ID: 959956530

View in Genome Browser
Species Human (GRCh38)
Location 3:112244724-112244746
Sequence GAAACATAAATTCTGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 562
Summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 499}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959956530_959956534 13 Left 959956530 3:112244724-112244746 CCAACTTCCAGAATTTATGTTTC 0: 1
1: 0
2: 3
3: 59
4: 499
Right 959956534 3:112244760-112244782 TTCTGTTCTGTATCCACAGATGG 0: 1
1: 0
2: 1
3: 30
4: 270
959956530_959956535 20 Left 959956530 3:112244724-112244746 CCAACTTCCAGAATTTATGTTTC 0: 1
1: 0
2: 3
3: 59
4: 499
Right 959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG 0: 1
1: 0
2: 2
3: 18
4: 176
959956530_959956536 21 Left 959956530 3:112244724-112244746 CCAACTTCCAGAATTTATGTTTC 0: 1
1: 0
2: 3
3: 59
4: 499
Right 959956536 3:112244768-112244790 TGTATCCACAGATGGAATTAGGG 0: 1
1: 0
2: 1
3: 16
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959956530 Original CRISPR GAAACATAAATTCTGGAAGT TGG (reversed) Intronic
901048389 1:6412960-6412982 GAATGAGAACTTCTGGAAGTGGG + Intronic
902182032 1:14696695-14696717 GAATCAGAAACTCTGGGAGTGGG - Intronic
903457018 1:23494640-23494662 GAATCTGAAATTCTGGATGTTGG - Intergenic
904818650 1:33225297-33225319 GAAAAATAATTTCAGGAAGAAGG - Intergenic
904842785 1:33384227-33384249 GAATCAGAAATTCTGGGAGCAGG + Intronic
905677412 1:39837313-39837335 GCCACATAAAGTCTGAAAGTAGG + Intergenic
906359991 1:45147279-45147301 AAAATCTAAATTCTGAAAGTGGG + Intronic
906713199 1:47948052-47948074 GCAACAAAAATTCTGGAATTTGG + Intronic
907381982 1:54098578-54098600 GAAGCTTACATTCTGGGAGTGGG - Exonic
907504178 1:54905592-54905614 GAAGCAAAAATTCTGGAAGTGGG + Intergenic
907806680 1:57827527-57827549 GAAAAATAAATTATGGAAGATGG + Intronic
908046333 1:60173544-60173566 GAATCAGAAATTCTGGAGTTAGG - Intergenic
908784457 1:67721425-67721447 GAATCAGAAACTCTGGGAGTGGG + Intronic
909225675 1:73018944-73018966 GAAACATGAAGTCTAGAAGTTGG + Intergenic
909339686 1:74517837-74517859 GAATCAGAAACTCTGGTAGTGGG - Intronic
910371475 1:86520853-86520875 GAAACAAAAATTTAGGAAATAGG - Intergenic
910547514 1:88434329-88434351 AAAGCAGAAATTCTGGAACTGGG + Intergenic
910593746 1:88955785-88955807 GAATCAGAAACTCTGGGAGTGGG + Intronic
911616642 1:100019862-100019884 GAAAAATAATTTAGGGAAGTGGG - Intronic
912220384 1:107667258-107667280 TACACAGAAATTCTGGAAGGTGG + Intronic
912738507 1:112172034-112172056 GAATCAGAAACTCTGGAAGCAGG - Intergenic
912803605 1:112737897-112737919 GAAAAAGATATTCTGTAAGTTGG - Intergenic
916160122 1:161903011-161903033 GAAAAAAAAGGTCTGGAAGTTGG - Intronic
916434514 1:164765208-164765230 GAGACAAAAATCATGGAAGTAGG - Intronic
916550621 1:165846461-165846483 AAAACAAAACATCTGGAAGTTGG + Intronic
917560601 1:176150186-176150208 GAGGCATAGACTCTGGAAGTGGG - Intronic
917810788 1:178656755-178656777 GAAACAGAATCTCTGGAAATGGG - Intergenic
918115341 1:181491364-181491386 GAACCAGAAACTCTGGGAGTGGG - Intronic
918164718 1:181934197-181934219 GAAAAAAAAATTGTGGAGGTGGG + Intergenic
918468085 1:184842301-184842323 GAATCAGAAACTCTGGGAGTGGG - Intronic
918747872 1:188228864-188228886 GAAACATAAATTGTGGAGTGGGG + Intergenic
919340919 1:196305558-196305580 GAAAAATAAATTCAGTAATTTGG + Intronic
919404041 1:197153333-197153355 GAAACATACATTCTGGCTATGGG - Intergenic
920690561 1:208143345-208143367 GAATCAGAAATTCTGGAGGTGGG - Intronic
921562618 1:216676601-216676623 GAATCAGAAATTCTGGAGGTAGG + Intronic
922662733 1:227444296-227444318 GAAACAAAAATTTTGCTAGTGGG - Intergenic
923812337 1:237332978-237333000 AAAACATAAATCCTAGAAGCTGG - Intronic
924442103 1:244095119-244095141 GTTACATAAATTCAGCAAGTGGG + Intergenic
924552647 1:245092622-245092644 GAAACAGAATCTCTGGAGGTAGG + Intronic
1063277797 10:4590231-4590253 TAAACATGAATTCTGGAGCTAGG + Intergenic
1063714980 10:8517890-8517912 GAATCAGAATTTCTGGGAGTAGG - Intergenic
1064661606 10:17613504-17613526 GTGATATAAATTCTGGAAATAGG - Intronic
1065791424 10:29263975-29263997 GCAACATAAATGGAGGAAGTGGG + Intergenic
1066137174 10:32460816-32460838 AAATCAGAAATTCTAGAAGTGGG - Intronic
1067854972 10:49784215-49784237 AAAACATAAATTCTTGAATATGG - Intergenic
1068424417 10:56840106-56840128 GAAACAAAAACTATGGAAGCTGG + Intergenic
1069002976 10:63286035-63286057 AAATCAGAAATTCTAGAAGTGGG + Intronic
1069058911 10:63873016-63873038 CACAAAGAAATTCTGGAAGTGGG - Intergenic
1069106465 10:64388565-64388587 GAACCATAAATACTGGAGTTTGG - Intergenic
1069331614 10:67300086-67300108 GAATTAGAAATTCTGGAGGTGGG + Intronic
1070141581 10:73742005-73742027 GAGCCAGAAATTCTGGAGGTGGG - Intergenic
1070170355 10:73928186-73928208 GAATCAGAAATTCTAGAGGTGGG + Intergenic
1071922031 10:90361242-90361264 GTAACAAAATTTCTGGAGGTTGG - Intergenic
1071964058 10:90834372-90834394 GGAACATAAATTCGGGGGGTGGG + Intronic
1072345439 10:94500678-94500700 AAAACATAAATACTGGAGGAAGG + Intronic
1072902336 10:99419545-99419567 GAACCATAAAATATGGAAGAGGG - Intronic
1073160944 10:101394257-101394279 CAAATATAAATTTTGGAAATGGG + Intronic
