ID: 959946768

View in Genome Browser
Species Human (GRCh38)
Location 3:112133418-112133440
Sequence CTGAAATTACAGATGGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959946763_959946768 -4 Left 959946763 3:112133399-112133421 CCTCTGGGGAATCCCAGGTCTGA 0: 1
1: 0
2: 1
3: 20
4: 188
Right 959946768 3:112133418-112133440 CTGAAATTACAGATGGGCCATGG 0: 1
1: 0
2: 2
3: 17
4: 209
959946758_959946768 16 Left 959946758 3:112133379-112133401 CCGTCAATGAGAGCTTCGAACCT 0: 1
1: 0
2: 0
3: 5
4: 43
Right 959946768 3:112133418-112133440 CTGAAATTACAGATGGGCCATGG 0: 1
1: 0
2: 2
3: 17
4: 209
959946756_959946768 27 Left 959946756 3:112133368-112133390 CCAGCAACTACCCGTCAATGAGA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 959946768 3:112133418-112133440 CTGAAATTACAGATGGGCCATGG 0: 1
1: 0
2: 2
3: 17
4: 209
959946757_959946768 17 Left 959946757 3:112133378-112133400 CCCGTCAATGAGAGCTTCGAACC 0: 1
1: 0
2: 0
3: 2
4: 32
Right 959946768 3:112133418-112133440 CTGAAATTACAGATGGGCCATGG 0: 1
1: 0
2: 2
3: 17
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959946768 Original CRISPR CTGAAATTACAGATGGGCCA TGG Intergenic
903126380 1:21251024-21251046 CTGAATTTGCAGATGGGGTAAGG + Intronic
903726121 1:25446593-25446615 TTTAAAATGCAGATGGGCCACGG + Intronic
904547460 1:31286842-31286864 CTCTAGTTAGAGATGGGCCAAGG - Intronic
904834161 1:33324238-33324260 CTGGACTGACAGATAGGCCAAGG - Exonic
906128357 1:43441421-43441443 GTGAAGTCACAGATGGGCCTTGG + Intronic
908525611 1:64984886-64984908 CTGCCATCACAGCTGGGCCAGGG + Intergenic
908830831 1:68176684-68176706 CTGAAATAACATATGTGCAAAGG - Intronic
909359910 1:74748005-74748027 CTGAAATGCCAGCTGTGCCATGG - Intronic
911709206 1:101049922-101049944 CTGAAAATAGAGATGAGCCAAGG + Intergenic
912544073 1:110438416-110438438 CTGAAACCAAAGATGGGCCCAGG + Intergenic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
913156546 1:116105147-116105169 CAGAAATAACAGCTGGGCAAAGG - Intergenic
913398650 1:118402985-118403007 CTGAATTCACAGTTTGGCCATGG + Intergenic
915131384 1:153697817-153697839 CTGAACTTCCTGATGGGCCCCGG + Intergenic
916800524 1:168211606-168211628 CTGCAAGAACAGATGGGCAATGG + Intergenic
917525644 1:175786030-175786052 CTGCCATGACAGCTGGGCCAGGG + Intergenic
918692025 1:187492926-187492948 CTGCAATTAAAAATGGGCAAAGG - Intergenic
918933578 1:190890688-190890710 GTGAAAGTACAGATGTGCCACGG - Intergenic
924019392 1:239765020-239765042 CTGTGATTCCAGATGGCCCAAGG - Intronic
924596187 1:245446987-245447009 CTGTAAATATAGGTGGGCCATGG + Intronic
1063936016 10:11079368-11079390 CGGAAAATGCAGATGGCCCATGG + Intronic
1063955435 10:11261258-11261280 CTGAAACTACTGATGTGGCAGGG - Intronic
1064329542 10:14380652-14380674 CTATTATTTCAGATGGGCCAAGG + Intronic
1064630759 10:17308463-17308485 CTCAAATTTCAGATGGGCAGAGG + Intergenic
