCTGTGGGTGG + Intergenic
1090187004 11:124745645-124745667 GGAAGGGCCCGGGCCCTGGGGGG + Exonic
1090249990 11:125244475-125244497 GAGGGAGCCAGGTCCCTGGGAGG - Intronic
1091018130 11:132072762-132072784 GAGAGGCACAGGGGCCTCTGCGG + Intronic
1091044710 11:132315383-132315405 GAGAGGCCCAGGGCCCTGCCTGG - Intronic
1091150334 11:133322739-133322761 GATAGAACCAGGGCCTTGGGTGG - Intronic
1091225982 11:133956637-133956659 GAGGGGCCGAGGGCGCCGGGAGG + Intronic
1091395941 12:154336-154358 GGGAGGCCCAGGGCACTGTGGGG - Intronic
1091584819 12:1810177-1810199 GAGAGCCCCACGGCCCCAGGAGG - Intronic
1091754172 12:3040968-3040990 GAGAGGCCCCATCCCCTGGGGGG + Intergenic
1091778618 12:3200284-3200306 GCGGGGCCGAGGGCCCGGGGAGG + Intronic
1091935005 12:4428043-4428065 GATAGTCCCAGGGCCCTGAGTGG + Intergenic
1092112148 12:5971366-5971388 GAGAAGCCCAGGGCCCTCCCAGG - Intronic
1092261016 12:6953383-6953405 GAGAGGAGCAGGGCCCCAGGAGG + Intronic
1094870854 12:34598509-34598531 GAGAGTCTCAGGCCCCCGGGGGG + Intergenic
1096211912 12:49773164-49773186 GGGAGGCCCAGGTCTGTGGGTGG + Intergenic
1096491010 12:52013030-52013052 GGGTAGCCCAGGGTCCTGGGTGG + Intronic
1096499349 12:52055682-52055704 GAGAGGGCCAAGGGGCTGGGGGG - Intronic
1096556233 12:52405835-52405857 CAGTGGCCCAGGGCCGTGAGAGG - Intronic
1096627255 12:52903571-52903593 GAGGGGCCCCGGGCCCCCGGCGG - Intronic
1096842076 12:54385720-54385742 GTCAGGCCCAGGCCCCTGGGGGG - Intronic
1097188425 12:57208215-57208237 GGGTGGGCAAGGGCCCTGGGGGG + Exonic
1097648013 12:62260127-62260149 GAGAGAGCCAGAGCCCTCGGCGG + Intronic
1097929569 12:65169490-65169512 GAGATGCCCGCGGCGCTGGGAGG + Intergenic
1098592260 12:72227932-72227954 GAGCTGCCCAAGGCCATGGGAGG - Intronic
1098736483 12:74112079-74112101 GAGGTGCCCAGAGCTCTGGGAGG + Intergenic
1099558997 12:84149048-84149070 GAGAGGCCCAAGGCCCTGGGAGG + Intergenic
1099907593 12:88790456-88790478 CACAGGCCCAGAGGCCTGGGAGG - Intergenic
1102244553 12:111347417-111347439 GAGAGCCCCAGGGCAGTGGGTGG + Intronic
1102318026 12:111905523-111905545 GAGTTTCCCCGGGCCCTGGGTGG - Intergenic
1102443284 12:112979742-112979764 CGGGGGCCCAGGGCTCTGGGGGG - Intronic
1102458557 12:113086385-113086407 GAGAGGCTCAGGGCAATCGGTGG + Intronic
1102534423 12:113570043-113570065 GAGAGGGCCGGGGCCCAGGCTGG + Intergenic
1102648524 12:114419734-114419756 GAAAGGCCCAGGGGACGGGGAGG - Intergenic
1102825841 12:115947242-115947264 CAGGGGGCCAAGGCCCTGGGGGG - Intergenic
1103327621 12:120131883-120131905 GAGAGGCCCAGGTCCCTGAAGGG + Intronic
1103408467 12:120693078-120693100 GAGAGGGCCAGGGCCAAGAGAGG + Intronic
1103414843 12:120737144-120737166 GTGTGTCCCAGGGGCCTGGGAGG - Intronic
1103482712 12:121261300-121261322 GAGGGGCCCTGGGTCCTGGCAGG - Intronic
1103558292 12:121779001-121779023 GATAGGCCCAGCCCCCTCGGTGG + Exonic
1103728340 12:123010161-123010183 GCAAGGCCCAGAGTCCTGGGAGG - Intronic
1104224480 12:126818381-126818403 GAGAGACCCAGGTTCCTGGAAGG - Intergenic
1104888659 12:132127742-132127764 GAGAAGCCTTGGGCCCAGGGAGG + Intronic
1104980522 12:132571373-132571395 CAGAGCCCCCGGGCCCAGGGAGG - Exonic
1105694087 13:22871385-22871407 CACAGGCCCAGAGGCCTGGGAGG + Intergenic
1105918799 13:24941580-24941602 GAGGGGGCCCGGGGCCTGGGAGG - Intergenic
1106072300 13:26424470-26424492 GTGGGGCCCGGGGCCCTAGGCGG - Intergenic
1107188333 13:37549660-37549682 CACAGGCTCAGGGACCTGGGAGG + Intergenic
1108274203 13:48791379-48791401 GAGAGGTGCAGTGCCCAGGGAGG - Intergenic
1109717355 13:66234192-66234214 CACAGGCCCAGAGCCCTAGGAGG + Intergenic
1110448702 13:75617490-75617512 GAGTGCCCCTGGGCACTGGGTGG + Intergenic
1110627259 13:77665250-77665272 GAGAAGGCCAGGGGCCTGTGGGG - Intergenic
1111568439 13:90047518-90047540 GAGATGCCCAAGCCCTTGGGAGG - Intergenic
1113786330 13:113003808-113003830 CAGAGGCCTAGGGACCTGGAAGG + Intronic
1113908486 13:113831084-113831106 GGGAGGCCCAGCGCTGTGGGCGG + Intronic
1114268441 14:21087106-21087128 GTGAGGGCCAGGGTGCTGGGGGG + Intronic
1114319747 14:21537285-21537307 GAGAGGCCCAGGGCCCTTGCAGG - Intergenic
1115850175 14:37584447-37584469 GTGGGGCCCAGGGCCCGGTGGGG + Intergenic
1115910934 14:38255767-38255789 GGCAGGCCCAGGGCCCGGAGGGG - Exonic
1116713373 14:48397426-48397448 GAGATGCCCAAGTCCTTGGGAGG + Intergenic
1117699673 14:58400281-58400303 TATAGTCCCAGGTCCCTGGGAGG + Intronic
1117828403 14:59726965-59726987 TAGAGGCCCAGGGCCCTTTGTGG + Exonic
1117962577 14:61177875-61177897 CAGAGGCCCAGGGCACGGAGGGG - Intergenic
1118454067 14:65929426-65929448 GGGAGGCTGAGAGCCCTGGGGGG + Intergenic
1118498317 14:66331091-66331113 GAGTGACTCAGGGCTCTGGGAGG - Intergenic
1119170204 14:72529195-72529217 GAGAGGCCCAGGCCAGAGGGAGG + Intronic
1120143644 14:80955720-80955742 GACCTGCCCAGGGACCTGGGCGG + Exonic
1121124474 14:91397253-91397275 GACAGCCACAGGGGCCTGGGTGG + Intronic
1121312813 14:92944316-92944338 GAGAGGCCCAGGGCTCTGGCAGG - Intronic
1121535156 14:94686117-94686139 GAGAGACCCAGGCACCTGGGAGG + Intergenic
1121717783 14:96088617-96088639 GAGAAGCCCAGAGCCATGGCGGG + Exonic
1122158882 14:99768558-99768580 GACAGGCCCAGGGCCAGGAGTGG + Intronic
1122204031 14:100139433-100139455 GAGAGGGCCAGGGCCTGGCGAGG + Intronic
1122264884 14:100541909-100541931 CAGCAGCCCCGGGCCCTGGGTGG - Intronic
1122298807 14:100720280-100720302 GGGAGGGCCAGGACCCTCGGTGG + Intergenic
1122399649 14:101459047-101459069 GAAAGGCCCGAGGCCCTGGAAGG + Intergenic
1122489128 14:102101661-102101683 GAGAGTCCCAGGTCCCTGCCTGG - Intronic
1122623822 14:103074189-103074211 GAGAAGCCCAGAGCCAAGGGAGG - Intergenic
1122786174 14:104164235-104164257 GAGAGGCCGAGGGCTGTGGGGGG + Intronic
1122789810 14:104179448-104179470 GAGAGCAACAGGGCTCTGGGAGG - Intronic
1122795079 14:104201976-104201998 GAGAGGGCCTGGGCTCTGGGAGG - Intergenic
1122834984 14:104426365-104426387 GAGAGGCCCAGGGCTCTAGAGGG - Intergenic
1122941659 14:104984251-104984273 TTGAGGCCCAGGGAGCTGGGAGG - Intergenic
1123019697 14:105391855-105391877 GACAGGCCAGGTGCCCTGGGAGG - Intronic
1123075299 14:105664874-105664896 GTGAGGCCCTGGCACCTGGGTGG - Intergenic
1124137761 15:27049792-27049814 GAGAAGAGCAGGGCTCTGGGAGG + Intronic
1124150658 15:27175139-27175161 GAGACAGCCAGTGCCCTGGGTGG - Intronic
1125341431 15:38679438-38679460 TAGAGGCCCAGTGGCCTGGAGGG + Intergenic
1126377924 15:48014772-48014794 TAGAGGCCCAGGGCCCAAGTGGG - Intergenic
1127303981 15:57684082-57684104 GAGAGGCCCCAGGCCCAGCGTGG - Intronic
