ID: 959949961

View in Genome Browser
Species Human (GRCh38)
Location 3:112168837-112168859
Sequence TGGCATATTGATCTGAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 118}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959949961 Original CRISPR TGGCATATTGATCTGAAGAC AGG Intronic
903129153 1:21267093-21267115 TGGCATATGGGACTGAAGAGGGG - Intronic
905900657 1:41580273-41580295 TGTCAGATGGATCTGAGGACAGG + Exonic
909388605 1:75090786-75090808 GAGCATTTTGATCTGAAGAAAGG - Intergenic
910000636 1:82337354-82337376 TGGCTCATGGTTCTGAAGACTGG - Intergenic
910074073 1:83256795-83256817 TGGCATAAAGATATGAAGTCTGG - Intergenic
915082906 1:153364322-153364344 TTGGATAGTCATCTGAAGACAGG - Intergenic
916365636 1:164024439-164024461 TGGCCAAATGATCTGAAGAAAGG + Intergenic
918385321 1:184001345-184001367 TGGAATCTGGATCTGAAGATTGG + Intronic
919071687 1:192763735-192763757 TGGCAATTTTATCTGAAGTCAGG - Intergenic
1067273241 10:44810661-44810683 TGGCTTATGGTTCTGAAGATAGG - Intergenic
1067289833 10:44932663-44932685 GGACATCTGGATCTGAAGACTGG - Intronic
1070563709 10:77587847-77587869 TGGCACATATATCTGAAGACTGG - Intronic
1071276101 10:84056666-84056688 TGGAATATGGATGTGAAGGCTGG + Intergenic
1071359516 10:84832103-84832125 TGGGATATAAATCTGGAGACAGG + Intergenic
1073649772 10:105345748-105345770 TGGGAGATAGATCTGAGGACAGG + Intergenic
1073879354 10:107961942-107961964 TGGCTTAATGTTCTGGAGACTGG + Intergenic
1074409593 10:113214751-113214773 TGGCCCATCGATCTGCAGACTGG - Intergenic
1075244498 10:120808958-120808980 TGGCTTATAAACCTGAAGACAGG + Intergenic
1075860055 10:125667487-125667509 TGGCATTGTGTTCTGAAGATTGG - Intronic
1085432906 11:76471003-76471025 TTGTATATTGATATGAAGAATGG - Intronic
1085638096 11:78173554-78173576 TGCCATTTTGAGCTGCAGACAGG - Exonic
1088934567 11:114386540-114386562 TGCCATATTGCTCTGAACTCAGG + Intergenic
1097527303 12:60753277-60753299 CTGCATTTTGATCTGAAGACTGG - Intergenic
1101194294 12:102366931-102366953 TGGCATATTCATCAGGATACTGG - Intergenic
1103877162 12:124137088-124137110 TGCCATCTTGGTCTGAAGCCAGG + Intronic
1105393317 13:20003466-20003488 TATAATCTTGATCTGAAGACAGG - Intronic
1110286371 13:73754311-73754333 TTGCATATTGTTCTGGAGACTGG + Intronic
1111820518 13:93208083-93208105 TGGAAAATTCATCTGAAGAGAGG + Intergenic
1112969661 13:105244964-105244986 TAGCATACTGATCTGAAGATGGG - Intergenic
1115293789 14:31802652-31802674 TGGCTCATTGCTCTGTAGACTGG - Intronic
1116342557 14:43743409-43743431 TGATGTATTTATCTGAAGACAGG - Intergenic
1119425659 14:74533359-74533381 TGGCATGTTGAGATGCAGACAGG + Intronic
1120243256 14:81974730-81974752 TTGCTGATGGATCTGAAGACAGG - Intergenic
1121480149 14:94261271-94261293 TTGCATTTTGATATGAAGTCTGG + Intronic
1133003534 16:2864135-2864157 TGGCACATGGTTCTGGAGACTGG - Intergenic
1138128512 16:54458143-54458165 TGGCTTCTTGGTCTGTAGACTGG - Intergenic
1139110366 16:63883145-63883167 TGGAATCATCATCTGAAGACAGG + Intergenic
1142217354 16:88836232-88836254 TTTCCTATTAATCTGAAGACGGG - Exonic
1146500036 17:33356364-33356386 TGGGACATAGATCTGAAGCCTGG - Intronic
1146515607 17:33486830-33486852 CAGCATGTTGTTCTGAAGACAGG + Intronic
1146978794 17:37140455-37140477 ATGCATATTGATCTGTAGCCAGG - Intronic