1065441858 10:25761316-25761338 CTGAAATTACAGATGGAGGCTGG + Intergenic
1065717689 10:28588575-28588597 TTAAAATTAAAGCTGGGCCAAGG + Intronic
1065914287 10:30339632-30339654 CTGTAAGTACAAATGGGGCATGG + Intronic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069842080 10:71346176-71346198 CTGAAAGTACTCCTGGGCCATGG + Intronic
1070235560 10:74621890-74621912 CTGAGATTCCAGGAGGGCCATGG - Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1070972372 10:80578177-80578199 CAGAAATTCCAGATGAGCCTGGG - Intronic
1071131752 10:82402305-82402327 CTGAAATTTCAGAAGGTTCATGG - Intronic
1071450201 10:85786704-85786726 CAGTAATTACAGATGGGAAAGGG + Intronic
1072625570 10:97108941-97108963 CTGAGATCACACATGGGCCCAGG + Intronic
1074461104 10:113637453-113637475 GTTATATTACAGATGGGCAAGGG + Intronic
1078526160 11:12103156-12103178 CCGAAATTTCATATGGGCCCAGG + Intronic
1080129707 11:28780166-28780188 ATGAAATTTGAGAGGGGCCAGGG - Intergenic
1080856854 11:36119660-36119682 CTCAACTTACAAATGGGCAAAGG - Intronic
1081978329 11:47249821-47249843 CTGGTATTACAGGTGAGCCACGG - Intronic
1082920753 11:58490802-58490824 CTGTAATTACACATGGGGCAGGG + Intergenic
1084085854 11:66854882-66854904 CTGACATTTCAGCTGGGCCAAGG + Intronic
1085751923 11:79169280-79169302 CTTAATTCACAGATGTGCCAGGG - Intronic
1087479484 11:98681017-98681039 CTGGGATTACAGAGGGGCCCCGG + Intergenic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1088605126 11:111522424-111522446 CTTTAATTTCAGATGTGCCATGG - Intronic
1089547044 11:119236145-119236167 CTGGAATTACAGAGGGGTGATGG - Intronic
1094307798 12:29040260-29040282 CTGAAATCAGAGGTGGGCCAGGG + Intergenic
1095454259 12:42365613-42365635 CTGCAATCACAGATGGTTCAAGG + Intronic
1096753757 12:53781594-53781616 CTGACATCACAGATGGTGCAGGG + Intergenic
1098316583 12:69199584-69199606 CTGAAATTAGAGGTGGGCTGAGG - Intergenic
1098459207 12:70713720-70713742 CCCAAATTAAAAATGGGCCAAGG - Intronic
1101208767 12:102514824-102514846 TGGGAATTACAGATGGGCAATGG + Intergenic
1104501700 12:129292481-129292503 CTGTAATTAGAGAAGGGCCAGGG + Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107295097 13:38899616-38899638 CTGAAATCACAGACCTGCCATGG + Intergenic
1110834896 13:80072494-80072516 CTCACATTGCAGATGTGCCAAGG + Intergenic
1114404636 14:22444899-22444921 CTGAAAATACAGAGGGACTACGG - Intergenic
1117937195 14:60919691-60919713 CTGAACTTACACATGGGTGATGG - Intronic
1118035032 14:61857400-61857422 CTGAAATTAGAGGTGGGCCCAGG + Intergenic
1118375776 14:65175782-65175804 CTGGGATTACAGATGAGCCACGG + Intergenic
1122068754 14:99191656-99191678 CTGAAATGGCAGAGGGGGCAGGG + Intronic
1124487067 15:30127673-30127695 CTCCGTTTACAGATGGGCCAAGG + Intergenic
1124542152 15:30596648-30596670 CTCCGTTTACAGATGGGCCAAGG + Intergenic
1124756458 15:32410650-32410672 CTCCGTTTACAGATGGGCCAAGG - Intergenic