1073722676 10:106191323-106191345 GAATCAGAAACTCTGGATGTGGG + Intergenic
1074074026 10:110103900-110103922 GAAAAATAAATTGTGGCAGAAGG - Intronic
1074170035 10:110923973-110923995 GACACATAATTTCTAGAACTTGG + Intronic
1075346586 10:121686511-121686533 TATATATATATTCTGGAAGTAGG + Intergenic
1075705990 10:124501299-124501321 GATACAAATATTCTGGAACTGGG + Intronic
1076500906 10:130935263-130935285 GAATCAGAAACTCTGGGAGTGGG - Intergenic
1077745506 11:4899893-4899915 GAAACACAAATTTTCCAAGTAGG + Intronic
1078906346 11:15691711-15691733 GAAACACAAATTCTGCAGGTGGG - Intergenic
1079049960 11:17145463-17145485 GAAACTTAAATCATGGAAGAAGG - Intronic
1080208036 11:29753886-29753908 GAGACATAAAGTCTGAGAGTTGG - Intergenic
1081130831 11:39378025-39378047 GTAGAATAAATTCTGTAAGTTGG - Intergenic
1081191422 11:40106848-40106870 GACACTTAACTTCTGAAAGTTGG - Intergenic
1081224878 11:40508445-40508467 GAAACTGAAATTATGGAAGTTGG + Intronic
1081558265 11:44187629-44187651 GAAACATAAATTTTAGAATTGGG + Intronic
1082547044 11:54344921-54344943 GAAAGTTCAATTCTGGAAGTTGG - Intergenic
1082547652 11:54353107-54353129 GAAAGTTCAATTCCGGAAGTTGG - Intergenic
1082552361 11:54415557-54415579 GAAAGTTCAATTCCGGAAGTTGG - Intergenic
1082553475 11:54530457-54530479 GAAAGTTCAATTCCGGAAGTTGG - Intergenic
1082553630 11:54532504-54532526 GAAAGTTCAATTCCGGAAGTTGG - Intergenic
1083583724 11:63841110-63841132 GAAACATAAAGGATGGAAGGAGG - Intronic
1084131438 11:67138773-67138795 GAATCAGAAAGTCTGGCAGTGGG + Intronic
1084919452 11:72457495-72457517 GAAACATGAATTCCACAAGTGGG - Intergenic
1085048663 11:73368156-73368178 GAAACATAAATACTGTACATGGG - Exonic
1085799195 11:79572475-79572497 GAATCAGAAACTCTGGAGGTGGG - Intergenic
1085956809 11:81408285-81408307 GAAGCATCTATTCAGGAAGTTGG + Intergenic
1086316031 11:85593387-85593409 GAATAAGAAACTCTGGAAGTAGG - Intronic
1086394542 11:86400446-86400468 ATAACATAAATGCAGGAAGTGGG - Intronic
1086399904 11:86452132-86452154 GAAGCAAAAATTCTGTACGTGGG - Intronic
1087144945 11:94801703-94801725 GATACAGAAATTCTGGAATAGGG + Intronic
1087834555 11:102859561-102859583 GAAACCTAAATTATAGACGTGGG - Intergenic
1088056385 11:105584899-105584921 TCAAGATAAATTCTGGGAGTGGG + Intergenic
1089024201 11:115251438-115251460 GAAACAGAAAATTGGGAAGTGGG + Intronic
1089087621 11:115836611-115836633 GAATTAGAAACTCTGGAAGTGGG + Intergenic
1089939277 11:122398388-122398410 GAAACACAAATTCTGCAAGTAGG - Intergenic
1089940404 11:122410688-122410710 TATACAGAAATGCTGGAAGTTGG + Intergenic
1090298018 11:125607594-125607616 GAATCAGAAACTCTGGAGGTGGG + Intronic
1090474574 11:127008033-127008055 CAAAAATAAATTCTGAAAGGTGG - Intergenic
1091130819 11:133145846-133145868 CAAACAAAAGATCTGGAAGTTGG + Intronic
1091415096 12:275975-275997 GAAACAGAAACTCTGGGAGTGGG - Intergenic
1092331120 12:7588982-7589004 GAAACAGAAATTCTGGGCGGAGG + Intergenic
1092676402 12:10925731-10925753 GAAACATAAGTTCTGTTATTAGG - Intronic
1093406699 12:18813255-18813277 GACACACAAATTCTCTAAGTGGG - Intergenic
1093423036 12:18997013-18997035 CAAACAGAAATTCTAGAACTGGG - Intergenic
1093763790 12:22939449-22939471 AAAACATAAACTTTGGAAGCGGG + Intergenic
1094733853 12:33209966-33209988 GAAAAATAAATACTGTAAGAAGG - Intergenic
1096984819 12:55749355-55749377 AAAAGATAAATTCTGGGGGTGGG + Intronic
1097199089 12:57263048-57263070 AAAACAACAGTTCTGGAAGTTGG - Intronic
1098343973 12:69481269-69481291 AAAAAAAAAATTCTGGAATTTGG - Intronic
1098846049 12:75537481-75537503 GAAATATACATTTTGGAATTAGG - Intergenic
1100781034 12:98026612-98026634 GAAATACAAATTTTGGAATTTGG + Intergenic
1101308301 12:103553456-103553478 GAAAAATCTTTTCTGGAAGTTGG - Intergenic
1101683930 12:106998013-106998035 GGAGCATAAATGCTGGAAGTTGG - Exonic
1101829094 12:108243183-108243205 GAATCAGAAATTCTGGGAGTGGG + Intronic
1102638358 12:114344487-114344509 GAGACATAGATGCTGGAGGTAGG + Intergenic
1103305163 12:119958417-119958439 GAAGCACAAAATCTGCAAGTGGG + Intergenic
1103691173 12:122775333-122775355 GTACCAAAAAGTCTGGAAGTGGG + Intronic
1104520425 12:129469411-129469433 GAATCAGAAATTCTGGAGGGGGG + Intronic
1106473086 13:30075485-30075507 GAAACATAAATTCAGAGAGTGGG + Intergenic
1106527838 13:30558834-30558856 GAATCAGAAACTCTGGGAGTAGG + Intronic
1106558781 13:30831805-30831827 TAAACAGAATTTCTGGGAGTAGG - Intergenic
1107911287 13:45107951-45107973 GAGACAAAAAAACTGGAAGTTGG + Intergenic
1108180124 13:47832402-47832424 GAAAGATAAATTTTGTAAGCAGG - Intergenic
1108351977 13:49596182-49596204 AAAACATAAATTCTTTAACTGGG - Intergenic
1109707521 13:66116343-66116365 GAAACATCAATTATGAAAATTGG - Intergenic
1110279648 13:73678305-73678327 TAAACCTAAATTATGGAATTTGG - Intergenic
1110332076 13:74284345-74284367 GAAACAAAAAGTCTTGAAGGGGG + Intergenic
1111261380 13:85745195-85745217 GAAACAGAAACTCTGGTAATGGG + Intergenic
1112010520 13:95290173-95290195 GAAAAATAATTTCTGGGGGTGGG - Intronic
1113546145 13:111153102-111153124 GCAACATAAATTATGCATGTTGG - Intronic
1114518029 14:23313023-23313045 AAAACATAAATTTTTTAAGTTGG + Intronic
1114688712 14:24560149-24560171 GAATCAGAATTTCTGGAAATGGG - Intergenic
