ID: 959946768

View in Genome Browser
Species Human (GRCh38)
Location 3:112133418-112133440
Sequence CTGAAATTACAGATGGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959946758_959946768 16 Left 959946758 3:112133379-112133401 CCGTCAATGAGAGCTTCGAACCT 0: 1
1: 0
2: 0
3: 5
4: 43
Right 959946768 3:112133418-112133440 CTGAAATTACAGATGGGCCATGG 0: 1
1: 0
2: 2
3: 17
4: 209
959946757_959946768 17 Left 959946757 3:112133378-112133400 CCCGTCAATGAGAGCTTCGAACC 0: 1
1: 0
2: 0
3: 2
4: 32
Right 959946768 3:112133418-112133440 CTGAAATTACAGATGGGCCATGG 0: 1
1: 0
2: 2
3: 17
4: 209
959946756_959946768 27 Left 959946756 3:112133368-112133390 CCAGCAACTACCCGTCAATGAGA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 959946768 3:112133418-112133440 CTGAAATTACAGATGGGCCATGG 0: 1
1: 0
2: 2
3: 17
4: 209
959946763_959946768 -4 Left 959946763 3:112133399-112133421 CCTCTGGGGAATCCCAGGTCTGA 0: 1
1: 0
2: 1
3: 20
4: 188
Right 959946768 3:112133418-112133440 CTGAAATTACAGATGGGCCATGG 0: 1
1: 0
2: 2
3: 17
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959946768 Original CRISPR CTGAAATTACAGATGGGCCA TGG Intergenic