1127641433 15:60919322-60919344 GAGAAGCCCAGGGCCCAGCAGGG + Intronic
1127884565 15:63188321-63188343 GAGAGACACAGAGCCCTGGCAGG + Intergenic
1127980412 15:64030648-64030670 TAAAGGCCCAGGGCTCAGGGTGG - Intronic
1128262339 15:66241169-66241191 TAGAGACCCTGGGCCCTGGGAGG - Intronic
1128322560 15:66703482-66703504 GAGGCGCCCAGGGCGCGGGGAGG + Exonic
1128556001 15:68632049-68632071 GAGAGGCCTGGGAGCCTGGGAGG - Intronic
1128738067 15:70064731-70064753 GGGAGGCCCAGTCCCCAGGGTGG + Intronic
1128772417 15:70292178-70292200 GCAAGGCCCAGGGCAGTGGGAGG + Intergenic
1129144265 15:73633131-73633153 GAGCGGCGCCTGGCCCTGGGAGG + Exonic
1129165575 15:73775358-73775380 CTGAGGCCCTGGGCCCTGGTGGG + Intergenic
1129275555 15:74442975-74442997 CAGAGGCCAAGGGCAGTGGGAGG + Intergenic
1129602817 15:77010099-77010121 GGGAGGCCGTGGGCCCTTGGGGG - Intronic
1129686079 15:77686806-77686828 GGGAGGCCCAGGGGACTGGCAGG - Intronic
1129698177 15:77752487-77752509 CAGAGCCCCAGAGCCCTGTGGGG - Intronic
1129738404 15:77978201-77978223 GGTAAGCGCAGGGCCCTGGGTGG - Intergenic
1129847669 15:78775408-78775430 GGTAAGCGCAGGGCCCTGGGTGG + Intronic
1129921018 15:79319262-79319284 GAGAGTCCCATAGCCTTGGGAGG + Intronic
1130254234 15:82318501-82318523 GGTAAGCGCAGGGCCCTGGGTGG - Intergenic
1130327967 15:82896584-82896606 GGGAGGCACAGAGACCTGGGAGG + Intronic
1130353091 15:83108069-83108091 GAGGGGCCCAGGGGCCGGTGGGG + Intronic
1130600735 15:85271469-85271491 GGTAAGCGCAGGGCCCTGGGTGG + Intergenic
1130859692 15:87875262-87875284 GAGGGGCCCCGTGGCCTGGGAGG + Intronic
1130991895 15:88880466-88880488 GAGAGGCCCAGGGCTCTAAGGGG + Intronic
1131277421 15:90994096-90994118 TCGAGGCCCGGGGCCCGGGGCGG - Intronic
1132252655 15:100345836-100345858 GAGGAGCCCAGAGCCCAGGGTGG - Intergenic
1132299586 15:100767742-100767764 GAGACATCCAGGGCCCTGGCCGG + Intergenic
1132498758 16:275689-275711 GCGAGGCCTGGGGCCCTTGGGGG - Intronic
1132592238 16:731099-731121 GAGAGGGAGAGAGCCCTGGGAGG - Intronic
1132641397 16:980200-980222 GAGGGGGCCAGGGCCTTTGGAGG - Intronic
1132657102 16:1045964-1045986 GGGCTGCCCAGGGCCCCGGGCGG + Intergenic
1132676126 16:1121940-1121962 GACAGGCCCAGGGACCCGAGAGG - Intergenic
1132702859 16:1229474-1229496 GGGCTGCCCAGGGCCCTGAGTGG - Intronic
1132705467 16:1241394-1241416 GGGCTGCCCAGGGCCCTGAGTGG + Intronic
1132708595 16:1256757-1256779 GGGCTGCCCAGGGCCCTGAGTGG + Intronic
1132715244 16:1286797-1286819 GTGAGGCGCAGGGGCCTGGCGGG + Intergenic
1132740149 16:1408135-1408157 GAGAGGCCCGGGGTCCCGCGGGG + Intronic
1132753804 16:1472059-1472081 GACAGGCCCAGTGCCCTGTGCGG - Intronic
1132846971 16:2005150-2005172 GAAAGGCCCTGGGCCTTGTGCGG + Intronic
1132855345 16:2042451-2042473 TAGAGGCCCCCGGCCCTTGGTGG + Intronic
1133020964 16:2966807-2966829 GCGGGGACCAGGGGCCTGGGCGG + Intronic
1133027826 16:2996395-2996417 CGGGGGCCCAGGGCCCTGGGAGG - Intergenic
1133029160 16:3001474-3001496 CAGAAGCTCAGGTCCCTGGGAGG + Intergenic
1133034740 16:3028454-3028476 GACAGCTCCAGGGCCCTAGGCGG + Exonic
1133295331 16:4749132-4749154 GAGAGGGCCTGGGGGCTGGGAGG - Exonic
1134024646 16:10944644-10944666 GAGCGGCCCAGCGCCCGCGGCGG - Exonic
1134211215 16:12279252-12279274 CAGAGGCCCAGGGCCTTGGAGGG + Intronic
1134332018 16:13259833-13259855 CACAGGCCCAGAGGCCTGGGAGG - Intergenic
1134683345 16:16141830-16141852 CAGTGTCCCAGGGCCCTGGATGG + Exonic
1135822111 16:25693251-25693273 GAGAGGCCCAAGCCCCCGCGAGG + Intronic
1136170114 16:28484073-28484095 CTGAGGCCCAGGACCCTGGAGGG - Exonic
1136288465 16:29257918-29257940 GAGAGGCCACGGGGCCAGGGAGG - Intergenic
1136290379 16:29268057-29268079 GACAGGCTCAGGGTCCTGGCAGG + Intergenic
1136375446 16:29862762-29862784 GAGAGGGCGAGGGGCCTTGGCGG - Intronic
1136458297 16:30394964-30394986 GAGAGGCCGAGGGCCCGGGGTGG - Intronic
1136513538 16:30753940-30753962 CTGAGGCCCAGGGCCCAGGTGGG - Intronic
1136540204 16:30924314-30924336 GAGGGGCCGAGCGCCCTCGGGGG + Intronic
1136723174 16:32339780-32339802 GAGAGGGACAGGGCCATGGTAGG + Intergenic
1136841496 16:33545784-33545806 GAGAGGGACAGGGCCATGGTAGG + Intergenic
1137057161 16:35751270-35751292 GAGAGGTCCCGGGCCCTGGTGGG - Intergenic
1138081253 16:54093428-54093450 GAGAAGCCCAGCTCCCTGGCAGG + Intronic
1138577330 16:57916337-57916359 GAGAGGCCCAGCCCCCAGGGAGG + Intronic
1139291132 16:65859089-65859111 GAGGCACCCTGGGCCCTGGGGGG - Intergenic
1139359588 16:66389430-66389452 GAGATGCCCAGGGCCTCCGGGGG + Exonic
1139418867 16:66835972-66835994 GAGAGGGCTAGTGGCCTGGGAGG - Intronic
1139455808 16:67075098-67075120 GAGAAGCCCATGAACCTGGGAGG + Intronic
1139561377 16:67744524-67744546 GAGAGGCTGAGAGACCTGGGTGG - Intronic
1139682394 16:68575159-68575181 GGCAGGCCCAGGGCCAAGGGAGG - Intronic
1140068138 16:71626961-71626983 GAGAGGCCCCGGGACCCGAGAGG + Intronic
1141172085 16:81697863-81697885 TAGATGCGCAGGGCCCTGAGAGG - Intronic
1141456334 16:84144941-84144963 GAGGGGGCCCGGGGCCTGGGGGG + Intronic
1141579335 16:84986536-84986558 GCAGGGCCCAGGGCCGTGGGTGG + Intronic
1141593184 16:85082029-85082051 GAGGAGACCAGGGCCCTGAGAGG - Intronic
1141593802 16:85085628-85085650 GGGAGGCCCCAGGCCCTGGAGGG + Intronic
1141842852 16:86585253-86585275 GAGAAGCCAAGAGCTCTGGGTGG - Intergenic
1141993109 16:87621513-87621535 GGGAAGCCCTGGGGCCTGGGGGG - Intronic
1142022163 16:87790659-87790681 GAGCGCCCCAGGGCTCTGGTGGG - Intergenic
1142094179 16:88230824-88230846 GAGAGGCCACGGGGCCAGGGAGG - Intergenic
1142096260 16:88241578-88241600 GACAGGCTCAGGGTCCTGGCAGG + Intergenic
1142129952 16:88427925-88427947 TCCAGTCCCAGGGCCCTGGGGGG - Exonic
1142182672 16:88678858-88678880 CAGTGGCCAAGGGCCCCGGGAGG - Intronic
1142190041 16:88713279-88713301 GAGCGTCTCAGGGGCCTGGGGGG - Intronic
1142207856 16:88792494-88792516 GTGAGGCGCAGAGCCCTGCGTGG + Intergenic
1142227390 16:88884278-88884300 CAGAGGCCCAGGGCCCGGTGGGG - Intronic
1142304754 16:89278960-89278982 GAGAGGTCAAGGGCCATGAGTGG + Intronic
1142324197 16:89403456-89403478 GCGAGGCCCCGCGCTCTGGGAGG + Intronic
1142358965 16:89617308-89617330 CCAAGGCCCAGGGCCCTGAGAGG + Intronic
1142381939 16:89737926-89737948 GCGAGGGCCACAGCCCTGGGAGG - Exonic
1142417301 16:89949483-89949505 GCGAGCCCCTGGGCCCTGGCAGG + Exonic
1203003257 16_KI270728v1_random:177984-178006 GAGAGGGACAGGGCCATGGTAGG - Intergenic
1203124297 16_KI270728v1_random:1561361-1561383 GAGAGGGACAGGGCCATGGTAGG - Intergenic
1203134865 16_KI270728v1_random:1714391-1714413 GAGAGGGACAGGGCCATGGTAGG - Intergenic