1114800411 14:25768706-25768728 CTAGCATAAAGTCTGGAAGTGGG - Intergenic
1115040822 14:28924552-28924574 GAAACAGAAGTACTAGAAGTTGG + Intergenic
1115085428 14:29509346-29509368 GAATCAAAAATTCTGGAGGTGGG - Intergenic
1115214329 14:30999493-30999515 CAAACAGAAATTCTGGAATTGGG + Intronic
1115237244 14:31219399-31219421 TAAAAATAAATTCTGGAATTTGG + Intergenic
1115424606 14:33243450-33243472 GAATCAGAAATGCTGGAAGAGGG - Intronic
1115834762 14:37388995-37389017 AAAACAGAAATTCTAGAATTGGG + Intronic
1115908542 14:38229679-38229701 ATAAAATAAATTCTGGAAATGGG - Intergenic
1117169931 14:53084076-53084098 CATACATAGATTCAGGAAGTTGG + Intronic
1117628149 14:57661786-57661808 GAATCAAAAACTTTGGAAGTGGG - Intronic
1117903992 14:60565589-60565611 GAATCAGGAATTCTGGAGGTTGG - Intergenic
1118038751 14:61895079-61895101 GAAACCTCATTTTTGGAAGTTGG + Intergenic
1118098830 14:62571714-62571736 AAAACCTATATTCTGGAAGTTGG + Intergenic
1118159128 14:63271524-63271546 GAAGCAGAAATTCTTGGAGTGGG - Intronic
1118544251 14:66867984-66868006 GAATCAGAATCTCTGGAAGTGGG + Intronic
1118675243 14:68177442-68177464 GAAACATGAATTTTGGTAGATGG - Intronic
1119131833 14:72179834-72179856 GAATCAAAAATCCTGGAGGTGGG + Intronic
1119357302 14:74018254-74018276 GAAACAGAAACTATGCAAGTGGG + Intronic
1119952006 14:78754728-78754750 GAACCAGAAACTCTGGAGGTGGG + Intronic
1120037832 14:79718008-79718030 GGAACATACATTCTGGGAGTGGG + Intronic
1120361032 14:83502559-83502581 AAAACATATATGCTGGAATTGGG + Intergenic
1120428028 14:84375604-84375626 GAAAACTAAATTCTGAAAATGGG - Intergenic
1120566435 14:86064542-86064564 GAAACACAAAGTGTGTAAGTTGG + Intergenic
1121156318 14:91688215-91688237 GAAATAGAAATTCTGGACTTTGG + Intronic
1122712100 14:103666414-103666436 GAATCAGAAACTCTGGGAGTGGG - Intronic
1123908300 15:24942195-24942217 GAAACACAAATTTTGCTAGTTGG + Intronic
1125442797 15:39721655-39721677 GTAACATAAATGCATGAAGTGGG + Intronic
1125912755 15:43456281-43456303 GAAACATCAACTCTGGGAGATGG + Exonic
1126386797 15:48101576-48101598 GAAATGGAAATTCTGGAATTTGG + Intergenic
1126603047 15:50448062-50448084 CAAACATAACTTCTGTAACTAGG - Intronic
1127041051 15:54977229-54977251 GAAAAAGAAACTCTGGGAGTGGG - Intergenic
1127095417 15:55507990-55508012 GAACCAGAAGTTCTGGAAGTGGG + Intronic
1127158695 15:56156917-56156939 GAATCAGAAACTCTGGAAGTGGG - Intronic
1127555108 15:60080162-60080184 AAAACAGAAATTCTGGATGTGGG - Intergenic
1127578823 15:60318012-60318034 GAATCAGAAATCCTGGAAATGGG + Intergenic
1128522957 15:68387465-68387487 GAATCAGAAACTCTGGAGGTGGG + Intronic
1128596309 15:68953800-68953822 AAAACATAAATTTGAGAAGTTGG - Intronic
1128608716 15:69057341-69057363 GAATCAGAATTTCTGGTAGTGGG - Intronic
1128772761 15:70294767-70294789 GAATCAGAATTTCTGGAGGTAGG - Intergenic
1129013731 15:72446899-72446921 ATAACAAGAATTCTGGAAGTAGG - Intergenic
1130160999 15:81400062-81400084 GAAGCAGAAATTTGGGAAGTAGG - Intergenic
1130365594 15:83235410-83235432 GAAACAAAAATTCTGTGAGTGGG - Intergenic
1130976290 15:88777990-88778012 GAATCACAAACTCTGGGAGTGGG - Intergenic
1131321563 15:91398367-91398389 GTAACATAAAATGTGGAAGGAGG - Intergenic
1132529565 16:439210-439232 GGAAAATAAATTCTTTAAGTAGG + Intronic
1133089265 16:3390668-3390690 GAATCGGAAATTCTGGAGGTGGG + Intronic
1133456850 16:5949804-5949826 GAATCAGAAACTCTGGAAGTGGG + Intergenic
1133733783 16:8598283-8598305 GTAACAAGAATTCTGGAGGTAGG - Intergenic
1134249955 16:12567437-12567459 GACACATAAATTCTGGGGCTAGG - Intronic
1135129216 16:19838428-19838450 GAAGCACATATTCTGGAAGGAGG + Intronic
1136055788 16:27688625-27688647 GAAGCAGAAATTCTGGGATTGGG - Intronic
1136218662 16:28813039-28813061 GAAACAAAAAATCTGCAAGTGGG - Intergenic
1136639912 16:31554862-31554884 GAAACAAAAAGTCTGAGAGTTGG - Intergenic
1137841306 16:51643198-51643220 GGAGCATAAATTATGGCAGTAGG - Intergenic
1138739785 16:59294678-59294700 GAAACTTCAATGCTGGAATTTGG + Intergenic
1140045338 16:71436915-71436937 GAATCAGAATTTCTGGGAGTGGG - Intergenic
1140820617 16:78659438-78659460 GAACCAGAAACTCTGGGAGTAGG + Intronic
1141382792 16:83590843-83590865 GAATCATAAATGCTGCAGGTGGG + Intronic
1143069106 17:4275383-4275405 GAAACATAAATTCTGCGAAATGG - Intronic
1143225710 17:5300934-5300956 GAATCAGAAATTCTGGAGATGGG - Intronic
1143833825 17:9674043-9674065 GAAACAGAATCTCTGGGAGTGGG + Intronic
1143907935 17:10224634-10224656 GAAACATGAGATCTGTAAGTAGG + Intergenic
1144037176 17:11377528-11377550 GAATCAGAAACTCTGGGAGTGGG + Intronic
1144114599 17:12075043-12075065 GAAACAGGAATTGTGGAACTAGG + Intronic
1144194231 17:12875136-12875158 GAATCAGAAATTCTGGGAGTGGG - Intronic
1144386058 17:14750322-14750344 GAATCAGAAATTCTGGAGATGGG - Intergenic
1146105422 17:30031275-30031297 GAATCAGAAATTCTGGGAGTAGG - Intronic
1146367018 17:32236996-32237018 GAAACAAAGATTCTGGCATTAGG + Intronic
1148396811 17:47314715-47314737 GAATCAGAAAATCTGGGAGTGGG + Intronic
1149114879 17:53081299-53081321 GAAACTTTAATTATAGAAGTAGG + Intergenic
1149219702 17:54402461-54402483 GAAAGATAAAATCAGGAAGCTGG - Intergenic
1149913060 17:60583826-60583848 GAATCAGAAACTCTGGGAGTGGG + Intronic
