ID: 959952978

View in Genome Browser
Species Human (GRCh38)
Location 3:112201946-112201968
Sequence CTCTAAGATCTGTCAGGCTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959952978_959952982 11 Left 959952978 3:112201946-112201968 CCATAGCCTGACAGATCTTAGAG 0: 1
1: 0
2: 0
3: 8
4: 113
Right 959952982 3:112201980-112202002 AGAAAGCTAACCACTGCACTTGG 0: 1
1: 0
2: 0
3: 10
4: 136
959952978_959952983 12 Left 959952978 3:112201946-112201968 CCATAGCCTGACAGATCTTAGAG 0: 1
1: 0
2: 0
3: 8
4: 113
Right 959952983 3:112201981-112202003 GAAAGCTAACCACTGCACTTGGG 0: 1
1: 0
2: 0
3: 7
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959952978 Original CRISPR CTCTAAGATCTGTCAGGCTA TGG (reversed) Intronic
904697678 1:32339342-32339364 CTTTAAGGTCTGTCAGGCCCCGG + Intergenic
906040989 1:42787639-42787661 CTGTGAGCTCTGTCAGGCAAGGG - Intronic
908323665 1:63002463-63002485 CTCCAAGATCTCTCAGGAAATGG + Intergenic
908884531 1:68773141-68773163 CTGTAAGCTCTGTGAGGTTAGGG + Intergenic
910532777 1:88259379-88259401 ATGTATCATCTGTCAGGCTAGGG + Intergenic
911653096 1:100411787-100411809 ATCTAAGCTCTGTCAGGACAGGG - Intronic
914357926 1:146904014-146904036 CTCTTAGATCTCTCATCCTAGGG - Intergenic
922424630 1:225481429-225481451 TTCTGTGATCTGTCACGCTATGG - Intergenic
1064633118 10:17337514-17337536 ATCTAAGATGTCACAGGCTAAGG + Intronic
1064975534 10:21110783-21110805 CTTTAAGAACAGTCAGGTTAGGG + Intronic
1065774732 10:29108904-29108926 CTCTCAGCTCTATCAGGCCAGGG - Intergenic
1070482123 10:76892960-76892982 CTTTAGGGTCTGGCAGGCTATGG - Intronic
1078757547 11:14225045-14225067 CTTTATGATTTCTCAGGCTATGG + Intronic
1080947893 11:36995497-36995519 TTCTAAGATCTCTAAGACTAGGG - Intergenic
1082202897 11:49395158-49395180 CTTTATGATCTATCATGCTATGG + Intergenic
1084073426 11:66753282-66753304 CTCTAAGTTCTCTCCAGCTAAGG + Intronic
1085367418 11:75963177-75963199 CTCTAAGCTCTATAAGGCGAGGG + Intronic
1086652131 11:89304921-89304943 CTTTATGATCTATCATGCTATGG - Intergenic
1088098311 11:106125524-106125546 TTCTAAGAACTGTCAGGAAACGG + Intergenic
1091781582 12:3217364-3217386 CTCTGACATCTGTCTAGCTATGG + Intronic
1096226740 12:49870892-49870914 CTCTAAGCTCTGTGAGGACAGGG - Intronic
1097994214 12:65870142-65870164 CTTTAAGACCTTTCAGTCTAGGG + Intronic
1099551421 12:84049006-84049028 CTCTAAGCTCTGTCTGTTTAGGG + Intergenic
1101922556 12:108944595-108944617 CTCTGAGATCTTTCAGACCATGG + Intronic
1105687372 13:22797876-22797898 CTCTAAGCTCTTTAAGGATAAGG + Intergenic
1111503954 13:89162090-89162112 TTCAAAGATCTGACAGGCAATGG - Intergenic
1115565471 14:34621560-34621582 ATGTAAGATCTGTAAGGCTGAGG - Intronic
1117436696 14:55721769-55721791 GTTTAAGATCTGCCAGGTTATGG - Intergenic
1120366391 14:83576542-83576564 CTCTGAAATCTGTCAGGGTCTGG + Intergenic
1128136951 15:65270899-65270921 CCCTAAAATCTGTGATGCTACGG + Intronic
1133631238 16:7623858-7623880 TTGTAAGATCTGTCAGATTAAGG + Intronic
1134866250 16:17609930-17609952 CTCATAGAGCTTTCAGGCTAGGG - Intergenic
1139976258 16:70813278-70813300 CTCTTAGATCTCTCATCCTAGGG + Intronic
1140790797 16:78389122-78389144 CTCTCAGATCTGGCTGGCTGGGG - Intronic