1149819397 17:59760644-59760666 TGGCATCTTGCTCTGACGTCAGG + Intronic
1152255714 17:79238339-79238361 AGGCATTTGGATCTGAAGCCAGG + Intronic
1157542845 18:48524457-48524479 TGGAACATTAAACTGAAGACAGG + Intergenic
1157967116 18:52220787-52220809 TAGCATATAGATCTGAATTCAGG - Intergenic
1165556089 19:36633510-36633532 TGGCATATTGTTTTCCAGACCGG - Intergenic
1168724323 19:58572490-58572512 AGGCACAGTGATCTGAAGATGGG - Intronic
924980906 2:220663-220685 TTGCATCCTGATCTGATGACAGG - Intronic
925767618 2:7251837-7251859 TGGCATATGGTTCTGAAGGCTGG - Intergenic
931615919 2:64157802-64157824 TGTCAAATTACTCTGAAGACAGG + Intergenic
932074864 2:68653451-68653473 TGGAATTTTGATTTGAAGAAAGG - Intronic
932297950 2:70642386-70642408 TGGCTTTTTGATCTGCAGAACGG - Intronic
933919590 2:87031486-87031508 TAGCATATTGCTGTGAGGACTGG - Intergenic
933932042 2:87162320-87162342 TAGCATATTGCTGTGAGGACTGG + Intergenic
934003404 2:87738416-87738438 TAGCATATTGCTGTGAGGACTGG + Intergenic
936090841 2:109500476-109500498 CAGCATATTGGTCTGAAGACAGG + Intronic
936361075 2:111803114-111803136 TAGCATATTGCTGTGAGGACTGG - Intronic
940488143 2:154322893-154322915 TGGCATTTTGATGTGACGGCTGG + Intronic
941613013 2:167684470-167684492 AGGCATAATGATCTGAAAAAAGG - Intergenic
944395857 2:199265302-199265324 TGGCATATTGAGTCGGAGACAGG - Intergenic
946014925 2:216596112-216596134 TGGCATTTTGTTGAGAAGACGGG + Intergenic
948499102 2:238378772-238378794 TCGCAGTTTGATCTGAAGCCGGG + Intronic
948737402 2:240017901-240017923 CGGCATTTTCATCTGTAGACTGG - Intronic
1169376054 20:5067365-5067387 TGGCATATTCATCTGCAGCGTGG - Intergenic
1169519005 20:6351165-6351187 TTGCATATTCAGCTGATGACAGG - Intergenic
1170713680 20:18814065-18814087 TGGACCATTGATCTGAAGAATGG + Exonic
1171452165 20:25243745-25243767 TGGCTCATGGTTCTGAAGACTGG + Intergenic
1175308830 20:57997200-57997222 TGGCTCAGTGATGTGAAGACAGG + Intergenic
1175344446 20:58262300-58262322 AGGCATCCTGATCTGAAGGCAGG + Intergenic
1177441785 21:21135402-21135424 TGGCATATTGCTCAGTAGAAAGG + Intronic
1179900168 21:44388032-44388054 TGGCATATGTATCTGAGGAGTGG - Intronic
1182984556 22:34704296-34704318 TTGCATTGTGATCTGAAGATGGG - Intergenic
950154649 3:10712508-10712530 TGGGAAAATGATCTGAAGTCAGG - Intergenic
951843786 3:27063483-27063505 TGACATAATGAGCAGAAGACTGG - Intergenic
954644680 3:52123877-52123899 TGGCTTATTGCTTAGAAGACAGG - Intronic
955998054 3:64698297-64698319 TGGCTTATAGTTCTGGAGACTGG + Intergenic
957656788 3:83089687-83089709 TGGCTTATGGTTCTGCAGACTGG + Intergenic
957848500 3:85773068-85773090 TCGCATATTGATCCCAAGAGTGG + Intronic
958440479 3:94150458-94150480 TGGCTTATGTTTCTGAAGACTGG + Intergenic
959146578 3:102553526-102553548 TGGCTTATTGATCTGAAGGCTGG + Intergenic
959949961 3:112168837-112168859 TGGCATATTGATCTGAAGACAGG + Intronic
963626971 3:147685401-147685423 GGGTATCTTGATTTGAAGACTGG - Intergenic
963987249 3:151610704-151610726 TGGCATATGGTTCTGGAGGCTGG + Intergenic
965334351 3:167417955-167417977 TAGAATATTGATTTGATGACTGG + Intergenic
965699554 3:171445872-171445894 TGGCAGTTTCATCTGAAGCCAGG + Intronic
969946630 4:10790149-10790171 TGGCCAATGGATCTGAAGCCAGG + Intergenic