1125256224 15:37766566-37766588 CTGAGACTACAGATAGACCAAGG + Intergenic
1125782163 15:42279364-42279386 CTCAAAATGCAGGTGGGCCAGGG + Intronic
1126410045 15:48363937-48363959 GTGAAATGAGAGATTGGCCAGGG + Intergenic
1126702389 15:51380064-51380086 CAGAAGTTACTGATGGGGCAAGG + Intronic
1127803270 15:62495655-62495677 CTGGTATTTCAGATGGGCCCAGG + Intronic
1131604370 15:93885547-93885569 CTAAAAATACAGATGGTCCCTGG - Intergenic
1132598420 16:763457-763479 CTGAAATTGCAGCTGGGTCTGGG + Intronic
1133866143 16:9645277-9645299 CTGAATTTACAGATAGGAAATGG - Intergenic
1138020564 16:53476116-53476138 CTGAAAATGAAGAAGGGCCAAGG - Intronic
1138425727 16:56931162-56931184 CTGAAAAAACAGATGTCCCAAGG + Intergenic
1138552729 16:57756317-57756339 ATGAAGTCACAGATGGACCAAGG - Intronic
1142701211 17:1662174-1662196 AGTAAATTACAGATGAGCCAGGG + Intronic
1144409487 17:14986661-14986683 TTGAAATTAGAGATGGGCCAAGG + Intergenic
1144740722 17:17580772-17580794 GCGGAATAACAGATGGGCCACGG - Intronic
1146330869 17:31925930-31925952 CAAAAATTACAGGTGTGCCATGG + Intergenic
1147276544 17:39322191-39322213 CTGAAATTAAGCATGGGGCATGG - Intronic
1150012887 17:61522876-61522898 CTTAAATAACCAATGGGCCAAGG - Intergenic
1152387203 17:79981728-79981750 CTGAGATTACAGAAGAGCCGAGG - Intronic
1153045345 18:850783-850805 TTGAAATTAAACATGGGCCAGGG - Intergenic
1155331340 18:24721646-24721668 TAGAAAAAACAGATGGGCCAAGG - Intergenic
1155632389 18:27908444-27908466 CTGAACATGGAGATGGGCCAGGG - Intergenic
1157609861 18:48949613-48949635 CTGAAAGTAGAGAAGGGACAAGG - Intronic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159555620 18:69941812-69941834 ATGAGATTTCAGAGGGGCCAGGG + Intronic
1160381949 18:78465717-78465739 CTGATATTACAGATATGCAAAGG - Intergenic
1162143215 19:8596933-8596955 CTGAGAAAACAGATGGTCCAGGG - Intronic
1162457951 19:10797154-10797176 GTGTAGTTACAGAAGGGCCACGG - Intronic
1162913095 19:13860542-13860564 CTGGAATTACAGATGGAGCCCGG - Intergenic
1163816928 19:19472163-19472185 CTGGGATTATAGATGAGCCACGG + Intronic
926551286 2:14304259-14304281 TTGAAACTACAGATAGACCATGG - Intergenic
926598356 2:14814770-14814792 ATGAAATTTCAGAGGAGCCAGGG + Intergenic
926862438 2:17322962-17322984 CTGAAATGAAAGATTGGACATGG + Intergenic
930014509 2:46961091-46961113 CGGAAGTTACAAAGGGGCCATGG - Intronic
930449679 2:51519403-51519425 CTGAGATCACAGATGGGCTAAGG + Intergenic
932706074 2:74026105-74026127 CTGGTATTACAGAGGGGCAAAGG - Intronic
933885358 2:86714771-86714793 CTAAAATTACAGAGATGCCAGGG - Intronic
933924817 2:87081920-87081942 CTAAAATTACAGAGATGCCAGGG + Intergenic
933983024 2:87568988-87569010 TTGAATTCACAGTTGGGCCAGGG + Intergenic
936310820 2:111381807-111381829 TTGAATTCACAGTTGGGCCAGGG - Intergenic
937115724 2:119403920-119403942 CTGAGAATGCAGATGAGCCATGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