1143185118 17:5005372-5005394 CACTGAGATCTGTTAGGCTATGG - Intronic
1151661699 17:75522340-75522362 CTCGAAGATGTGGCAGGCTGAGG - Intronic
1151836635 17:76586330-76586352 CCCTCAGATCTGTCAGTCTGCGG + Intronic
1155344643 18:24846450-24846472 CTCTAATGTCTTTGAGGCTATGG - Intergenic
1156607932 18:38690667-38690689 CCCTAAGTTATGTCAGGTTAGGG - Intergenic
1159331081 18:66994643-66994665 TTCAAAAATCTCTCAGGCTAAGG + Intergenic
1159616961 18:70592133-70592155 ATGTAAGATCTGACAGGCTGAGG - Intergenic
1163792502 19:19315913-19315935 CTCTGGGATCTGGCAGGCAAAGG - Intronic
1164476528 19:28579788-28579810 CTCTAAGATATGGGAGGCTGGGG + Intergenic
925079313 2:1050123-1050145 CACAAAGATCTGTCACTCTATGG + Intronic
925154938 2:1641599-1641621 CTCTAAGCTGTGTCAGCTTAAGG + Intronic
925819866 2:7789702-7789724 CTCTAATATCTTTCAGGTTTTGG - Intergenic
927832056 2:26359991-26360013 CTCTACAATCTATCAGGCTAGGG - Intronic
928193335 2:29194095-29194117 CTCTAAGGTCTTTGAGGATAAGG - Intronic
929244318 2:39685482-39685504 CTCTAAGCTCTGTGAGGGTAGGG + Intronic
931553481 2:63472998-63473020 ATCTCAGATCTGTAAGTCTAAGG - Intronic
932834990 2:75027926-75027948 CTCTAAGAACTGTGAGGTTCTGG + Intergenic
932973166 2:76570424-76570446 CTATAAGATTTGCCAGGCAAAGG + Intergenic
935702786 2:105826766-105826788 CTCTAAAATGTGCCAGGATAAGG - Intronic
937971305 2:127551445-127551467 CTCTAAGATCTCTCAGCCTGGGG - Intronic
939010177 2:136837245-136837267 CTGTAAGATCTGCCAGGGTCTGG + Intronic
941123096 2:161554156-161554178 CTCTTAAGTCTTTCAGGCTAAGG + Intronic
943869828 2:192979872-192979894 CTGTAAGAACTATCAGGCCATGG + Intergenic
944136303 2:196403718-196403740 CTATAAGACCAGTCAGCCTAAGG + Intronic
945327865 2:208503839-208503861 CACTAAGATTGGTCAAGCTAAGG - Intronic
945687021 2:212984039-212984061 ATCTAAGGTCTGTCAATCTAAGG - Intergenic
945741703 2:213671395-213671417 CTCTAAGAACTCTCAGAGTAAGG + Intronic
946550745 2:220799483-220799505 CTCACAGATCTGACAGACTATGG - Intergenic
946587366 2:221205014-221205036 CGATAAGAACTGTCAGACTAAGG + Intergenic
948272399 2:236684689-236684711 CTCTAAGATGTGCAAGGCTCTGG + Intergenic
948399270 2:237671263-237671285 CTCTCAGATCTGTATGGCTGTGG - Intronic
1168949614 20:1787688-1787710 CTCTAAGATCAGCCAGGAGAGGG - Intergenic
1173891416 20:46513699-46513721 CTCAAAGATCCCTCAGGGTAGGG - Intergenic
949564068 3:5228989-5229011 TTCCAAGATCTGTCAGGGTTAGG - Intergenic
950624522 3:14235065-14235087 CCCTAAGCTCTGGCAGGGTAGGG - Intergenic
952180924 3:30915661-30915683 CTCCAAGATCTGCCCAGCTAAGG + Intergenic
953746898 3:45581939-45581961 CTGTAAGCTCTGTGAGGGTAAGG - Intronic
954111106 3:48433642-48433664 CTCCATGATCTGCCAGGCTAGGG + Intronic
957840053 3:85656028-85656050 CTCTAAGATGTGACAGGGAATGG - Intronic
958801350 3:98759709-98759731 CTCTAAGATCTGTAATTCTTGGG + Intronic
959952978 3:112201946-112201968 CTCTAAGATCTGTCAGGCTATGG - Intronic
960699066 3:120423489-120423511 CACAAAGATCTGTGAGGCTCAGG + Intronic
960864865 3:122189255-122189277 CTTTGAGATCTGTGAAGCTAAGG + Intronic
961212508 3:125136624-125136646 CTCTTAGATCTCTCAGCCTATGG + Intronic