1203151661 16_KI270728v1_random:1846081-1846103 GAGAGGGACAGGGCCATGGTAGG + Intergenic
1142561109 17:809503-809525 AAGGGGTCCAGGACCCTGGGAGG + Intronic
1142570255 17:868981-869003 GAGCTTCCCAGGGCCCCGGGTGG + Intronic
1142610910 17:1108901-1108923 GACACGCCCTGGGCGCTGGGGGG - Intronic
1142681259 17:1550283-1550305 GGTGGGCACAGGGCCCTGGGTGG + Intronic
1142781272 17:2182965-2182987 GAGAGGCCCAGCACTGTGGGAGG + Intronic
1143120892 17:4606068-4606090 AGGAGGCAGAGGGCCCTGGGGGG + Intronic
1143509421 17:7387264-7387286 AGGAGACCCAGGGCCCAGGGTGG - Intronic
1143626761 17:8114691-8114713 GAGAGACCCAGGGACTTGGAAGG - Intronic
1143649800 17:8256449-8256471 GGGAGGCCCCAGGCCCTGGTTGG + Intronic
1144685127 17:17221108-17221130 GGGAAGCCCAGGCACCTGGGAGG + Intronic
1145165780 17:20612641-20612663 GCGAGCCCCTGGGCCCTGGCAGG + Intergenic
1145249027 17:21287395-21287417 GGGAGGCCCAGTGCCCAGGATGG - Intronic
1148072178 17:44914912-44914934 GGGAGGCCCAGGGAGCAGGGAGG + Intronic
1148185662 17:45641695-45641717 GAGGTGCCCAGGGCCCAGGAAGG + Intergenic
1148469533 17:47884632-47884654 GACAAGCCCAGGGGCCTGGAAGG + Intergenic
1148798790 17:50210460-50210482 TGGAGACCCAGGACCCTGGGGGG - Intergenic
1149300945 17:55304291-55304313 GAGAGGCTCCCGGCCCAGGGAGG + Intronic
1150300044 17:64040231-64040253 GAGAAGCCCAGCGCCCTGGAAGG - Exonic
1150704888 17:67477757-67477779 GGGAAGCCCAGGGCCCTCGATGG - Intronic
1151433434 17:74080164-74080186 GAGTTACCCAGGGCCCTGGGTGG - Intergenic
1151508438 17:74543993-74544015 AGGAGCCCCAGAGCCCTGGGTGG - Intronic
1151653636 17:75485434-75485456 GACAGGCCCAGGGCTGAGGGAGG - Exonic
1151765923 17:76133024-76133046 GAGAGTCACTGGGCCCTGGGTGG + Intergenic
1152259861 17:79261000-79261022 GAGAGGCCCCGGCCCCAGGACGG - Intronic
1152260361 17:79263471-79263493 GCGGGGCCCTGGGCCCTGGCTGG + Intronic
1152476257 17:80520423-80520445 GAGATGACCACGGCCTTGGGGGG - Intergenic
1152567998 17:81108693-81108715 AAGAGGGGCAGGGCCCAGGGGGG - Intronic
1152646068 17:81469096-81469118 GAGGGGCCCAGGTTCCTGGTAGG - Intergenic
1152697589 17:81804579-81804601 GCGGGGCCCGGGGCCCTGAGTGG - Intronic
1152747679 17:82048854-82048876 GCGGGGGCCAGGGCCGTGGGCGG + Intronic
1152760071 17:82103187-82103209 GAGGGGCCCAGGGCCAGGGCTGG - Intronic
1152794541 17:82300751-82300773 GAGAGGGCGACAGCCCTGGGGGG + Intergenic
1152858495 17:82680220-82680242 GAGAGACCCAGGCCCCAGTGTGG - Intronic
1203172105 17_GL000205v2_random:157846-157868 GAGAGGCCTAGAGACTTGGGCGG - Intergenic
1153149100 18:2069886-2069908 GAGAGGGCCAGGGCCTCGGAGGG - Intergenic
1153842186 18:9017063-9017085 GTGAGGCCCAGGGCCCTGCCGGG + Intergenic
1154092910 18:11381494-11381516 CAGAGGCCCAGAGGCCTTGGAGG - Intergenic
1156078476 18:33308208-33308230 GAGCTGCCCAAGGCCATGGGAGG + Intronic
1156290944 18:35748130-35748152 GACAGGCAGAGGGCTCTGGGTGG + Intergenic
1156736208 18:40262999-40263021 GACAGGCCCAGAGGCCTAGGAGG + Intergenic
1157176887 18:45459961-45459983 GAGAGCCCCAGGTACCTGGTGGG - Intronic
1157489361 18:48111560-48111582 GAGAAGACCAGAGCCCTGGCTGG + Intronic
1158579966 18:58672043-58672065 GCGGGGCCCAGGGCTCTGGAGGG + Intronic
1159461232 18:68724234-68724256 CAGAGGCCCAGAGGCCTAGGAGG - Intronic
1159927366 18:74281396-74281418 GAAAAGCCCAGGCCCCAGGGGGG + Intronic
1160482726 18:79257404-79257426 AAGAGGCCAAGGGCACTGGATGG - Intronic
1160488934 18:79320473-79320495 GAGAGGCCCAGGGCCAGGCCAGG + Intronic
1160691611 19:462898-462920 GAGAGACCCAGGGCGAGGGGAGG - Intergenic
1160739553 19:679727-679749 CAGAGGCCTAGGGCTGTGGGGGG + Intronic
1160789170 19:915217-915239 GACAGGCCCAGGCCCCTGAAGGG - Intergenic
1160851626 19:1195549-1195571 GAGAGGCCCAGGTCCCAGGTGGG - Intronic
1160851650 19:1195623-1195645 GAGAGGCCCAGGTCCCAGGTGGG - Intronic
1160851809 19:1196278-1196300 GAGAGGCCCAGGCTCCAGGTCGG - Intronic
1160851841 19:1196417-1196439 GAGAGGCCCAGGTTCCTGGCGGG - Intronic
1160852050 19:1197363-1197385 GAGAGGCCCAGGTCCCAGGTGGG - Intronic
1160852074 19:1197437-1197459 GAGAGGCCCAGGTCCCAGGTGGG - Intronic
1160852233 19:1198092-1198114 GAGAGGCCCAGGCTCCAGGTCGG - Intronic
1160852265 19:1198231-1198253 GAGAGGCCCAGGTTCCTGGCGGG - Intronic
1160879776 19:1314139-1314161 GAGGGTCCCAGGGACCTGGGGGG - Intergenic
1160884477 19:1339169-1339191 GAGATGCTGGGGGCCCTGGGTGG - Intergenic
1161067352 19:2245311-2245333 AGGAGGGCCAGGGGCCTGGGAGG - Intronic
1161378041 19:3950200-3950222 GAGAGGCCCTGGGAGGTGGGGGG + Intergenic
1161398675 19:4058323-4058345 GAGAGGGCCAAGGCCTTGGCTGG - Intronic
1161582089 19:5086649-5086671 CAGAGGCCCTGGGGGCTGGGGGG - Intronic
1161705532 19:5819098-5819120 GAGAGGTCCGGGGCCCGGGTAGG + Intergenic
1163276324 19:16286566-16286588 GAGAGGCCAAGGGCTGTGGCCGG + Intergenic
1164033118 19:21428396-21428418 GAGATGGCCAGGAACCTGGGAGG + Intronic
1164406930 19:27957482-27957504 GAGAAGCCCATGGCTCTGGAAGG - Intergenic
1164473113 19:28552366-28552388 GACATGCCAAGGACCCTGGGTGG - Intergenic
1165091562 19:33390787-33390809 GTGCGGCCCAGGGGCCTGGGAGG + Intronic
1165115105 19:33523894-33523916 GAGAGGGCAGGGGACCTGGGTGG - Intergenic
1165316561 19:35059866-35059888 GAGTGGGTCAGTGCCCTGGGCGG - Exonic
1165327787 19:35124408-35124430 GAGCGGCCCAGGTCCCAGGGAGG - Intergenic
1165356396 19:35306847-35306869 TAGAGGCCCAGGAGCCTGAGTGG + Intronic
1165722504 19:38089656-38089678 GAGAAGCCCATGGTCCTGGCTGG + Intronic
1165901648 19:39172205-39172227 GAGAGGCCCTGGGCGCAGGGGGG + Intronic
1165991266 19:39816077-39816099 GGGAGGCCAAGAGCCCAGGGAGG + Intergenic
1166077313 19:40421203-40421225 GAGAGGCGCAGGGGGCTGGACGG - Intergenic
1166231420 19:41427445-41427467 GAGGGCCCCAGGGGCCGGGGCGG + Exonic
1166301804 19:41915344-41915366 GAGGGGTCCAGGTCCCTGTGGGG - Intronic
1166313860 19:41977899-41977921 GGGATGTCCAGGGCCCTGGCTGG + Intronic
1166838720 19:45683256-45683278 GAGAGGCACTGGGTCCTGAGAGG + Exonic
1167255395 19:48424867-48424889 AAAAGTCCCAGGGTCCTGGGGGG - Intronic
1167348602 19:48961916-48961938 GAGAGCCCCACGTCCCTGAGTGG - Intergenic
1167838664 19:52095888-52095910 GGGAGGCCCAGGGCGGTAGGGGG + Intergenic
1168245966 19:55113339-55113361 GACAGACTCAGGGGCCTGGGCGG + Intronic
925035906 2:685718-685740 CACAGGCCCAGAGACCTGGGAGG + Intergenic
925120528 2:1415117-1415139 CAGAGGCCCAGGGACCTGCCCGG - Intronic
925120548 2:1415178-1415200 CAGAGGCCCAGGGACCTGCCCGG - Intronic
925120568 2:1415239-1415261 CAGAGGCCCAGGGACCTGCCCGG - Intronic