937831889 2:126433360-126433382 TTGAAAATAAAGATGGGACAAGG - Intergenic
939654175 2:144802155-144802177 CAGAAATCACAGATGAGCCAAGG + Intergenic
940148938 2:150578099-150578121 GTGAAATTTGAGAGGGGCCAGGG - Intergenic
940393202 2:153156874-153156896 CTGACAGTACAGATGAGACAAGG + Intergenic
941172982 2:162162497-162162519 GTGGAACTACAGATGGGGCAGGG - Intergenic
941871599 2:170391407-170391429 CTGAAAATACAAATTTGCCATGG + Intronic
941983894 2:171490736-171490758 CTGAATTTTCAGATTGCCCAAGG + Intergenic
942571421 2:177319025-177319047 CCCAAATTAAAAATGGGCCAAGG + Intronic
943325458 2:186492121-186492143 CTGTAGTTACAGATGGAGCATGG + Intronic
943371563 2:187022981-187023003 CTGAGGTGACAGATGGGACAAGG - Intergenic
943717771 2:191171317-191171339 CTGATACTTCAGATGGGCTAGGG - Intergenic
946411539 2:219517583-219517605 CTGGAATTACAGATTGGGCTGGG + Intronic
1170502765 20:16991599-16991621 CTGAAGTCACAGATTGACCATGG + Intergenic
1174888743 20:54366027-54366049 ATGAAATAACATATGTGCCAGGG - Intergenic
1175012980 20:55758587-55758609 CTGAAATTACAGTTGATCCTTGG - Intergenic
1175184376 20:57170111-57170133 GTGAAATTGCAGAGGGGACAAGG - Exonic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175880926 20:62258554-62258576 CAGAAAATACAGATGAGCAAAGG - Intronic
1176425446 21:6545711-6545733 GGGAAATTGCAGATGGGCCTGGG + Intergenic
1179700937 21:43154028-43154050 GGGAAATTGCAGATGGGCCTGGG + Intergenic
1181317379 22:21979341-21979363 CAGGAATTACAGAGGGGCCTGGG + Intronic
1181775613 22:25158245-25158267 CTGACATTAGAGAGGGGACAGGG + Intronic
1182466547 22:30520413-30520435 CTGGAAGAACAGATGGGCCCTGG - Intergenic
1182858126 22:33535819-33535841 GTGAAAATACAGATGGGACGGGG - Intronic
1183305162 22:37079101-37079123 CAGAAAACTCAGATGGGCCAAGG - Intronic
951934951 3:28012294-28012316 ATGAAATTACAGATGGAGCCAGG + Intergenic
952033676 3:29174775-29174797 CTGAAACCAGAGATGAGCCAGGG - Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
953415188 3:42711727-42711749 CTCATTTTACGGATGGGCCAGGG + Intronic
954136508 3:48584475-48584497 CTGCACTTACCGATGGTCCAGGG + Exonic
955231686 3:57105006-57105028 CTGATTTTACAAATAGGCCAAGG - Intronic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
958896434 3:99834955-99834977 CCGAAACTTTAGATGGGCCAGGG - Intronic
959374717 3:105574325-105574347 CTGAGATTATAGATGGGCTTGGG + Intronic
959946768 3:112133418-112133440 CTGAAATTACAGATGGGCCATGG + Intergenic
960843050 3:121979373-121979395 ATGAGATTTCAGAAGGGCCAGGG + Intergenic
963516467 3:146315866-146315888 ATGAGATTAGCGATGGGCCAGGG - Intergenic
963538834 3:146561711-146561733 ATGAGATTTCAGAGGGGCCAGGG - Intergenic
969411368 4:7030437-7030459 CTGAAACAACAGAGGGGCCGCGG - Exonic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
973142291 4:46783393-46783415 CTGAAATCACTGATAGGCAAAGG - Intronic
975433323 4:74320813-74320835 CTGAAATGACAGATCTGGCAAGG - Intergenic