962968034 3:140372058-140372080 CTCTAGGATCTTTCAGGTTTGGG - Intronic
964382923 3:156115900-156115922 CTCTTAGATATGTAATGCTAAGG + Intronic
966880620 3:184348166-184348188 CTCTAAGTACTGTCATGCCATGG - Intronic
970280760 4:14452341-14452363 CTGTAAGATGTCTCAGGCTCTGG - Intergenic
970307150 4:14744700-14744722 CTGTAAGATCAGTGAGGCTCTGG + Intergenic
970359256 4:15291910-15291932 CTCTACTACATGTCAGGCTATGG - Intergenic
970799503 4:19955620-19955642 CTCTAAGATCCATAAGACTAAGG + Intergenic
971050263 4:22854213-22854235 CTTTAAGAGCTGTGAGGCAAAGG - Intergenic
976114573 4:81713325-81713347 CCCTCAGATTTGTCAGGCTGTGG + Intronic
981535240 4:145793226-145793248 CTCTTAGTTCTGTCACTCTAGGG - Intronic
986912822 5:12577605-12577627 CTCTAACATTTGTGAGGCTCAGG + Intergenic
989145609 5:38246452-38246474 CTTTTAGATCTATCAGGCCAAGG - Intergenic
994752560 5:103756481-103756503 CTCTAAGAACTGGCAGGTCAGGG + Intergenic
995243504 5:109911985-109912007 CTCTGAGATCTGTCTGCCCATGG - Intergenic
996163479 5:120195799-120195821 TTCTAAGCTCTGTCAGTCAATGG + Intergenic
996309010 5:122081683-122081705 CTCTAAAATCTCTCTGGCTTAGG + Intergenic
997199385 5:132000492-132000514 CTGCAAGATCTGTGAGGCTTAGG + Intronic
1001097611 5:168787866-168787888 CTGTAAGCTCTGTCAGGCCAAGG + Intronic
1004850157 6:19690965-19690987 GTCTAAGATCTGCCAGGAAAAGG - Intergenic
1007265296 6:40591110-40591132 GTCCAAGTTCTGTGAGGCTAAGG - Intergenic
1007323036 6:41040858-41040880 GTGAAAGATCTGTCAAGCTAGGG + Intronic
1011426142 6:87232948-87232970 CCCTAAAATCTGTAATGCTAGGG - Intronic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1016747195 6:147593263-147593285 CTCTCAGCTCTGTTAGGATAGGG - Intronic
1022950382 7:35332618-35332640 CACTCAGATCCGTCAGGCTATGG + Intergenic
1024057437 7:45670902-45670924 CTCTCAGAACTGTCAGACCAGGG + Intronic
1026377268 7:69764482-69764504 CTCTAAGAACTGCTAGGGTAAGG - Intronic
1027345428 7:77254648-77254670 CTTTAAAATGTTTCAGGCTATGG - Intronic
1027980700 7:85217404-85217426 CTATAAGATCTGTGAGGACAAGG - Intergenic
1037267800 8:17085793-17085815 ATCTAAGAACTATCAGCCTATGG - Intronic
1040093717 8:43422395-43422417 CTCTAAATTTTGTCAGGCTCCGG - Intergenic
1041717308 8:60943820-60943842 CTGTAAGCTCTGTGAGGCTGGGG + Intergenic
1045031935 8:98145258-98145280 CCCTAAAATCTGTCACACTATGG + Intronic
1045451380 8:102329986-102330008 CTGTAAGCTCTTTCAAGCTATGG + Intronic
1047570799 8:126096754-126096776 CACAAAGATCATTCAGGCTAGGG - Intergenic
1049672625 8:143876695-143876717 CTCCAGGATCTGTGAGCCTAAGG + Intronic
1054874337 9:70079467-70079489 CAATAAGATCTGACAGTCTAGGG - Intronic
1056232285 9:84559036-84559058 CTCTTACATCTGTCATCCTAGGG - Intergenic
1058359722 9:104130303-104130325 CTCAAAGTTTTGTCAGGTTAGGG - Intronic
1060916488 9:127394801-127394823 CTATAAAATCTGTCAGACCAAGG - Intergenic
1193809103 X:86030574-86030596 CTCTGAGCTCTAACAGGCTAGGG - Intronic
1195109906 X:101637581-101637603 CCCTAAGATGTATCAAGCTATGG + Intergenic
1198637363 X:138714183-138714205 CTCTGTGATCTGTCTGTCTACGG + Intronic
1199307709 X:146286941-146286963 CTGTAAGATTTGTAAGGGTAGGG + Intergenic