925120607 2:1415361-1415383 CAGAGGCCCAGGGACCTGCCCGG - Intronic
925120625 2:1415422-1415444 CAGAGGCCCAGGGACCTGCCCGG - Intronic
925390406 2:3490360-3490382 CAGAGGCCGGGAGCCCTGGGGGG - Intergenic
925738862 2:6987465-6987487 GAGAAGCACAGGGCTCTGCGTGG + Intronic
925858147 2:8150311-8150333 GGGAGGCCCTGGGTCCTGTGGGG - Intergenic
925887109 2:8402446-8402468 GAGAGGCACAGGGAGCTGGTAGG - Intergenic
926059273 2:9795052-9795074 GCTAGGCCCAGGGCACTGGGGGG - Intergenic
926144131 2:10386521-10386543 AAGTGGCCCAGGGCCCTGGGAGG + Intronic
926144911 2:10391059-10391081 GAGAAGCCCATGGCCCAGTGGGG - Intronic
926150454 2:10422932-10422954 CAGAGGCCCGGGGGCTTGGGCGG - Intronic
926196315 2:10765613-10765635 GAGAGGCTCAGGCCCCTGCTGGG + Intronic
926563713 2:14445876-14445898 GACAGGCCCAGAGGCCTAGGAGG - Intergenic
926723844 2:15982529-15982551 GACTGGGCCAGGGACCTGGGAGG + Intergenic
926926444 2:17993085-17993107 TACAGGCCCAGGGGCCTAGGAGG + Intronic
927236572 2:20880476-20880498 GGGATGCCCAGAGCCCTGGCTGG + Intergenic
927472503 2:23386163-23386185 GAGCGGCCCAGGGCCCCGGCCGG + Intronic
927515097 2:23667681-23667703 GTGGAGTCCAGGGCCCTGGGTGG - Intronic
928022515 2:27715759-27715781 GAGGGGCCCAGAGGCCGGGGCGG + Intergenic
928097542 2:28413661-28413683 GAAAGGCCCGGTGCCCTGCGGGG - Exonic
928193106 2:29192230-29192252 GAGATGGACAGGGCCCCGGGAGG - Intergenic
928257068 2:29731980-29732002 GCGAGGCCCAGGGCAAAGGGAGG - Intronic
928391394 2:30913492-30913514 GAGAGGACCAGGGACCAGGAGGG - Intronic
929275523 2:40021166-40021188 CACAGGCCCAGGGGCCTAGGAGG + Intergenic
929554928 2:42920286-42920308 TAGAGTGCCAGGGCTCTGGGAGG + Intergenic
929584041 2:43102216-43102238 GAGAGGCCCAGGTCCCAGGTCGG + Intergenic
929789669 2:45013642-45013664 GAGAGGCGCTGGGCTCCGGGCGG + Intergenic
930626014 2:53698223-53698245 CACAGGCCCAGGGCTCTAGGAGG - Intronic
930641665 2:53859803-53859825 GAGAGGCCGCGGGCCCCTGGAGG - Intronic
931620598 2:64206039-64206061 GAGAAGACCAAGGCCCTGGAAGG + Intergenic
931715015 2:65021945-65021967 CAGAGGCCCAGGCCTCTGGAAGG - Exonic
931867413 2:66426835-66426857 GGCAGGCCCAGGGCTCTGGGTGG + Intergenic
932445648 2:71779415-71779437 GAGAGGCCCTGAACCCTGGGTGG + Intergenic
932479834 2:72032559-72032581 GAGAGGCCCAGGCCCCTGGGTGG - Intergenic
932595089 2:73088559-73088581 AGGAGCCCCAGGGCCCTGTGCGG - Exonic
932614693 2:73224464-73224486 GAGTGGCCCTGGAGCCTGGGAGG - Intronic
932805188 2:74777378-74777400 GATAAAACCAGGGCCCTGGGTGG + Intergenic
932882417 2:75516063-75516085 GAGGGGCCAGGGGCCCTGCGGGG + Intronic
933102787 2:78281933-78281955 CACAGGCCCAGAGGCCTGGGAGG + Intergenic
933371151 2:81417549-81417571 GAGAGATCCATGGACCTGGGAGG - Intergenic
934144119 2:89075104-89075126 CACAGGCCCAGAGGCCTGGGAGG + Intergenic
934225125 2:90125448-90125470 CACAGGCCCAGAGGCCTGGGAGG - Intergenic
934571424 2:95375295-95375317 GAGAGAGCCATGGTCCTGGGTGG + Intronic
935425837 2:102917389-102917411 GACAGGCCCAGAGCCCTAGGAGG - Intergenic
935618507 2:105109270-105109292 GAATGGCCCAGAGCCCTGGAGGG - Intergenic
935697536 2:105783102-105783124 CAGAAGGCCAGAGCCCTGGGAGG + Intronic
935872830 2:107469611-107469633 GAGCGGCCCAGGGCAGTGAGGGG - Intergenic
937121391 2:119441966-119441988 GTGAGACCCTGGGCCCTGTGTGG + Intronic
937264569 2:120607798-120607820 GAGAGGGCAGGGGCCCTGGGTGG - Intergenic
937994316 2:127681284-127681306 GATGGGCACAGGGCCCCGGGAGG - Intronic
938540832 2:132282298-132282320 GAGAGTCCCTGAGGCCTGGGGGG + Intergenic
938596027 2:132788005-132788027 CAGAGAGCCTGGGCCCTGGGAGG - Intronic
939667597 2:144969784-144969806 CATAGGCCCAGAGCCCTAGGAGG - Intergenic
940533054 2:154904566-154904588 GAGTTGCCCAAGGCCGTGGGAGG - Intergenic
940862786 2:158787617-158787639 GGGTGGGGCAGGGCCCTGGGTGG + Intergenic
941978574 2:171431736-171431758 GCCAGCCCCAGGGCCATGGGCGG + Intronic
942039779 2:172048151-172048173 GAGAGGCCCAGTGCTTTGGATGG + Intronic
942453896 2:176124737-176124759 GAGGAGCCCAGGGCCTCGGGCGG + Exonic
943069577 2:183124693-183124715 GGGAAGCTGAGGGCCCTGGGAGG + Intronic
944127994 2:196316085-196316107 GAGGGGCCCAGGGACCCGAGAGG - Intronic
944221890 2:197311013-197311035 GGCCGGCCCCGGGCCCTGGGCGG + Intronic
945495329 2:210501193-210501215 TATAGGCCCAGAGGCCTGGGAGG - Intronic
946185769 2:217979644-217979666 TGGAGTCCCAGAGCCCTGGGGGG - Intronic
946200542 2:218068560-218068582 CAGAGGAGCAGGGGCCTGGGAGG - Intronic
946227812 2:218273735-218273757 GGGAGGCCGAGGGCGGTGGGGGG - Intronic
946331280 2:219010484-219010506 GAGAGCCTCAGAGCCCAGGGTGG - Intronic
946704172 2:222441160-222441182 GTGAGGCCCAGGGCTTTGGCAGG + Intronic
947112933 2:226739004-226739026 CAGAGACCCAGGGCCCTGTGAGG + Intronic
948569154 2:238906717-238906739 GGGAGGCCCCAGGCACTGGGGGG - Intronic
948673557 2:239584046-239584068 GAGGTGCCCGGGGCCTTGGGTGG - Exonic
948682580 2:239645975-239645997 GAGATGCCCAGCGCCCTGCAAGG - Intergenic
948772711 2:240259708-240259730 CCGAGGCCCAGAGCCCTTGGAGG + Intergenic
948886094 2:240885651-240885673 GAGATGCCCAGGCCCCTTGAAGG - Intergenic
948886600 2:240888066-240888088 GAGAAGCCCCAGGCCCTGTGAGG + Intronic
948939834 2:241190235-241190257 CAGAGGCTCTGGGCCCAGGGTGG - Intronic
949017376 2:241720953-241720975 GAGAGGGCCGGGGGCCTGAGGGG - Intronic
1168969337 20:1920074-1920096 GAGAGGCCCAGGGCCAAAAGTGG - Intronic
1169254452 20:4086296-4086318 GAGGGGCACAGGGCCGTGGGGGG - Intergenic
1170568159 20:17618190-17618212 GAGAGCCCCAGGGCGATGGGTGG + Intronic
1170628083 20:18044704-18044726 GAGAGGCCCAGGGGTCCGAGGGG + Intronic
1171334382 20:24370501-24370523 GGGAGGCCCAGGGCTCCTGGCGG - Intergenic
1171421894 20:25023118-25023140 GAGAGGCTGAGTGCCCTCGGTGG - Intronic
1171456742 20:25276582-25276604 GAGAGGCACAGGGGCCGGCGGGG + Intronic
1171460593 20:25295915-25295937 GTGACGGGCAGGGCCCTGGGAGG + Intronic
1172047883 20:32093708-32093730 GAGGGCCCCAGGGCTCAGGGTGG - Intronic
1172619414 20:36309228-36309250 CAGAGGCCCACGGGGCTGGGCGG - Intronic
1172781738 20:37440416-37440438 GAGGGTCCCAGTGCCCTTGGGGG - Intergenic
1172946403 20:38692969-38692991 GACAGCCCCACGGCCCTGGCCGG + Intergenic
1172978986 20:38926934-38926956 GTGCGACCCAGGGCCCTGGAGGG - Intronic
1173320530 20:41983452-41983474 GGGGAGCCCAGGGCCCAGGGAGG + Intergenic
1174276766 20:49409688-49409710 AGGAGGCTCTGGGCCCTGGGTGG + Intronic
1175031761 20:55961762-55961784 GATTGACCCAGGGCCCAGGGAGG + Intergenic
1175320588 20:58085017-58085039 GAGAGGCCGAGGGCCCCTGCTGG + Intergenic