1150480948 17:65510179-65510201 GAAACATAAATAATGGCAGAAGG + Intergenic
1150847304 17:68672644-68672666 GAAGAAAAAAGTCTGGAAGTAGG + Intergenic
1151011620 17:70504575-70504597 GAATCTTAAACTTTGGAAGTAGG + Intergenic
1151062861 17:71116571-71116593 GAATCATAATATCTGGAAATGGG + Intergenic
1152056391 17:78031165-78031187 GAATCAGAAAGTCTGGAGGTTGG + Intronic
1152313983 17:79569179-79569201 GATAGAAAAGTTCTGGAAGTGGG - Intergenic
1152446016 17:80344432-80344454 GAAACTTAGTTTCAGGAAGTTGG + Intronic
1152978886 18:253824-253846 AAAACATTATTTCTGTAAGTTGG + Intronic
1153512883 18:5874521-5874543 GAATCAGAAATTCTGGAGGTGGG - Intergenic
1153552297 18:6274259-6274281 GAATCAAAAACTCTGGGAGTAGG + Intronic
1153716131 18:7850343-7850365 CAAATAGAAAATCTGGAAGTGGG + Intronic
1154234458 18:12590998-12591020 AAAACATACATTCTAGAAGAGGG + Intronic
1154402906 18:14058970-14058992 GAAACACCCATTCTGGAAATTGG - Intronic
1154442734 18:14407166-14407188 GAATCATAAACTCTGGGTGTGGG - Intergenic
1155125569 18:22872177-22872199 GAATCATAAACTCTGGGGGTGGG - Intronic
1156504410 18:37580007-37580029 GAAACAGGAATGCTGGAAGATGG - Intergenic
1156677211 18:39542254-39542276 TAAAGATAAATTCTTGAAGTGGG - Intergenic
1157302766 18:46491368-46491390 GAATCAGAAACTCTGGCAGTAGG - Intronic
1157537589 18:48471382-48471404 GAAGCAAAAATTCTATAAGTGGG + Intergenic
1157885701 18:51364270-51364292 GAATCAGAATTTCTGGAGGTAGG - Intergenic
1158039583 18:53076689-53076711 TAAACACATATTCTGGAAATGGG - Intronic
1158109006 18:53919148-53919170 AAAACATAATTTCTAGAAATTGG - Intergenic
1158343008 18:56486877-56486899 GAATCAGAAATTCTGGGAGTGGG + Intergenic
1158556382 18:58478012-58478034 AAAACATGAAATCTGGGAGTAGG + Intergenic
1159531196 18:69657779-69657801 GTTTCATAAATTCTGGAATTAGG + Intronic
1159923246 18:74245633-74245655 GAAACAATAATTCTCAAAGTTGG + Intergenic
1161669327 19:5596337-5596359 AAAAAATAAATTACGGAAGTTGG - Intronic
1162239784 19:9340945-9340967 GAAACATAAATTGAGAAATTTGG - Intronic
1162244409 19:9387559-9387581 TAAAAAAAAATTCTGTAAGTGGG + Intergenic
1162682537 19:12357323-12357345 GAAAAAGAAATTCTGGGGGTAGG - Intronic
1167737976 19:51308939-51308961 GAAGCTTACATTCTGGAAGTGGG + Intergenic
924981746 2:228952-228974 GAAACATAACTGCTGTTAGTGGG - Intronic
926546990 2:14254742-14254764 TAAACATAATTTGTGGAAGTAGG - Intergenic
928410030 2:31047755-31047777 GAATCATAAACTCTGCAAGCAGG + Intronic
928661456 2:33506321-33506343 AAAACATAAATTTTTGGAGTTGG + Intronic
928912181 2:36433008-36433030 GAATCAGAAATGCTGGGAGTGGG - Intronic
929097906 2:38281360-38281382 CAGACATAAATTCTGGTTGTTGG - Intergenic
929150519 2:38743572-38743594 GATACTTAATTTTTGGAAGTGGG - Intergenic
929644538 2:43613502-43613524 GAATCAGAAACTCTGGAAGCAGG - Intergenic
929747130 2:44670712-44670734 GAATCAGAAACTCTGGAGGTGGG - Intronic
930318136 2:49822147-49822169 GAAACAAAACTTCTGCAAGAGGG + Intergenic
930802187 2:55454346-55454368 GAATCAGAAATTCCGGAAGCTGG - Intergenic
930860575 2:56068463-56068485 AAAACATAAAATGTGGAAGAAGG - Intergenic
931335189 2:61334472-61334494 GACATAGAAATCCTGGAAGTAGG + Intronic
931740676 2:65239647-65239669 TAAACATGAACCCTGGAAGTAGG + Intronic
932930789 2:76035628-76035650 GAAACAAATATACTGGAAATAGG - Intergenic
933642244 2:84776413-84776435 AAAACATCAATTCCTGAAGTTGG - Intronic
933921178 2:87048018-87048040 CTAACAGAAATTTTGGAAGTAGG + Intergenic
934001788 2:87721567-87721589 CTAACAGAAATTTTGGAAGTAGG - Intergenic
934059758 2:88283187-88283209 GAATCAGAAACTCTGGGAGTGGG - Intergenic
934932816 2:98442137-98442159 GAATCAGAAACTCTAGAAGTGGG - Intergenic
935234313 2:101125440-101125462 GAAATAAAATTTCTGGAAGGAGG - Intronic
935699389 2:105798082-105798104 AAAACACATCTTCTGGAAGTAGG - Intronic
936362673 2:111819669-111819691 CTAACAGAAATTTTGGAAGTAGG + Intronic
936656711 2:114496664-114496686 GAAACTTAAACTCTGGATTTTGG + Intronic
939043569 2:137222705-137222727 GAGACAATAATTCTGAAAGTCGG + Intronic
939858710 2:147392323-147392345 AAATCAGAAATTCTGCAAGTGGG - Intergenic
939878717 2:147605996-147606018 GAATCAGAATCTCTGGAAGTGGG + Intergenic
941510096 2:166396707-166396729 GAATCAGAAATTATGGTAGTGGG - Intergenic
941689431 2:168483886-168483908 GATTCAGAAATTCTGGAGGTGGG - Intronic
941740884 2:169033798-169033820 GAATCAGAAACTCTGGGAGTGGG + Intergenic
941760542 2:169237710-169237732 GAAACTGAAATTCTGGGAGATGG + Intronic
941917002 2:170819531-170819553 TAAAGATAGATTCTGGAAATGGG - Intronic
942059770 2:172217452-172217474 GAATCAGAAATCCTGTAAGTTGG + Intergenic
942400531 2:175597408-175597430 AAAACAAAAATTCAGTAAGTAGG - Intergenic
942585956 2:177478098-177478120 GAAAGATAACTGCTGGATGTAGG + Intronic
943126677 2:183803215-183803237 CAAACAGAAATTCTGGAGGTGGG - Intergenic
943165852 2:184324793-184324815 GAATCAGAAACTCTGGAAGTAGG + Intergenic
943684510 2:190803883-190803905 GTAACAGAAACTCTGGGAGTGGG - Intergenic
943706433 2:191039725-191039747 TTAACATAAACACTGGAAGTGGG + Intronic
943720730 2:191200885-191200907 GAATCAGAAACTCTGGGAGTGGG + Intergenic
944390307 2:199211225-199211247 GAAACAAAACTCCTGGAACTTGG + Intergenic
944530870 2:200666955-200666977 GAAACATAAAATCTGTGACTAGG + Intronic