976137662 4:81956455-81956477 CTGAATTAAAAAATGGGCCAAGG + Intronic
978270332 4:106881816-106881838 CTGAAACTTCAGATGGGAAATGG - Intergenic
979425317 4:120557242-120557264 CTGAAAATTCAGATGTGCAATGG - Intergenic
981326610 4:143455673-143455695 CTGAATTTACAGATGTGGCTTGG - Intronic
982090818 4:151878563-151878585 CTATAATTGCAGATCGGCCAGGG + Intergenic
983321855 4:166204979-166205001 CTTAAATTTAAGATGGGACAAGG + Intergenic
984705706 4:182845717-182845739 CTGGAATTACAGGTGTGACAGGG + Intergenic
987253220 5:16121633-16121655 TTCTAATTACAGAAGGGCCAAGG + Intronic
987992848 5:25237598-25237620 CTCAAATTACAGAGGTGACATGG - Intergenic
988858445 5:35252236-35252258 ATGAGATTTCAGAGGGGCCAGGG - Intergenic
989823651 5:45827306-45827328 CTGTAACTACAGCTGGGGCAGGG + Intergenic
990219989 5:53577391-53577413 CTGAAATGACACATGGGCCAAGG + Intronic
990698311 5:58446966-58446988 GTCAAATCACACATGGGCCAGGG + Intergenic
992091489 5:73321844-73321866 ATGAAATTTTAGATAGGCCAGGG - Intergenic
993029935 5:82694392-82694414 CAGAGATTACAGATGGACCTTGG - Intergenic
994690295 5:103010457-103010479 CTGAGAAGACAGAAGGGCCATGG - Intronic
995590871 5:113698691-113698713 ATGAGAGTTCAGATGGGCCAGGG - Intergenic
997944930 5:138191704-138191726 CTGAAAGCAAAGCTGGGCCAAGG - Intronic
999914174 5:156239075-156239097 CCCAAATTACTGATGCGCCACGG - Intronic
1000322791 5:160148247-160148269 CTAAAAATACAGATTGGGCACGG - Intergenic
1000581144 5:163036322-163036344 ATGAAATTTGAGAGGGGCCAGGG + Intergenic
1000609722 5:163360610-163360632 TTGAAATTTCGGAGGGGCCAGGG + Intergenic
1002629761 5:180563903-180563925 TTGAATTTACAGATGGCTCATGG + Intronic
1007691889 6:43707758-43707780 CTGATATTACAGGTGGGTCTGGG + Intergenic
1008065417 6:47042527-47042549 CTGAAATCACAGAAGGGAAATGG + Intergenic
1011045363 6:83076154-83076176 CTGAATTTTAAAATGGGCCAAGG + Intronic
1012053835 6:94379779-94379801 CTAAAATTACAAATGGGCTTTGG + Intergenic
1013947018 6:115733607-115733629 CTGCAATAACAGATGGCCCAAGG - Intergenic
1014904202 6:127006499-127006521 CTGAAATTTCAGCTGTGCTAGGG + Intergenic
1015549569 6:134398029-134398051 CTGATATTACAGATGGATCCAGG + Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018354722 6:163000866-163000888 GTGAAATTACCTATGAGCCAAGG + Intronic
1020649584 7:10857964-10857986 CTGCAATAACAGATGGGAGAAGG + Intergenic
1022471646 7:30685164-30685186 CTGACATCAGAGGTGGGCCATGG - Intronic
1024814958 7:53257541-53257563 ATGGAATTAGAGAGGGGCCAGGG + Intergenic
1026260666 7:68752668-68752690 CTGGAAGTCCAGCTGGGCCAGGG - Intergenic
1026681305 7:72468881-72468903 CTGAATTTAAAAATGGGCAAAGG - Intergenic
1028667060 7:93358166-93358188 TGGAAATTACAGTTGGGACATGG - Intronic
1029209899 7:98898630-98898652 CTCAAAATACAGATGGGCAATGG - Intronic
1030412169 7:109194562-109194584 CTCAATTTAAAAATGGGCCAAGG - Intergenic