1175828749 20:61950918-61950940 GAGGGGCCCAGGGCTGTGGAAGG - Intergenic
1175844499 20:62051444-62051466 GGCAGTCCCAGGGCCCTGTGGGG - Intronic
1175933862 20:62506180-62506202 GGGTGGCCCAGGGTCCTGTGGGG + Intergenic
1175947598 20:62565982-62566004 GCGAGGGTCAGGACCCTGGGAGG + Intronic
1176012842 20:62909144-62909166 GACAGGCCCGGGACCCTGGAGGG + Intronic
1176022330 20:62968159-62968181 GAGACCCCCAGGGCAGTGGGTGG + Exonic
1176035309 20:63033521-63033543 GAGGGGCCCACAGCGCTGGGTGG - Intergenic
1176038995 20:63054675-63054697 GAGATGCCCAGTGACCAGGGCGG + Intergenic
1176070744 20:63224973-63224995 GGGAGTCCCTGGGCTCTGGGAGG + Intergenic
1176102175 20:63369611-63369633 GAGAGGCCCTGGGTCCGGGTGGG - Intronic
1176110909 20:63410321-63410343 GAGGGGCACAGGGTCCTTGGAGG - Intronic
1176127487 20:63482474-63482496 GAGAGGGTCTGGGCCCTGGATGG - Intergenic
1176144757 20:63560600-63560622 GCGTGGCCCAGGACACTGGGCGG + Exonic
1176179115 20:63741316-63741338 GAGGGGCCCAGAGCTCTGGCTGG + Intronic
1176189373 20:63800654-63800676 GAGCGGCCCAGGGCAATGAGGGG + Intronic
1176236429 20:64055865-64055887 GGGAGGCCTGGGCCCCTGGGAGG + Intronic
1176285284 21:5016111-5016133 GAGACACCCAGGAGCCTGGGAGG - Intergenic
1176286573 21:5022102-5022124 GAGAGCGCCAGGCCCCTGGCCGG - Intergenic
1176328089 21:5519683-5519705 GAGAGGCCTAGAGACTTGGGCGG - Intergenic
1176399668 21:6301268-6301290 GAGAGGCCTAGAGACTTGGGCGG + Intergenic
1176411597 21:6452081-6452103 GAGAGGAGCAGGGACCTGGGAGG + Intergenic
1176437489 21:6687836-6687858 GAGAGGCCTAGAGACTTGGGCGG - Intergenic
1176461751 21:7014906-7014928 GAGAGGCCTAGAGACTTGGGCGG - Intergenic
1176485312 21:7396684-7396706 GAGAGGCCTAGAGACTTGGGCGG - Intergenic
1178183889 21:30197247-30197269 GAGAGGCACAGGGCACTGAAAGG + Intergenic
1178289115 21:31351550-31351572 AAGGGGCCCAGAGACCTGGGAGG + Intronic
1179043875 21:37828633-37828655 GAGAGGCCCATGGCTCTGCGTGG + Intronic
1179048688 21:37870015-37870037 GAATGGCACAGGTCCCTGGGAGG + Intronic
1179150231 21:38803591-38803613 GGGAGGACCAGGGACCTGGGTGG + Intergenic
1179309857 21:40185836-40185858 GTGAGGCACAGTGACCTGGGGGG - Intronic
1179310723 21:40193676-40193698 GAGATGCCCAGGAGACTGGGAGG - Intronic
1179438898 21:41379830-41379852 AAGGGGCACAGGGCCCTGGGAGG - Intronic
1179466830 21:41581438-41581460 GAAGGGCCCTGGGTCCTGGGCGG - Intergenic
1179687091 21:43060403-43060425 GAGAGGAGCAGGGACCTGGGAGG + Intronic
1179723880 21:43331172-43331194 AAGAGGCCCTGGGCGTTGGGAGG + Intergenic
1179870608 21:44241373-44241395 GAGAGCGCCAGGCCCCTGGCCGG + Intergenic
1179871897 21:44247364-44247386 GAGACACCCAGGAGCCTGGGAGG + Intronic
1180043856 21:45293893-45293915 GAGGGGACCAGCGCCCCGGGGGG + Intergenic
1180081793 21:45490568-45490590 CGGAGGCCCAGGGACCTGAGAGG - Intronic
1180081813 21:45490624-45490646 CGGAGGCCCAGAGACCTGGGAGG - Intronic
1180088848 21:45523754-45523776 GAGACCCTCAGGGCCCTGTGTGG - Intronic
1180177783 21:46098604-46098626 GAGAGGCCCTGCGCCCCCGGAGG - Intronic
1180206808 21:46265847-46265869 CAGATGCCCAGGCTCCTGGGAGG + Intronic
1180229988 21:46421435-46421457 GGATGGACCAGGGCCCTGGGAGG + Intronic
1180256851 21:46635606-46635628 GCGGGGCGCCGGGCCCTGGGCGG + Intronic
1180784668 22:18540132-18540154 GAGGGGCCCGGGGCCGTTGGGGG - Intergenic
1180787504 22:18555004-18555026 GGCAGGCCCAGGGCCCAGGCAGG + Intergenic
1180843333 22:18969351-18969373 GGGAGCACCAGGGCTCTGGGAGG + Intergenic
1180955004 22:19737646-19737668 GATGGGCTGAGGGCCCTGGGGGG - Intergenic
1181035894 22:20169592-20169614 TAGTGGCCCACAGCCCTGGGGGG + Intergenic
1181042404 22:20198336-20198358 CTGGGGCCCAGGACCCTGGGAGG + Intergenic
1181058140 22:20269384-20269406 GGGAGCACCAGGGCTCTGGGAGG - Intronic
1181179317 22:21055795-21055817 GAGAGGTCCAGGTTCCTGTGAGG - Intronic
1181234235 22:21440301-21440323 GGCAGGCCCAGGGCCCAGGCAGG - Intronic
1181244412 22:21494530-21494552 GGCAGGCCCAGGGCCCAGGCAGG + Intergenic
1181591075 22:23884901-23884923 GTGAGGACCAGGGCCCTGGCAGG - Exonic
1182091328 22:27596888-27596910 GAGAGGAGCAGGGCCCATGGAGG - Intergenic
1182368076 22:29792077-29792099 TAGAGCCCAAGGGCCCTGGGAGG - Intronic
1183405715 22:37629671-37629693 GGGAGGCCCTGTACCCTGGGTGG - Intronic
1183420877 22:37710572-37710594 TAGAGTCCCAGGGCCCAGGAAGG + Intronic
1183606105 22:38867478-38867500 GAGTGGCCCAGGGCCCTCTGTGG - Intronic
1183750366 22:39716540-39716562 GTGAGGCCCCGGGCCAGGGGTGG - Intergenic
1184021846 22:41826382-41826404 GAGGGGCCCCAGGCCCTGGCAGG + Intergenic
1184217965 22:43079827-43079849 GAGAGGGCGCGGGGCCTGGGAGG - Intronic
1184225684 22:43127831-43127853 GAGGGGCCCTGGGCGGTGGGTGG + Intronic
1184389623 22:44195747-44195769 GAGTGGAGTAGGGCCCTGGGAGG + Intronic
1184551138 22:45204712-45204734 GAGAAACACAGGGCACTGGGAGG - Intronic
1184651134 22:45919954-45919976 CAGAGGCACAGGGCCCAGTGGGG + Intergenic
1184655989 22:45942282-45942304 GAGAAGCTCAGGGCCCAGGTGGG + Intronic
1184689714 22:46112015-46112037 GACAGGCACTGGACCCTGGGTGG + Intronic
1184691220 22:46118191-46118213 GCCAGGCCCAGGGCCCTGCCAGG + Intergenic
1184763997 22:46562118-46562140 GAGAGGCCTGGGGCTTTGGGTGG + Intergenic
1184776809 22:46627466-46627488 GCTAGGCCCTGGGCCCTGGGTGG + Intronic
1184800577 22:46756292-46756314 GACAGGCCCAGAGGCCTAGGAGG - Intergenic
1185066890 22:48636907-48636929 GACAGGCGCGGGGCCCTGGGAGG + Intronic
1185074935 22:48678012-48678034 GGGAGCCCCAGGGGCCTGGAAGG - Intronic
1185087663 22:48749448-48749470 CAGAGGCCCAGGAAGCTGGGAGG + Intronic
1185179280 22:49349939-49349961 GAGAGGCCCAGGGCAGGCGGGGG - Intergenic
1185220696 22:49627810-49627832 GAGCTGCCCAGGTCTCTGGGAGG + Intronic
1185276464 22:49952052-49952074 GCCAGGCCTAGGGCACTGGGAGG - Intergenic
1185294276 22:50045687-50045709 CAGAGGCCAGGGGCCCCGGGAGG - Intronic
1185294732 22:50047499-50047521 GAGGGGCCTCGGGCTCTGGGGGG + Intronic
1185391304 22:50562820-50562842 GGGAGGGCCGGGGCCCAGGGGGG + Intronic
950425199 3:12921315-12921337 GACAACCCCAGGGCCCTGGCGGG - Intronic
950533563 3:13566954-13566976 GAGAGGGCCAGGGCCGTGCCTGG + Intronic
950661536 3:14469729-14469751 GAGGGGCCAGGGGCTCTGGGAGG - Intronic
951605986 3:24435497-24435519 GGGATGCTCAGGGCCCTGGGGGG - Intronic
952397039 3:32930341-32930363 CAGAGGCCCAGAGGCCTAGGAGG + Intergenic
952847688 3:37702012-37702034 GTGTGGCTCAGGGCCCAGGGTGG + Intronic
952898937 3:38097034-38097056 GGGAGGCCCATGGCTTTGGGTGG + Intronic
952919417 3:38274794-38274816 GTGAGGCCCAGGGGCCTGGGAGG + Intronic