944982128 2:205133439-205133461 GAACCAGAAATTCTGGAGGTGGG + Intronic
945445863 2:209937701-209937723 GAATCATAAAATCTCAAAGTTGG - Intronic
945632149 2:212292434-212292456 GCAATATTAATTCTGGAAATTGG - Intronic
945819174 2:214642205-214642227 GAAACATAGATCCTGCAACTTGG + Intergenic
946218775 2:218208097-218208119 GAAAAATATATTCTGGGACTGGG - Intergenic
948007157 2:234618961-234618983 GAAACATAACACCTGGAATTTGG + Intergenic
1169325113 20:4669564-4669586 GAAGCATAAATTCTTGGTGTTGG + Intergenic
1169524611 20:6410028-6410050 GAAAGATAAAAACTGGAAGATGG + Intergenic
1169540343 20:6592921-6592943 GAATCAGAAATTCTGGGTGTGGG - Intergenic
1169945167 20:10980115-10980137 GAATCAGAAACTCTGGAGGTGGG + Intergenic
1170262882 20:14430982-14431004 AACAAATAAATTCTGGAGGTAGG - Intronic
1170384171 20:15797809-15797831 GAATTAGAAATTCTGGCAGTGGG - Intronic
1170398507 20:15954507-15954529 GAAACCTAAATTATAGTAGTGGG - Intronic
1170981096 20:21213612-21213634 GAAACATACACTCTGGCAGCGGG + Intronic
1172011612 20:31849090-31849112 GAGACATAAGACCTGGAAGTGGG - Intronic
1172667006 20:36607101-36607123 GAACCATAAATGCTGGAGGCAGG - Intronic
1172943415 20:38670203-38670225 GAATCAGAAATTCTGGAGGTGGG + Intergenic
1174417971 20:50380034-50380056 AAAACACAAATTCTGAAATTAGG + Intergenic
1176877422 21:14146673-14146695 AAAATATAAATTCTGGAACATGG + Intronic
1177495368 21:21883175-21883197 AAATCATAAATTCTCCAAGTAGG - Intergenic
1177719734 21:24890500-24890522 GAATCAGTAATTCTGGAAGTAGG - Intergenic
1178131645 21:29579847-29579869 GAAAGATAAATTCCGGGGGTGGG + Intronic
1178845620 21:36171954-36171976 GAAAAATAAACTGGGGAAGTGGG + Intronic
1178946438 21:36952113-36952135 GAAAAATATATTATGGAAGAAGG - Intronic
1179048699 21:37870090-37870112 GAAACATATTTCCTGGAAGAGGG + Intronic
1180609731 22:17087376-17087398 GACACTTACATTCTGGAAGGTGG - Intronic
1180863578 22:19102319-19102341 GACAAAAAAGTTCTGGAAGTGGG + Intronic
1183765476 22:39869453-39869475 GAAACAGGACTACTGGAAGTGGG + Intronic
1184006095 22:41710366-41710388 GATACAAAAATTCTGCAAGTGGG + Intronic
949856826 3:8469624-8469646 GCATCAGAAATTCTGGAGGTGGG + Intergenic
950892520 3:16416981-16417003 GAAAAACAAGTTCTGGAAATGGG - Intronic
951273337 3:20654713-20654735 GAATCAGAAATTCTGGTAATGGG + Intergenic
951592094 3:24277446-24277468 GAATCAAAAATTCTGGGGGTGGG - Intronic
951646295 3:24895404-24895426 GAAGCAGAAACTCTGGAGGTAGG - Intergenic
951990842 3:28674988-28675010 GAAACAGAAACTCTGGAGGTGGG - Intergenic
952030336 3:29134195-29134217 GAATCAGAAATTCTGAATGTCGG - Intergenic
953028479 3:39159608-39159630 GAATCAGAAATTCTGCAAGTGGG + Intergenic
954999094 3:54910260-54910282 ATATCATAAAATCTGGAAGTTGG - Intronic
955515522 3:59722693-59722715 GAATCTGAAACTCTGGAAGTAGG + Intergenic
955977296 3:64490862-64490884 GAAACATAAAAGCAGGAAGAGGG - Intergenic
956063923 3:65376999-65377021 GAAAGACAAATTCTCAAAGTAGG - Intronic
956363991 3:68480090-68480112 GAAATATAAATTCTTGGGGTTGG + Intronic
956743851 3:72296021-72296043 GCAAAATAAATTCTTGGAGTTGG - Intergenic
957229289 3:77490910-77490932 GAAACATAAAGTCGTGAATTAGG - Intronic
957243285 3:77686374-77686396 GAAACATAACTAATGGAAGGAGG + Intergenic
958070734 3:88607899-88607921 TAAACTTAATTTCTAGAAGTGGG - Intergenic
958810554 3:98856656-98856678 GAAGCATAAATTCAGAAACTAGG + Intronic
959956530 3:112244724-112244746 GAAACATAAATTCTGGAAGTTGG - Intronic
959987216 3:112587583-112587605 AAAACATAAAGACAGGAAGTGGG - Intergenic
960047245 3:113210705-113210727 GAATCAGAAACTCTGGAGGTGGG + Intergenic
960332901 3:116384430-116384452 GAATCAGAATTTTTGGAAGTGGG + Intronic
960839488 3:121941962-121941984 GAAACATTAATAAAGGAAGTTGG - Exonic
961871823 3:129993904-129993926 GAATCAGAAACTCTGGGAGTGGG + Intergenic
961924111 3:130458488-130458510 GAATCAGAAATTCTGGGAGCAGG + Intronic
961980523 3:131073285-131073307 TAAACAAAAATTCTAGGAGTAGG - Intronic
961981393 3:131083096-131083118 GAATCAGAAATTCTGGGGGTGGG + Intronic
962633107 3:137299843-137299865 GAATCATAAACTATGGAAGTGGG + Intergenic
962679573 3:137784327-137784349 GAATCAAAAATTCTGGGGGTGGG + Intergenic
962875705 3:139534657-139534679 GAATCAGAAACTCTGGGAGTGGG - Intronic
965301412 3:167010442-167010464 GAAACATACATTATGGCAGAAGG + Intergenic
965356920 3:167686659-167686681 AAATCAGAAATTCTAGAAGTGGG + Intronic
965451862 3:168847927-168847949 GAATAAGAAATTCTGGAAATGGG + Intergenic
965563367 3:170083159-170083181 GATACATACATTTTGGAAGCAGG - Intronic
965800625 3:172490191-172490213 GAATCAAAAACTCTGGGAGTGGG + Intergenic
965914650 3:173828630-173828652 GAAAAATAAATCATGGAAGGTGG + Intronic
966102204 3:176284319-176284341 GAAATTTGAATACTGGAAGTAGG + Intergenic
966197229 3:177325566-177325588 GAAGCAAAAATTCTATAAGTGGG + Intergenic
967215813 3:187209270-187209292 GAATCATAAAGTCTTGCAGTTGG - Intergenic
967446404 3:189572150-189572172 GAATCAGAAACTCTGGAGGTGGG + Intergenic
967467204 3:189821609-189821631 GAAACAGAAAATCTGTTAGTTGG - Intronic
967502596 3:190217237-190217259 GAAACATAAATTCCGCAGTTGGG + Intergenic
969084222 4:4643394-4643416 GAGACCGATATTCTGGAAGTTGG - Intergenic