970003249 4:11385570-11385592 TGGCTTACGGTTCTGAAGACTGG - Intergenic
971075814 4:23147960-23147982 TGACCTACTGATCTTAAGACTGG - Intergenic
971848278 4:31948000-31948022 TTGCATATTAAACTGAGGACAGG - Intergenic
972976913 4:44646724-44646746 TGGTGTATTGATCTGAAAGCTGG - Intronic
974144151 4:57925252-57925274 AGGCATATTGCTCAGAAAACAGG + Intergenic
974786389 4:66623912-66623934 TGGCAGATTGCACAGAAGACTGG - Intergenic
975033657 4:69656216-69656238 TGGCATTTTCATCTGAAAATGGG - Intergenic
982056898 4:151560081-151560103 GGGCATATTTTTCTGAAGAGAGG - Intronic
987324273 5:16798160-16798182 TGGCTTATGGTTCTGGAGACTGG - Intronic
988414618 5:30930446-30930468 GGGCATCTTGACCCGAAGACTGG - Intergenic
989104909 5:37853345-37853367 TAGCTTAGTGATCTGAAGAAAGG + Intergenic
995012678 5:107275589-107275611 TGGCATCTAGATCCCAAGACAGG - Intergenic
995585432 5:113643473-113643495 TGGCTTGTAGTTCTGAAGACTGG - Intergenic
998322485 5:141245801-141245823 TTGCAGCTTGATCTGCAGACCGG + Exonic
1000689290 5:164295021-164295043 TGTCATATTCATCTTAAAACTGG + Intergenic
1003384650 6:5656004-5656026 TGGCTTATTACTCTGAAAACTGG + Intronic
1006876604 6:37302995-37303017 TGGAATATTGATGTGATGGCTGG - Intronic
1009400661 6:63251522-63251544 TGGCTTATTGTTCTGGAGGCCGG - Intergenic
1014866905 6:126543588-126543610 TGTAACATTGATCTTAAGACTGG + Intergenic
1016317058 6:142801977-142801999 TGCCATATTAATCTGTAGACTGG + Intronic
1016725649 6:147363210-147363232 ACGCATATTGAACTGAACACTGG - Intronic
1019215844 6:170443373-170443395 TGGCAGAATGTCCTGAAGACAGG - Intergenic
1023760880 7:43464033-43464055 TGGCATGGGGATCTGGAGACAGG + Intronic
1025264666 7:57446774-57446796 AGGCAGATTAATCTAAAGACAGG + Intergenic
1026407301 7:70079839-70079861 TGGCAGATGGTTCTGGAGACTGG + Intronic
1026658348 7:72276780-72276802 TGGCTGATGGTTCTGAAGACTGG - Intronic
1027180122 7:75933207-75933229 TGGCATATTGTTTTGAAGTCTGG + Intronic
1027291773 7:76721658-76721680 TGGCATAAAGATATGAAGTCTGG - Intergenic
1028801674 7:94972730-94972752 AGGAAGATTAATCTGAAGACAGG + Intronic
1028885648 7:95929626-95929648 CTGAATCTTGATCTGAAGACTGG - Intronic
1029475995 7:100784966-100784988 TGGCACATTGATCTCCAGCCAGG + Intronic
1030456897 7:109785947-109785969 TTGCATATAGATTTGAAGACTGG + Intergenic
1033118311 7:138645546-138645568 TGGCATATTGCTGTGGAGGCTGG - Intronic
1033364542 7:140661704-140661726 TGGCAGATTGTTCTGAGCACAGG - Intronic
1033552641 7:142461925-142461947 TGGCTTATAGATGTGGAGACTGG - Intergenic
1033554962 7:142481210-142481232 TGGCTTATAGATCTGGAGACCGG - Intergenic
1033559569 7:142518741-142518763 TGGCTTATAGATCTGGAGACTGG - Intergenic
1037365134 8:18114176-18114198 TAGCATATTATTCTGAAGTCAGG + Intergenic
1042249211 8:66739147-66739169 TGGCCCATTGTTCTGAAGGCTGG + Intronic
1050073087 9:1837022-1837044 TGAAAAATTGATCTGATGACTGG + Intergenic
1058462088 9:105192197-105192219 TGAAATTTTGATCTGAAGTCAGG - Intergenic
1188750262 X:33896306-33896328 TGGCTTATGGTTCTGAAGCCTGG - Intergenic
1194462054 X:94182999-94183021 TGGCATATGGATGTGAAGCTTGG - Intergenic
1197848489 X:130830951-130830973 TGGCCTATGGTTCTGAAGGCTGG + Intronic
1201929825 Y:19330481-19330503 GGGTGTATTGCTCTGAAGACAGG - Intergenic