953246797 3:41200041-41200063 GGGATGCGCCGGGCCCTGGGTGG + Intronic
953975664 3:47380355-47380377 AGGAGGCCCCGGGCCCTGTGGGG - Intergenic
954107697 3:48418200-48418222 GAGGGGCGCTGGGCACTGGGTGG + Exonic
954294876 3:49668703-49668725 GAAAGGCCCAGAGCCCTGTGCGG + Exonic
954382930 3:50229224-50229246 GGGAAGCCCAGGGTCCTTGGGGG - Intronic
954397533 3:50300851-50300873 GAGTGCCTCAGTGCCCTGGGTGG - Intronic
954459944 3:50620626-50620648 AAGAGGCCCAGCTCCCTGGGAGG - Intronic
954719823 3:52552181-52552203 GAGTGTCCCAGGGCACAGGGAGG - Intronic
954756072 3:52840668-52840690 GAAGGGCCCAGGGTCCAGGGAGG - Intronic
955103385 3:55873580-55873602 GATGGCCCCAAGGCCCTGGGTGG + Intronic
955219497 3:57011957-57011979 GACTGGCCCTGGGTCCTGGGTGG + Intronic
956363273 3:68471482-68471504 GAGCTGCCCAAGGCCATGGGAGG + Intronic
956731962 3:72204379-72204401 ATGAGGCCCAGGGCCCAGGTGGG + Intergenic
956772199 3:72536093-72536115 GAGAGTCCCAGCGTCCTGAGAGG + Intergenic
957457710 3:80473184-80473206 GAGCTGCCCAAGGCCATGGGAGG + Intergenic
958074939 3:88664578-88664600 GAGAGGCCTAGGGCAGTGGCAGG - Intergenic
959037775 3:101386349-101386371 GAGAGCCCCTTGGCCCTGGCAGG + Intronic
959142693 3:102505690-102505712 GACAGGCCCAGAGGCCTAGGAGG + Intergenic
959752635 3:109856191-109856213 CAGAGGCCCAGAGGCCTAGGAGG - Intergenic
959944825 3:112115350-112115372 GAGAGGCCCAGGGCCCTGGGAGG + Intronic
960050502 3:113234688-113234710 GAGAGGTGCAGGTCCCTGGTGGG - Intronic
960896835 3:122514659-122514681 GAGAGGCCCTGGGGCGAGGGCGG - Intronic
960902055 3:122563635-122563657 GAGTGGGCCTGGGGCCTGGGAGG - Intronic
961358272 3:126352296-126352318 GAGGTGCCCAGGGCCCAGGTGGG - Exonic
961523621 3:127483027-127483049 TGCAGGGCCAGGGCCCTGGGTGG - Intergenic
962005351 3:131343852-131343874 GACAGGCCCAGAGGCCTAGGAGG - Intronic
962323037 3:134406979-134407001 CACGGGCCCAGGGCCCTTGGGGG - Intergenic
962851594 3:139312301-139312323 GAGAGACCAGAGGCCCTGGGAGG + Intronic
965449501 3:168820152-168820174 GAGAGACCCTGGGACCTGGTGGG + Intergenic
966918568 3:184598000-184598022 GAGAGCCTGCGGGCCCTGGGCGG - Intronic
967975462 3:195031958-195031980 GAAATGCCCAGACCCCTGGGGGG - Intergenic
968426374 4:526269-526291 GTGAGGCCCAGGCCCCCGTGTGG + Intronic
968450560 4:674168-674190 GGGGGGCCCAGAGCACTGGGCGG + Intronic
968526631 4:1061365-1061387 GAGAGGCCCACAGTCCTGGCTGG + Intronic
968605852 4:1534973-1534995 GAGAACCCCAGGGTACTGGGAGG + Intergenic
968640824 4:1713556-1713578 GGGATGCCCAGGGCCTGGGGAGG - Intergenic
968900319 4:3428188-3428210 GAGAGGAGCAGGGCACAGGGTGG - Intronic
968922544 4:3530165-3530187 GAGCGTGCCAGGGCCCAGGGTGG - Intronic
968929907 4:3573351-3573373 GGCAGCCCCTGGGCCCTGGGAGG - Intergenic
968968409 4:3781101-3781123 GGGCGGCTCAGGGCTCTGGGAGG - Intergenic
968971468 4:3797915-3797937 GAGTGGTCCAGGAGCCTGGGGGG + Intergenic
969350113 4:6593487-6593509 GAGAGGCCCAGGGGTCTGCAGGG - Intronic
969687060 4:8681596-8681618 CAGAGTCCCAGCGCCATGGGGGG + Intergenic
970361211 4:15310667-15310689 CACAGGCCCAGAGGCCTGGGGGG + Intergenic
974034846 4:56808940-56808962 GAGAGGAACAGGGCCATGTGAGG + Intergenic
974806066 4:66882592-66882614 CAGAGGCCCAGAGTCCTAGGAGG + Intergenic
975563100 4:75725219-75725241 GAGGGGCCCACGGCCCCGAGGGG - Intronic
977924565 4:102685567-102685589 GAGAGGGCAAGGTCTCTGGGAGG - Intronic
978265896 4:106823545-106823567 TACAGGCCCAGAGCCCTAGGAGG - Intergenic
978576947 4:110197764-110197786 GCGAGGACCAGGGCCAAGGGCGG + Intronic
979001510 4:115226610-115226632 GAGAGGCCAAGGGCCATGGCTGG - Intergenic
979468234 4:121066028-121066050 GAGAGGCCCTGGGAGCAGGGTGG + Intronic
980006813 4:127552200-127552222 CAGAGGCCCAGAGGCCTAGGAGG + Intergenic
984844961 4:184101024-184101046 GGGAGGCTCAGGCCCCAGGGAGG + Intronic
985588250 5:751748-751770 GAGAGGCCTGGAGACCTGGGGGG - Intronic
985602921 5:844203-844225 GAGAGGCCTGGAGACCTGGGGGG - Intronic
985665102 5:1178051-1178073 GAGAGCCCCAGTGCCCGGGATGG + Intergenic
985852907 5:2401886-2401908 CATAGGCCCAGAGGCCTGGGAGG + Intergenic
986211473 5:5676974-5676996 TTGAGGCCCAGGGCCTTGGGGGG + Intergenic
987680732 5:21133307-21133329 GAAAGGCCCAGAGACCTAGGAGG + Intergenic
988564921 5:32313008-32313030 GCGGGGCCCACGGGCCTGGGCGG - Exonic
988670182 5:33372791-33372813 GAGAGGCACATCGCCCAGGGAGG - Intergenic
989103438 5:37840089-37840111 GGGAGGCGCGGGGCCCCGGGAGG + Intergenic
989520307 5:42393116-42393138 CACAGGCCCAGAGGCCTGGGAGG - Intergenic
990173960 5:53086390-53086412 GAAAGGTTCAGGGCCATGGGTGG + Intronic
992962759 5:81972204-81972226 GAGGGACCCAGCGCCCTGCGAGG - Exonic
993752811 5:91691726-91691748 GAGCTGCCCAAGGCCCTGTGAGG - Intergenic
994045599 5:95305971-95305993 GTGAGGCCCAGGGGCCTTGAGGG - Intergenic
994233954 5:97339940-97339962 GAGTTCCCCTGGGCCCTGGGTGG - Intergenic
997282601 5:132658281-132658303 GGGAGGCACAGGGCCTGGGGAGG - Exonic
997297221 5:132776135-132776157 GGGAGGCCCAGGGCTGTTGGAGG - Intronic
997308395 5:132857790-132857812 GATAGTCCCAGCTCCCTGGGAGG + Intergenic
997400193 5:133596253-133596275 CAGGGGCCCAGGCCCCTGGCTGG + Intronic
997600226 5:135133997-135134019 GCCAGGCCCAGGGCTGTGGGGGG - Intronic
998155038 5:139781164-139781186 GAGAAGTCCAGGGCCAAGGGTGG + Intergenic
998317431 5:141194879-141194901 TTCAGGCACAGGGCCCTGGGAGG + Exonic
999624183 5:153502664-153502686 GGGGAGCCCAGGGCCATGGGAGG + Intronic
1000047740 5:157535484-157535506 GAGAACCCCATGGGCCTGGGTGG + Intronic
1000097731 5:157986268-157986290 CAAAGGCCCAGGGTCCGGGGAGG - Intergenic
1000609674 5:163360241-163360263 GAGCTGCCCAAGGCCATGGGAGG + Intergenic
1001141092 5:169144671-169144693 CAGTGGCCCAGGGCCTTGGGTGG - Intronic
1001239522 5:170057472-170057494 GGGAGGCCCGGGGACCTGGCTGG + Intronic
1001816296 5:174672060-174672082 GAGGGGCACAGGGCACGGGGTGG - Intergenic
1002133761 5:177096213-177096235 GAGGGGCACTGGGCCCGGGGTGG + Intronic
1002331174 5:178442035-178442057 CAGAGGGCCAGGCCCGTGGGTGG - Intronic
1002644421 5:180646182-180646204 GAGAGGAGCAGGACCTTGGGTGG - Intronic
1002786559 6:404801-404823 GGGAGACCGAGGGCCCTGGGGGG + Intronic
1002991247 6:2241089-2241111 CAGAGGCCCAGAGACCTAGGAGG + Intronic
1003230077 6:4243760-4243782 CAGAGGCCCAGAGGCCTAGGAGG - Intergenic
1003306770 6:4936020-4936042 CAGAGGCACAGAGGCCTGGGTGG - Intronic
1003330382 6:5124093-5124115 GACAGCCCCAGGGACCTGGGAGG - Intronic
1003499433 6:6692112-6692134 GACAGGCCAGAGGCCCTGGGTGG - Intergenic
1003840340 6:10113234-10113256 GATAGGCTCCGTGCCCTGGGAGG + Intronic