969903334 4:10370315-10370337 GGAACATAAATGCTGGGAGAAGG + Intergenic
970023572 4:11596168-11596190 GAAACATAAAATGTGGACTTAGG - Intergenic
970946066 4:21693209-21693231 GAAGCAGAAACTCTGAAAGTAGG - Intronic
970953309 4:21781290-21781312 GAAACTTAAATTATGGCAGAAGG - Intronic
971292519 4:25357867-25357889 AAAACAGAAACTCTGGGAGTAGG - Intronic
971557134 4:28027407-28027429 GAAACATGAAATCTGGCAGCTGG + Intergenic
972374483 4:38457791-38457813 GAAACTTAAATTATGGCAGAAGG + Intergenic
972611398 4:40658907-40658929 CAAACATAAACTCTGGAACCAGG - Intergenic
972739148 4:41874229-41874251 GCAACTTCAATTCTGGAAATTGG + Intergenic
972757967 4:42069855-42069877 GAATAAAAAATTCTGGATGTGGG - Intronic
972935907 4:44135123-44135145 GAAAGACAGATTCTGGAAGAAGG - Intergenic
973014327 4:45118618-45118640 TAACCATAAAATCTGGTAGTGGG + Intergenic
974564981 4:63569814-63569836 GAAGCAAAAATTTTGTAAGTTGG - Intergenic
974634045 4:64535681-64535703 TAAACATAAATACTGGATGGAGG - Intergenic
974702368 4:65468061-65468083 TTATCATAAATTCTGTAAGTTGG - Intronic
975309958 4:72892693-72892715 GAATCAGAAACTCTGGGAGTGGG + Intergenic
975879491 4:78886371-78886393 GAAACAGGAATTGAGGAAGTGGG - Intronic
975908185 4:79240511-79240533 GAAGCAAAAATTCTGTGAGTAGG - Intronic
976546616 4:86343117-86343139 GAAAGGTAATTTCTGGAAGAGGG - Intronic
977465474 4:97379001-97379023 AAAACATTAATCCTGGAAATGGG - Intronic
977637668 4:99318248-99318270 GAAACACAATTTCAGGAATTTGG - Intronic
977663947 4:99623390-99623412 TAAATATTAATTCTTGAAGTTGG - Exonic
978181293 4:105799494-105799516 GACACAAAAATACTGGAATTAGG - Intronic
979003861 4:115263073-115263095 TAAACATAAATATAGGAAGTAGG + Intergenic
979189365 4:117836736-117836758 GAAACATAGAGTCTGGAACATGG + Intergenic
979860783 4:125691050-125691072 GAAACTTAAATCCTGGCAGAAGG - Intergenic
980734332 4:136865691-136865713 GAAACACAAATTGTAGAAATTGG + Intergenic
981486092 4:145287945-145287967 GAAATATGAATTCTGTAAGTTGG - Intergenic
981763038 4:148215105-148215127 GAAAAACAAATCCTGGAAGCTGG + Intronic
983119839 4:163868865-163868887 GAAAAAAAAATTCCTGAAGTTGG - Intronic
983309877 4:166045969-166045991 GCAGCATAAATTCTGGTAGTTGG - Intronic
983431249 4:167654269-167654291 CAAACATAAACTGTGAAAGTAGG - Intergenic
983924866 4:173389590-173389612 GAATCAGAAACTCTGGAGGTAGG - Intronic
984865890 4:184280321-184280343 GAAACTAACATTCAGGAAGTTGG + Intergenic
986253190 5:6079998-6080020 GAAAAATAAATCCAGGAAGGAGG + Intergenic
986292533 5:6411556-6411578 GAATCCTAAACTCTGGAGGTGGG + Intergenic
986630314 5:9766418-9766440 AAAACAAAAATGCTGGAAGAAGG + Intergenic
986931719 5:12833256-12833278 GAGACAGAAATTCTGGACGTAGG + Intergenic
988026120 5:25692619-25692641 GAATCTGAAATTCTGGAGGTAGG - Intergenic
988585859 5:32507039-32507061 GAATCAGAAACTCTGGGAGTGGG - Intergenic
989177402 5:38542093-38542115 GAAACATAAATTATGATTGTTGG + Intronic
991393596 5:66177957-66177979 GAAACATAAATTGAGGAAAATGG - Intronic
992091270 5:73319543-73319565 GAAACCTCAATCCTGGAAGAGGG - Intergenic
992147413 5:73865235-73865257 GAATCAGAAATTCTGGAATTGGG - Intronic
992753785 5:79885669-79885691 GAGAAATAATTTCTGGAAATGGG + Intergenic
993498777 5:88639830-88639852 AAAGCAAAAATTCTGGAAGTGGG + Intergenic
994123674 5:96146416-96146438 GAATCAGAAACTCTGGCAGTGGG - Intergenic
994209402 5:97071701-97071723 GAAACATAAAATCTGGTACAGGG + Intergenic
994290325 5:98022495-98022517 GAAATAAAAATACTAGAAGTAGG + Intergenic
994544623 5:101148954-101148976 GAAGAATAATTTCTGGATGTGGG - Intergenic
994643383 5:102438278-102438300 GATACATAAATTTTAGAAATAGG + Intronic
995161029 5:108982136-108982158 GAATCAGAAACTCTGAAAGTAGG + Intronic
995227604 5:109719719-109719741 GCAACATAAATTCACAAAGTTGG - Intronic
996360470 5:122639584-122639606 GAAACAAAAATCCTGAAATTTGG - Intergenic
996441639 5:123497926-123497948 GAAAAAAAAATTCTGGATATTGG - Intergenic
996963518 5:129280248-129280270 GAAACATAAAGACTGGGATTAGG + Intergenic
998868711 5:146531438-146531460 GAAACAGAATTTCTGGAAGAAGG + Intergenic
998872959 5:146570797-146570819 GAATCAGAAACTCTGGAAGTGGG + Intergenic
999089508 5:148923307-148923329 AGTACATAAATCCTGGAAGTTGG + Intergenic
999496770 5:152106817-152106839 GAATCAGAAACCCTGGAAGTGGG + Intergenic
1000371618 5:160541996-160542018 GAATCAGAAATTCTGGGATTAGG + Intergenic
1000422164 5:161050496-161050518 GAAACAAAAATGATGGAAGCAGG + Intergenic
1000881090 5:166698385-166698407 GAAACATAATTTCTGCTAGGTGG + Intergenic
1000931629 5:167259032-167259054 GAATCAGAAACTCTGGGAGTGGG - Intergenic
1000961701 5:167608369-167608391 GAAAAATAAGTTGTGAAAGTAGG + Intronic
1001849973 5:174955296-174955318 GGAAGATAAGTTCTGGAACTGGG - Intergenic
1002551912 5:180000927-180000949 GAAACATGAAATAAGGAAGTAGG - Intronic
1002664479 5:180812099-180812121 GGAACTTAAATTCTAGTAGTGGG - Intronic
1004083689 6:12422445-12422467 AAATCAAAAATTCTGGGAGTGGG + Intergenic
1004132305 6:12932038-12932060 GAATCAGAAATGCTGGAGGTAGG + Intronic
1006039021 6:31238444-31238466 GAATCCTGAATCCTGGAAGTTGG - Intergenic
1006048131 6:31317247-31317269 GAATCCTGAATCCTGGAAGTTGG - Intronic
1006587579 6:35127061-35127083 GAAACAAAAATCCTGCAAGTGGG - Intronic