1030617427 7:111752854-111752876 CTGGGATTACAGGTGAGCCATGG + Intronic
1031073436 7:117188589-117188611 CAAAAATTTCAGAAGGGCCAGGG - Intronic
1031164803 7:118214985-118215007 CTGAAAACACAGCTGGGACATGG - Intronic
1032538642 7:132685328-132685350 CTGAAATCAGAGGTGGGCCAAGG - Intronic
1032546679 7:132749552-132749574 ATCAATTTGCAGATGGGCCAAGG - Intergenic
1033436271 7:141336208-141336230 CTGGAAGTACAGAGTGGCCAGGG - Intronic
1033849028 7:145471861-145471883 AAGAAATGACAGATGGTCCAGGG - Intergenic
1034834307 7:154337557-154337579 CAGAAATGACAGATGGTGCAAGG - Intronic
1038473550 8:27845298-27845320 CAGAAATTAGAGATGAGCCTGGG + Intergenic
1038984426 8:32793110-32793132 CTCAAATGGCAGAAGGGCCAAGG + Intergenic
1039166644 8:34688500-34688522 CTGACATTACATTTTGGCCAGGG - Intergenic
1040892998 8:52336895-52336917 CAGAAACTACAGAAGGGGCATGG - Intronic
1041953935 8:63536710-63536732 ATGAGATTTCAGAGGGGCCAGGG - Intergenic
1042027784 8:64442580-64442602 CTGAAATTATTGATGTGACAGGG - Intergenic
1043164056 8:76881080-76881102 CTGAAATGAAAGATAGGCCTGGG - Intergenic
1043954046 8:86341703-86341725 GTGAAGTTAAAGATGTGCCAAGG + Intergenic
1044039644 8:87351323-87351345 CAGAAATTTCAAATGAGCCATGG + Intronic
1044562322 8:93625159-93625181 CAGAAACTACCGATGGCCCAGGG + Intergenic
1046711324 8:117514971-117514993 CTGCAATTACACAAGAGCCAGGG + Intergenic
1047015000 8:120714648-120714670 TTGAACTAACAGATGGGCTATGG + Intronic
1050526640 9:6552182-6552204 CTGAAATAAGAGAAGGCCCAAGG + Intronic
1051577860 9:18637827-18637849 CTCTAATTAAAGATGAGCCAAGG - Intronic
1056329257 9:85508470-85508492 CTGAAATAACAGATGGAACAGGG + Intergenic
1057314937 9:93961840-93961862 CAGAAAGTACAGATGTGACATGG - Intergenic
1057555482 9:96084331-96084353 CTAAAATTAGGGGTGGGCCACGG + Intergenic
1059198249 9:112391255-112391277 CAGAAATTAAAGATGAGCCTGGG + Intronic
1060060401 9:120454563-120454585 CTGAAGTCAGAGGTGGGCCAAGG - Intronic
1060103708 9:120860780-120860802 CTGAGTTTTCAGATGGGCTAGGG + Intronic
1061227338 9:129288405-129288427 TTTAAATTCCAGATGGGGCAGGG + Intergenic
1185514713 X:690844-690866 CTGAAAATACAGACGGGACACGG - Intergenic
1187026238 X:15438282-15438304 GCAAAATGACAGATGGGCCAAGG + Intronic
1188863329 X:35284984-35285006 ATGAGATTTCAGAGGGGCCATGG - Intergenic
1189201285 X:39197710-39197732 CTGAAACTGGAGGTGGGCCAAGG + Intergenic
1189203498 X:39217980-39218002 CTGAAATCAGAGATAGGCCAAGG - Intergenic
1196057172 X:111368190-111368212 CTGAAATTACAGTGGGTTCATGG + Intronic
1197059031 X:122154590-122154612 CTGAAATTTTGGAGGGGCCATGG + Intergenic
1197149649 X:123206156-123206178 TTGAAATTACAGGTGGAACAAGG - Intronic
1197450320 X:126605361-126605383 CTGAACTTAAAAATGGGCAAAGG + Intergenic
1197593333 X:128436642-128436664 CTGAAAATAAATATAGGCCAAGG + Intergenic
1199074313 X:143511755-143511777 TTGATATCACAGATGGGGCAAGG - Intronic