1005987151 6:30882497-30882519 GAGATTCCCAGGGGCCTGAGAGG - Intronic
1006112927 6:31759711-31759733 GAGAGGCAGAGGCCCCTAGGGGG - Intronic
1006360549 6:33584773-33584795 GAGAGCCACAGGGCCCCGTGAGG + Intergenic
1006624403 6:35387074-35387096 AAGGGGCCCAGGGCCCTCTGTGG - Intronic
1006802008 6:36765484-36765506 CTGGGCCCCAGGGCCCTGGGTGG + Intronic
1006804376 6:36778714-36778736 GAGAGGGCAAGGGCTCTGGGTGG - Intronic
1006945239 6:37780156-37780178 GAGCAGCCCAAGGCCCTGAGTGG + Intergenic
1007168494 6:39845872-39845894 CAGCAGCCTAGGGCCCTGGGTGG - Intronic
1007285444 6:40744228-40744250 GGGAGGCCTGGGGCCCTGTGTGG + Intergenic
1008337531 6:50324917-50324939 GATAGGCCCAGAGGCCTAGGAGG - Intergenic
1010184864 6:73132318-73132340 GAGAGGCCCAGGACTCTGCAGGG - Intronic
1010324518 6:74549749-74549771 GAGATCCCCTTGGCCCTGGGTGG + Intergenic
1011635819 6:89372161-89372183 GAGATGCCAAGGCCCCTGGGAGG + Intronic
1011751396 6:90458679-90458701 GTGAAGCCCAGGTTCCTGGGAGG + Intergenic
1012485855 6:99722215-99722237 CAGAGGCCCAGAGGCCTAGGAGG + Intergenic
1013730084 6:113155107-113155129 CAGAGGCCCAGAGCTCTAGGGGG + Intergenic
1014509847 6:122307735-122307757 AACAGGCCCAGAGGCCTGGGAGG + Intergenic
1015261624 6:131244281-131244303 GAGAGAGCCAGGGCCCAAGGAGG - Intronic
1016594375 6:145782901-145782923 GAGAGGCCCAGGGCTCTTGTGGG - Intergenic
1018039187 6:159906596-159906618 GAGTGGCCGAGTGCCCTGTGCGG - Intergenic
1018197678 6:161369017-161369039 GCCAGCCCCAGGGACCTGGGGGG + Intronic
1018310621 6:162504383-162504405 ATGAAGCCCAGGGCTCTGGGAGG + Intronic
1018678347 6:166242329-166242351 GAGAGGCTCAGGGACCTCTGAGG - Intergenic
1018853642 6:167659477-167659499 AAGGGGCTCAGTGCCCTGGGAGG + Intergenic
1019142024 6:169954378-169954400 GAGATGCCCAGGTAGCTGGGAGG + Intergenic
1019604333 7:1901020-1901042 GACAAACCCAGGGCCCTGGAGGG + Intronic
1019704351 7:2490377-2490399 GCTGGGCCCAGGGGCCTGGGGGG - Intergenic
1019919227 7:4152317-4152339 GAGAATTCCAGGGCTCTGGGAGG - Intronic
1019998820 7:4742964-4742986 GAGAGGCCCCGGGCTCAGGCCGG + Intronic
1020088439 7:5323988-5324010 GAGCGGCCCTGGGACCAGGGAGG - Intronic
1020095953 7:5369464-5369486 AGCAGGCCCAGGGACCTGGGAGG + Intronic
1020136018 7:5588480-5588502 GTGTGGCTCAGGGCCCTGGAGGG + Intergenic
1020182219 7:5931355-5931377 GAGAGGACAAGGGCCCGGGATGG + Intronic
1020257462 7:6510155-6510177 GAGGGTCACAGGGCCATGGGAGG + Intronic
1021450896 7:20783712-20783734 GCGATGCCCAGGGGCCTGGCAGG + Intronic
1021555429 7:21913764-21913786 AAGATGCCCATTGCCCTGGGAGG - Intronic
1021746371 7:23745222-23745244 GTGATACCCAGGGCCTTGGGTGG + Intronic
1022490482 7:30813637-30813659 GAGAGGCACAGGGGGCTGGCAGG + Intronic
1022712607 7:32865657-32865679 CACAGGCCCAGAGGCCTGGGAGG - Intergenic
1022910478 7:34895876-34895898 GAGCTGCCCAAGGCCTTGGGAGG + Intergenic
1024036312 7:45510197-45510219 GATGGGACCAGGGCCATGGGAGG + Intergenic
1024068775 7:45768612-45768634 GGGAGTCCCCGGGCCCTGGCTGG + Intergenic
1025810439 7:64872129-64872151 GAGAGGCAGGGGTCCCTGGGAGG + Intronic
1025954301 7:66170736-66170758 GAGAGTCCCAGGAACCTGGTGGG + Intergenic
1026739448 7:72969619-72969641 GCGAGGGCCAGGGCCGTTGGCGG + Intergenic
1026790466 7:73328234-73328256 GCGAGGGCCAGGGCCGTTGGCGG + Intronic
1026829808 7:73603576-73603598 GACAGGCCCAGGACCCCGTGGGG + Intronic
1027104283 7:75395454-75395476 GCGAGGGCCAGGGCCGTTGGCGG - Intronic
1029124592 7:98287527-98287549 GAGAGGCGCCGGGGCCTGGGTGG + Intronic
1029440707 7:100585360-100585382 GAGAGGGCCAGGACCTTAGGGGG + Intronic
1029490754 7:100868694-100868716 GAGGGGCCCAGAGGCCTGAGAGG - Exonic
1029495674 7:100894693-100894715 GCCAGACCCGGGGCCCTGGGGGG + Intronic
1029547180 7:101216667-101216689 GAGAGGGAAAGGCCCCTGGGAGG - Intronic
1029655928 7:101924448-101924470 GACTCGCCCAGGGTCCTGGGGGG - Intronic
1030408248 7:109142739-109142761 GAGTTCCCCTGGGCCCTGGGTGG + Intergenic
1031080424 7:117252161-117252183 GAAAGGCCCTGGCTCCTGGGAGG + Intergenic
1032077635 7:128843614-128843636 GGGAGACCCAGGGCTCTGGCGGG - Intronic
1034345681 7:150383996-150384018 GAGAGGCCCGGGGCAGGGGGAGG - Intronic
1034451589 7:151139905-151139927 GAGGGGCGCAGGGCACTGGGAGG - Intronic
1034478670 7:151303522-151303544 GGGAGACCCAGGACCCTGGCCGG + Intergenic
1035027625 7:155836266-155836288 GAGAAGCCCGGGGCCCGGGCAGG - Intergenic
1035107933 7:156457694-156457716 GGGAGCCCCAGGGCTCTGCGTGG - Intergenic
1035173274 7:157032785-157032807 GGGAGGCACAGGTGCCTGGGCGG + Intergenic
1035263368 7:157675377-157675399 GTGTGGTCCGGGGCCCTGGGGGG - Intronic
1035452157 7:158984213-158984235 CACAGGCCCAGAGGCCTGGGAGG - Intergenic
1035567169 8:649509-649531 CAGAGCCCCTGGGCCCCGGGGGG + Intronic
1036182714 8:6598695-6598717 GAGAAGGCCATGGCCCTGTGTGG + Intronic
1037890374 8:22620962-22620984 GAGAGGCCCTGAACCCTGTGCGG - Exonic
1037917861 8:22783522-22783544 GAGAGGCCTGAGGCTCTGGGTGG + Intronic
1038059473 8:23896535-23896557 GATGTGCCCAGTGCCCTGGGAGG - Intergenic
1038133386 8:24758988-24759010 CAGAGGCTCAGAGCCCTTGGGGG - Intergenic
1038425590 8:27462061-27462083 GAAGGGCCCATGCCCCTGGGTGG - Intronic
1038612422 8:29068912-29068934 CAGAGGGCCCGGCCCCTGGGGGG - Exonic
1038646312 8:29365330-29365352 TTGAGGTCCAGGGCCCTGAGGGG + Intergenic
1039148721 8:34479382-34479404 CACAGGCCCAGAGGCCTGGGAGG - Intergenic
1039479343 8:37860255-37860277 GATAGTCCAAGTGCCCTGGGGGG - Exonic
1039645553 8:39278281-39278303 GGGAGGGGCAGGGCCATGGGTGG + Intronic
1040550702 8:48435019-48435041 GAGGGGTCCAGGGCCCAGGGTGG + Intergenic
1040676531 8:49757317-49757339 GAGAGGCCCAGGGCCAGAGGTGG - Intergenic
1041545239 8:59034978-59035000 GGGAAGAGCAGGGCCCTGGGAGG + Intronic
1041693743 8:60714559-60714581 GAGAAGCCCAGGGGCCAGGAGGG - Intronic
1042642460 8:70951384-70951406 TAGAGGCCCAGGGCCCTCACAGG + Intergenic
1042827134 8:72990935-72990957 CACAGGCCCAGAGGCCTGGGAGG + Intergenic
1043483952 8:80680450-80680472 GAGAGGACCAGGGACCTTGACGG + Intronic
1044125336 8:88452437-88452459 CAGAGGCCCAGAGGCCTAGGAGG - Intergenic
1045880297 8:107030437-107030459 GACAGGCCCAGAGGCCTAGGAGG + Intergenic
1046078754 8:109344347-109344369 GTGAGGCAGAGGGCCCTGGAGGG - Exonic
1046839464 8:118841178-118841200 TGCAGGCCCAGGGGCCTGGGAGG + Intergenic
1047011631 8:120678993-120679015 GAGAGGACTATAGCCCTGGGAGG - Intronic
1047866940 8:129035180-129035202 TAGTGCCCCAGGGCCCTGCGAGG + Intergenic
1048197858 8:132347240-132347262 GAGAGGGCCAGGGACTTGGCAGG - Intronic