1007366220 6:41395846-41395868 GAAAAATAAAAACTGGAAGTAGG + Intergenic
1007524119 6:42476064-42476086 GAATCAGAAACTCTGGGAGTGGG + Intergenic
1008503192 6:52203487-52203509 GAAAAATAAATTTGGGAATTTGG - Intergenic
1008677487 6:53835566-53835588 CAAACTCAAATTCTGGATGTGGG + Intronic
1008749163 6:54711207-54711229 GAATCATAAACTCTGACAGTAGG + Intergenic
1009406494 6:63320238-63320260 GTAACAAAAATTCTGTATGTTGG - Intergenic
1009552365 6:65115409-65115431 AAAAGATAATTTCAGGAAGTGGG - Intronic
1010189542 6:73180714-73180736 AAAACAGAATTTCTGGAGGTAGG + Intronic
1011194864 6:84770815-84770837 GAAAACTGAATTATGGAAGTCGG + Intergenic
1011987633 6:93469702-93469724 GAATCAGAAACTCTGGGAGTAGG + Intergenic
1012871821 6:104682199-104682221 GAATCAGAAACTCTGGAGGTGGG - Intergenic
1013809461 6:114028117-114028139 GAATAAGAAAATCTGGAAGTGGG - Intergenic
1013976382 6:116083617-116083639 GAATCAGAAACTCTGGAGGTCGG - Intergenic
1014068444 6:117153539-117153561 GATAGATAAATTACGGAAGTAGG - Intergenic
1014248318 6:119091253-119091275 GAAGCACAAATTCTGCAAGTGGG + Intronic
1014682462 6:124448720-124448742 GAAACATGAATTCTGGGAACAGG + Intronic
1014820404 6:125982882-125982904 GAATCAGAAATTCTGGGAGTAGG - Intergenic
1015261736 6:131245606-131245628 GAAACATAACTTGTGGAAATTGG - Intronic
1015530615 6:134217950-134217972 GAAACATAAATAAGTGAAGTGGG - Intronic
1015550483 6:134406946-134406968 AAAAAATAAAATCTGTAAGTTGG + Intergenic
1015665221 6:135620540-135620562 GCATCATACATTCTGTAAGTGGG + Intergenic
1015726574 6:136305650-136305672 GAATCAGAAATTCTGGAATAAGG + Intergenic
1016318469 6:142816347-142816369 AAAAAATATATTCTGGAAATGGG - Intronic
1017036540 6:150272258-150272280 GAAAGATCAATGCTGGAAGCTGG + Intergenic
1017144339 6:151220521-151220543 AAAAAAGAAGTTCTGGAAGTTGG - Intergenic
1017259217 6:152367169-152367191 GAAAAACAAATTCTGTAGGTTGG + Intronic
1020709185 7:11584901-11584923 GAAACAGAATTTAAGGAAGTGGG + Intronic
1021029026 7:15706351-15706373 GAGAGAAAAATTCTGGAAATGGG + Intergenic
1022538443 7:31113241-31113263 GAATCAGAAATTCTGGGGGTGGG - Intergenic
1022718002 7:32915975-32915997 GAATGGAAAATTCTGGAAGTTGG + Intergenic
1022767493 7:33430604-33430626 GAAGGATAAATTCTAGAATTTGG - Intronic
1022922784 7:35033367-35033389 GGAACTTACATTCTGGAAGGGGG - Intronic
1022970218 7:35510340-35510362 GAGCCAGAAGTTCTGGAAGTGGG - Intergenic
1023553158 7:41390338-41390360 GAAACATGGAATCTTGAAGTTGG - Intergenic
1024217809 7:47262724-47262746 AAAAAAATAATTCTGGAAGTGGG + Intergenic
1024580332 7:50795691-50795713 GAAACATATAAGCTGGAATTAGG + Intergenic
1026799693 7:73392016-73392038 GAATCAAAAACTCTGGGAGTAGG - Intergenic
1026890528 7:73979130-73979152 GCAACACAGATTCAGGAAGTTGG - Intergenic
1027364917 7:77447477-77447499 GAATCAAGAATTCTGGAGGTGGG - Intergenic
1027436191 7:78167009-78167031 GAATCATCAATACTAGAAGTAGG - Intronic
1027745884 7:82073469-82073491 GCAAAATAAATTCTGGAAGAAGG + Intronic
1028072723 7:86472074-86472096 GAATCAGAAATTCTGGAAGTGGG + Intergenic
1028682922 7:93558908-93558930 GAATCAGAAACTCTGGGAGTGGG + Intronic
1028724878 7:94075773-94075795 GAAGCATAACTTCTTCAAGTGGG - Intergenic
1028835012 7:95365331-95365353 TCAACATGAAATCTGGAAGTGGG - Intronic
1028950411 7:96629455-96629477 AAAGCAGAAATTCTGGAATTTGG - Intronic
1029237354 7:99132056-99132078 GAAATTTTAATTCTGGAATTTGG - Intronic
1029545029 7:101206164-101206186 GGAACATGAACTCAGGAAGTGGG + Exonic
1030248256 7:107410196-107410218 GAATCAGAAATTCTGGGTGTTGG + Intronic
1031671915 7:124558728-124558750 GAAAAATTAATTCTGGCATTTGG + Intergenic
1032036625 7:128526145-128526167 GAATCAAAAATTCTGGGGGTGGG + Intergenic
1032527409 7:132589700-132589722 GCAACATACATTCTGGATGGGGG + Intronic
1032730999 7:134642899-134642921 TAAAAATAAATTCTGGAGGGTGG + Intergenic
1034888215 7:154815431-154815453 GAAACACAAATTATGTAAATTGG - Intronic
1035813928 8:2517741-2517763 GAATCATAAAATCCAGAAGTAGG - Intergenic
1037085633 8:14846176-14846198 TAAACATAAATTAGGCAAGTTGG - Intronic
1038958214 8:32490010-32490032 AAAACATAAATTCTTGCAGCTGG + Intronic
1041433366 8:57809328-57809350 GACTCGTAAATTCTGCAAGTGGG + Intergenic
1041762549 8:61382684-61382706 GAATCAGAAACTCTGGGAGTGGG - Intronic
1042162285 8:65909231-65909253 AAAATAAAAATTCTGCAAGTTGG + Intergenic
1042192960 8:66206495-66206517 AAAACCAAAATTTTGGAAGTTGG - Intergenic
1042313373 8:67400348-67400370 GATAGAAACATTCTGGAAGTAGG - Intergenic
1043323894 8:79026036-79026058 CAAATATTTATTCTGGAAGTAGG + Intergenic
1043401046 8:79884717-79884739 GACAAATAAATTCTGATAGTTGG - Intergenic
1044123686 8:88430984-88431006 GAAACATAAATTCTGATGGGAGG + Intergenic
1044174941 8:89108277-89108299 GAAACAGAATTTCTGGCAATGGG - Intergenic
1044318147 8:90773269-90773291 GAAACACAAATTCCGCAAGTAGG + Intronic
1044865143 8:96563573-96563595 GAATCAGAAACTCTGGGAGTTGG - Intronic
1045582189 8:103494073-103494095 CAAAAATAAATTCTGAAAGCAGG + Intergenic
1049691712 8:143964174-143964196 GAAACATTTATTTTGGAAGTGGG + Intronic
1049985538 9:947572-947594 AGAATTTAAATTCTGGAAGTTGG + Intronic
1050019439 9:1268262-1268284 AAAACATAAATTCCCCAAGTGGG - Intergenic