1048694697 8:137012893-137012915 GAGGTGCCCAGGGCCATAGGAGG - Intergenic
1048774713 8:137932989-137933011 GAGAGTCCCAGGACTCTTGGAGG - Intergenic
1048790058 8:138093547-138093569 CAGAGGCCCAGGGGCCTAGGAGG - Intergenic
1049419268 8:142509867-142509889 GGCAGGCCCAGGACCTTGGGTGG + Intronic
1049427740 8:142544847-142544869 GAGGGGCCTAGGGCCCTGGAAGG - Exonic
1049442976 8:142617591-142617613 GGGAGGCCCAAGGCACAGGGTGG - Intergenic
1049519857 8:143082580-143082602 GAGGGGCGCTGGGCCCTGCGAGG + Exonic
1049755267 8:144308755-144308777 GGGAGGCCCAGGGGGCTGGCGGG - Intronic
1049765742 8:144354486-144354508 GGCAGGGCCAGGGCCCTGGGTGG - Intronic
1049847375 8:144809577-144809599 GACTGGCCGAGAGCCCTGGGAGG - Intronic
1050258466 9:3816799-3816821 GTGAGGCCAAGGGCCCATGGTGG - Intergenic
1051157067 9:14159847-14159869 GAAAGGCCCAAGGACCTTGGAGG - Intronic
1051334290 9:16052647-16052669 AAAAGGCCCCGGGCCCTGGCTGG - Intronic
1052007078 9:23361355-23361377 CACAGGCCCAGGGGCCTAGGAGG - Intergenic
1052686677 9:31765437-31765459 TAGAGGCCCAGAGGCCTAGGAGG - Intergenic
1053055687 9:34991891-34991913 GAGGCGCCCAAGGCCCTAGGTGG - Intronic
1053122035 9:35554952-35554974 GAGAGGGGCAGGGACCTGGCTGG - Intronic
1053281172 9:36820564-36820586 GACAGGCACACAGCCCTGGGAGG + Intergenic
1053306315 9:36986739-36986761 GAGAGGCCGAGGTCCCTGCGGGG - Intronic
1054451155 9:65404223-65404245 GTGGGGTCCAGTGCCCTGGGAGG - Intergenic
1054454823 9:65424428-65424450 GAGAGACACAGGGGCCGGGGAGG + Intergenic
1055337424 9:75247125-75247147 GACAGGCCCAGAGGCCTAGGAGG + Intergenic
1056101059 9:83301128-83301150 GTGAGAGCCATGGCCCTGGGGGG + Intronic
1056752278 9:89361150-89361172 GAGAGGCCCAGCTGCCTGTGAGG - Intronic
1057025794 9:91733097-91733119 GAGTGCCCGAGGGCCCGGGGCGG - Intronic
1057439970 9:95075977-95075999 GAGAGAGCTAGAGCCCTGGGAGG - Intronic
1058759779 9:108119662-108119684 GTCAGGCCCTGGGGCCTGGGGGG - Intergenic
1060497528 9:124129460-124129482 CAGAGGCCCAGGGGCCCAGGAGG + Intergenic
1060547140 9:124468303-124468325 GGGAGGAGCAGGGCCCGGGGAGG + Intronic
1060547147 9:124468320-124468342 GGGAGGAGCAGGGCCCCGGGAGG + Intronic
1060548812 9:124475731-124475753 GAGGCCCCCAGGCCCCTGGGAGG + Intronic
1060820309 9:126658071-126658093 GAGGGGCCAAGGGACCTGAGTGG + Intronic
1060893682 9:127204043-127204065 GAGCTGCCCAAGGACCTGGGAGG - Intronic
1061130016 9:128703308-128703330 GCGGGGCACAGGGGCCTGGGGGG + Intronic
1061165952 9:128922300-128922322 GAGACGCTCAGGGCACTGGGCGG - Exonic
1061194416 9:129099991-129100013 GTCAGCCCCAGGGCCCTGGGGGG + Intronic
1061251555 9:129429256-129429278 GAGTGCCCCAGGGACCTGTGCGG + Intergenic
1061368709 9:130186064-130186086 GGGAGGCCCTGGGTCCTGTGGGG + Intronic
1061426138 9:130499573-130499595 GAGAAGCTCAGGGCCCTGACGGG + Intronic
1061863127 9:133478133-133478155 GGGGGGACCAGGGCCCTGGAGGG + Intronic
1062017405 9:134297730-134297752 CAGAGGCCCTCGGGCCTGGGAGG - Intergenic
1062029484 9:134355813-134355835 GGTGAGCCCAGGGCCCTGGGAGG - Intronic
1062087291 9:134655338-134655360 GAGAAGCACAGAGCCCCGGGAGG + Intronic
1062131464 9:134896293-134896315 GGAAGGCACAGGGCTCTGGGAGG - Intergenic
1062139198 9:134946041-134946063 GGGAGGCTCTGGGCCCTGAGCGG - Intergenic
1062235310 9:135505148-135505170 GAGCGGCACAGGGCAATGGGAGG + Intergenic
1062286143 9:135773382-135773404 GGGAGACCTAGGGCACTGGGTGG - Intronic
1062325453 9:136010480-136010502 GAGTGGTCCCTGGCCCTGGGCGG + Exonic
1062361965 9:136192686-136192708 GGGTGGCACAGGGCTCTGGGTGG - Intergenic
1062522068 9:136962030-136962052 GAGGGGCCCTGGGGACTGGGAGG - Intergenic
1062572293 9:137191261-137191283 GAGGGGCCCAGAGCCTGGGGAGG - Intergenic
1062613611 9:137386475-137386497 GAGTGGCCCAGGTCGGTGGGAGG - Intronic
1062629176 9:137456002-137456024 GAGAGGAGCAGGTCCCTGCGGGG + Intronic
1062638657 9:137505558-137505580 AGGAGGCCACGGGCCCTGGGTGG + Intronic
1062689619 9:137834532-137834554 GAGATGGCCAGGGGCCGGGGCGG - Intronic
1203782502 EBV:108392-108414 GGGAGGCCCAGGACCTTGGCCGG - Intergenic
1203434016 Un_GL000195v1:120774-120796 GAGAGGCCTAGAGACTTGGGCGG + Intergenic
1185680777 X:1886913-1886935 GAGAAGGACAGAGCCCTGGGAGG - Intergenic
1187334711 X:18372294-18372316 CAGAGGCCCAGAGCTCTAGGAGG + Intergenic
1187342631 X:18434836-18434858 GAGAGTCCCATGAACCTGGGAGG + Intronic
1187576485 X:20561875-20561897 GAGGGGCCCAGGGCACTTGTGGG + Intergenic
1187872961 X:23779499-23779521 GAGAGTCCCTTGACCCTGGGAGG + Intergenic
1187958009 X:24539577-24539599 CAGGGTCCCAGGGCCCTAGGTGG - Exonic
1189478462 X:41375135-41375157 GAGAGGCCGTTGGCCCAGGGAGG - Intergenic
1189733879 X:44049528-44049550 GAGGGGACCAGGGCCCTTGGAGG + Intergenic
1190300910 X:49057067-49057089 GTGAGGCCCAGGGCCCAGCTGGG + Intronic
1190335289 X:49258273-49258295 GTGAGGCCCTGGGCCCAGGATGG - Intronic
1190374267 X:49774223-49774245 GAGCTGCCCCTGGCCCTGGGTGG + Intergenic
1191095037 X:56665036-56665058 CAGAGGCCCAGAGGCCTAGGAGG + Intergenic
1192114428 X:68396934-68396956 GAGAGTCCTATGCCCCTGGGGGG - Intronic
1193528790 X:82627612-82627634 GAGTACCCCAAGGCCCTGGGTGG - Intergenic
1193665491 X:84310534-84310556 GAGGTCCCCCGGGCCCTGGGTGG - Intergenic
1193880081 X:86910941-86910963 GATATGCCCCAGGCCCTGGGTGG + Intergenic
1194952603 X:100144992-100145014 CACAGGCCCAGGGGCCTAGGAGG + Intergenic
1195333971 X:103831809-103831831 GAGAGGCGCAGGGCTCCGTGGGG - Intronic
1196368328 X:114947391-114947413 CAGAGGCCCAGAGGCCTAGGAGG - Intergenic
1196849976 X:119928303-119928325 AAGATGCCCAGGGCTCTGTGAGG - Intronic
1196937406 X:120743418-120743440 GAAAGGCACAGGCACCTGGGTGG + Intergenic
1197708192 X:129648691-129648713 GAATGGGCCAGGGCCCTGGCAGG - Exonic
1199180465 X:144848252-144848274 GTCAGGCCCAAGGCCCTGGTGGG - Intergenic
1199217853 X:145281903-145281925 GAGATTCCCCAGGCCCTGGGTGG + Intergenic
1200062210 X:153488691-153488713 AAGAGGCGCAGGGACCGGGGCGG - Intronic
1200962875 Y:9011183-9011205 GAGAGGCCATGGGCAGTGGGAGG + Intergenic
1201190403 Y:11438846-11438868 GACAGGGCCAGGGCCATGGCAGG - Intergenic
1202119835 Y:21510524-21510546 GACAGGCTAAGGGCCCTGTGGGG - Intergenic
1202122286 Y:21534065-21534087 GACAGGCTAAGGGCCCTGTGGGG - Intronic
1202156719 Y:21895318-21895340 GACAGGCTAAGGGCCCTGTGGGG + Intronic
1202159167 Y:21918859-21918881 GACAGGCTAAGGGCCCTGTGGGG + Intergenic
1202185616 Y:22183774-22183796 GACAGGCTAAGGGCCCTGTGGGG + Intergenic
1202205744 Y:22402622-22402644 GACAGGCTAAGGGCCCTGTGGGG - Intronic