1050376333 9:4977386-4977408 GTATCAGAAACTCTGGAAGTAGG - Intergenic
1051104174 9:13559198-13559220 GAGACATAACTTCTGCAAGCTGG + Intergenic
1051111472 9:13642519-13642541 AAAAAATAAAGTCAGGAAGTCGG + Intergenic
1051444622 9:17127088-17127110 GAAACATAATCTCTGGAGATGGG + Intergenic
1051447912 9:17161439-17161461 GAAACATAATCTCAGGAAGCAGG + Intronic
1051931731 9:22394348-22394370 TAATCATAAACTCTGGGAGTGGG + Intergenic
1052457861 9:28723771-28723793 GAAACATAAAGTATGGAAATAGG + Intergenic
1052895319 9:33742129-33742151 GAAACAAAAATTTTGCTAGTGGG + Intergenic
1052956987 9:34260639-34260661 GAAACACATTTTCTGGAAATGGG + Intronic
1055223608 9:73967720-73967742 GAAACAAAAATTTTGCTAGTGGG - Intergenic
1055286313 9:74731887-74731909 GAAGCAGAAACTCTGGGAGTGGG + Intronic
1055321218 9:75085193-75085215 GAAGCATAAATTCTCAAACTTGG + Intronic
1055852739 9:80651841-80651863 GATACAGAAAATCTGGAAGAAGG + Intergenic
1056129698 9:83571959-83571981 GAATCAAAAATTCTGGGTGTGGG - Intergenic
1056366578 9:85910922-85910944 GAATCAGAAACTCTGGGAGTGGG - Intergenic
1056432912 9:86546529-86546551 GAATCAGAAACTCTAGAAGTAGG + Intergenic
1057748178 9:97769169-97769191 GAAAGCTGAATTCTGGAGGTGGG - Intergenic
1057864197 9:98666367-98666389 GAAGCATGAATTCTCCAAGTGGG - Intronic
1057881957 9:98799161-98799183 GAATCAGAAATTCTGGGTGTGGG + Intergenic
1057967498 9:99518345-99518367 GAAGGATGAATACTGGAAGTGGG - Intergenic
1058456911 9:105146366-105146388 GAAACATAGATTCTGGCTGAAGG - Intergenic
1059009766 9:110444085-110444107 GAAACTTACATTCTGGAAGAAGG - Intronic
1059526850 9:115000061-115000083 GGAACGTGAATTCTGGAAGAGGG + Intergenic
1060120368 9:120983508-120983530 GAAACACAAATTTTTTAAGTGGG - Intronic
1185878568 X:3719992-3720014 GAAACATTATTTTTAGAAGTCGG - Intergenic
1186274587 X:7926145-7926167 AAAACAAAAATGCTGTAAGTTGG + Intronic
1186325731 X:8474871-8474893 GATAGATAAATTTTGGAAGCTGG - Intergenic
1186692964 X:11998776-11998798 GAAATAAAAATTTTGGAGGTAGG - Intergenic
1186880915 X:13865396-13865418 GAAACATAAATCCGTGAATTTGG - Intronic
1187147787 X:16653640-16653662 GAATCAGAAACTCTGGAGGTGGG + Intronic
1187286864 X:17914074-17914096 GAACCCTACATGCTGGAAGTGGG - Intergenic
1187306675 X:18101348-18101370 GAATCATAAACTCTTGAGGTGGG + Intergenic
1187541334 X:20198767-20198789 GAAACATAAATTTTAATAGTAGG + Intronic
1187652167 X:21421057-21421079 GAATCATCAATCCTGGCAGTTGG - Intronic
1187666448 X:21616248-21616270 GAAGCTTAAATTCTGGTAGTAGG - Intronic
1187670703 X:21663625-21663647 AAATCAGAAACTCTGGAAGTGGG + Intergenic
1187687106 X:21826650-21826672 GAATCAGAAATTCTGAGAGTGGG + Intergenic
1188395080 X:29672623-29672645 GAAACATAGAATCTGGAGGAAGG - Intronic
1188579399 X:31691145-31691167 GAAACATAAAATGTGGGAGGAGG + Intronic
1188656297 X:32700721-32700743 TAAACATAAATCCTGGCAGGAGG + Intronic
1188706685 X:33342258-33342280 AAAAAATAAATTCTCGAAATTGG - Intergenic
1188920872 X:35975302-35975324 GAAATATAAGTACTGGATGTAGG - Exonic
1189115109 X:38334312-38334334 GGAACATAGATTCTGGAACCAGG - Intronic
1189150365 X:38700236-38700258 GAAAACTAAATTATGGAAATAGG + Intergenic
1189456512 X:41195399-41195421 GAATCAGAAATACTGGAGGTGGG - Intronic
1189662197 X:43311962-43311984 GAAACATCAGTTATGAAAGTGGG - Intergenic
1189675400 X:43456021-43456043 GAAACAAAAATTCTTTGAGTAGG - Intergenic
1190144188 X:47875535-47875557 CAATCATAAAATCTGGAATTTGG + Intronic
1190767027 X:53483758-53483780 GAAGCAAAAATTCTGTGAGTAGG + Intergenic
1190767617 X:53488561-53488583 CAATGATAAATTCAGGAAGTGGG + Intergenic
1190788512 X:53677234-53677256 GAATCAGAAACTCTGGGAGTGGG + Intronic
1190863977 X:54369198-54369220 CAACTATAAATGCTGGAAGTAGG - Intergenic
1190951228 X:55145181-55145203 GTAACAAGAATTATGGAAGTGGG - Intronic
1191009113 X:55742716-55742738 GAAACAAAAATTTTGCTAGTGGG + Intronic
1191131383 X:57015095-57015117 GAACCAGGAATTGTGGAAGTAGG - Intergenic
1191674942 X:63784465-63784487 GAAACCCACATTCTGGAAATGGG - Intronic
1192030244 X:67503473-67503495 GAAACTAAAATTCTGAAAGGAGG + Intergenic
1192164716 X:68820798-68820820 GAAACATTATTTCCAGAAGTGGG + Intergenic
1193087488 X:77459909-77459931 GAAAGATAAACTCCGGAAATGGG + Intergenic
1193095698 X:77546444-77546466 GAATCAGAATTTCTGGAGGTAGG - Intronic
1193407160 X:81115861-81115883 GAATCATAAATTCTGGAAAAGGG + Intronic
1193497176 X:82229572-82229594 AAAACAGAACTTCTGGAAATAGG - Intergenic
1194697841 X:97077297-97077319 GAAACAAATGTTCTGGAATTGGG - Intronic
1195000935 X:100642637-100642659 TAAACATAAACTCTGGGAGCTGG + Intergenic
1195570701 X:106395647-106395669 GAGACATCTATTCTGGAAGCTGG + Intergenic
1196095360 X:111792621-111792643 AAAACACAAATTCTTTAAGTGGG - Intronic
1196153913 X:112406349-112406371 GAAACATAAAATATGGCAGGAGG + Intergenic
1196203588 X:112913612-112913634 GAATCAGAAATTCTGGTTGTGGG + Intergenic
1197951258 X:131899943-131899965 GAATCAAAAACTCTGGAGGTAGG - Intergenic
1198057092 X:133006148-133006170 AAAGCAAAAATTCAGGAAGTGGG - Intergenic
1198992333 X:142529196-142529218 GCATCAAAAATTCTGGCAGTAGG - Intergenic
1200365936 X:155663706-155663728 GAATCAGAAATTTTGGAATTGGG + Intronic