ID: 959956531

View in Genome Browser
Species Human (GRCh38)
Location 3:112244731-112244753
Sequence CTAGGGTGAAACATAAATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959956531_959956536 14 Left 959956531 3:112244731-112244753 CCAGAATTTATGTTTCACCCTAG 0: 1
1: 0
2: 0
3: 5
4: 150
Right 959956536 3:112244768-112244790 TGTATCCACAGATGGAATTAGGG 0: 1
1: 0
2: 1
3: 16
4: 185
959956531_959956535 13 Left 959956531 3:112244731-112244753 CCAGAATTTATGTTTCACCCTAG 0: 1
1: 0
2: 0
3: 5
4: 150
Right 959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG 0: 1
1: 0
2: 2
3: 18
4: 176
959956531_959956534 6 Left 959956531 3:112244731-112244753 CCAGAATTTATGTTTCACCCTAG 0: 1
1: 0
2: 0
3: 5
4: 150
Right 959956534 3:112244760-112244782 TTCTGTTCTGTATCCACAGATGG 0: 1
1: 0
2: 1
3: 30
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959956531 Original CRISPR CTAGGGTGAAACATAAATTC TGG (reversed) Intronic
900142765 1:1145482-1145504 CTGGGGTGAGCCATAAAGTCAGG - Intergenic
902544073 1:17175596-17175618 CTAGAGTAAAATATAAAATCAGG + Intergenic
906639258 1:47431908-47431930 CCAGTGTGAAACCTCAATTCAGG + Intergenic
906710871 1:47929103-47929125 CTAGGCTGAGACATAAAGGCTGG - Intronic
907504176 1:54905585-54905607 CCAGGCTGAAGCAAAAATTCTGG + Intergenic
917812158 1:178669899-178669921 CTGCATTGAAACATAAATTCTGG + Intergenic
918694654 1:187530086-187530108 CTTGGGTGTAAAATAATTTCTGG - Intergenic
919481536 1:198096150-198096172 CTAGAGGGAAACTTAAATACAGG + Intergenic
921442149 1:215200220-215200242 TTGGGGTGAAATAAAAATTCAGG - Intronic
921984277 1:221293752-221293774 CTAGGGTAAAATGCAAATTCAGG + Intergenic
1064869210 10:19919117-19919139 CTAGGGAGAAATGTAAATACAGG + Intronic
1065857637 10:29843145-29843167 CCAGTGTCAAACATAACTTCAGG - Intergenic
1071359572 10:84832405-84832427 CTTGGGGGAAAAAAAAATTCTGG + Intergenic
1073917111 10:108418199-108418221 CTAGAATGAACCATAAATTTTGG + Intergenic
1074830175 10:117242048-117242070 TCAGGGGGAAACATAAGTTCTGG - Intronic
1077605457 11:3607722-3607744 GCAGGGTGAAACATACATGCAGG + Intergenic
1078283178 11:9923282-9923304 CTAGGGTGTAACCAAAATGCAGG - Intronic
1079430164 11:20381828-20381850 CTAGCATGCAACATGAATTCTGG + Intronic
1079863614 11:25706862-25706884 CTAGGATGAAACAAAACTTTTGG - Intergenic
1080018581 11:27534130-27534152 CTGAGGTGAGACAGAAATTCAGG + Intergenic
1085753182 11:79180230-79180252 GGAGGGTGAATCATAAATACGGG - Intronic
1087235368 11:95712194-95712216 TTAGGATAAAACATCAATTCGGG - Intergenic
1087265193 11:96052954-96052976 CTAGGGTGAGACTTAAGTGCTGG + Intronic
1087822905 11:102731507-102731529 TTAGGTTAAAAAATAAATTCAGG - Intergenic
1089027454 11:115286655-115286677 CTGGGGTAAAACATACATTCTGG + Intronic
1089221309 11:116874168-116874190 TTAAAGAGAAACATAAATTCAGG - Intronic
1090541435 11:127710831-127710853 CTCAGGTGAGACATAAATCCAGG - Intergenic
1090676098 11:128998030-128998052 CTAGGGAGAAATAGAAACTCAGG + Intronic
1091416092 12:285834-285856 CTATGGTGAAATATAATTTTGGG - Intronic
1092916067 12:13190210-13190232 CTAGAGGGACACATAAATTTTGG + Intergenic
1099500175 12:83404078-83404100 CTAGGGTGAGACAGAAATATAGG + Intergenic
1101815815 12:108145254-108145276 CTTGGGTGAAGCATCACTTCTGG + Intronic
1102362437 12:112299969-112299991 CTAGGTTGAAAAACAATTTCTGG + Intronic
1112139448 13:96622002-96622024 AAAGGGTGTAACATCAATTCTGG + Intronic
1112485547 13:99816500-99816522 TGAGGGTGACACATACATTCAGG - Intronic
1112817076 13:103285232-103285254 ATAGGGTGAAAAGTAAAATCTGG + Intergenic
1114564967 14:23623937-23623959 CTAGGGAGAAAGAGAAATGCAGG + Intergenic
1116578986 14:46614225-46614247 CTAGGCTAAAAAAGAAATTCAGG + Intergenic
1118432520 14:65734548-65734570 TTAGGGAGAAACATAAATAGTGG - Intronic
1126565597 15:50095522-50095544 CCAGGGTGAAAGATTACTTCAGG + Intronic
1128231632 15:66039602-66039624 CTAGGTTGAAACTTAAACCCTGG - Intronic
1133573235 16:7062819-7062841 CCAGGGTTAAACATAAAGGCAGG - Intronic
1133659618 16:7903596-7903618 ATAGCGTGAAACAGAAATTACGG + Intergenic
1134249958 16:12567444-12567466 ATAAGGGGACACATAAATTCTGG - Intronic
1135932532 16:26750532-26750554 CTAGAGGGAAACGTAAATACTGG - Intergenic
1137362035 16:47827154-47827176 CTAGAGTTGAACATTAATTCTGG - Intergenic
1139153840 16:64416918-64416940 CTATTGTGAAACATATGTTCTGG + Intergenic
1140022509 16:71251969-71251991 CTGTGGTGAAACTGAAATTCTGG - Intergenic
1147651057 17:42062311-42062333 CTAGGGAGAAGCAGAAATCCTGG + Intronic
1149310125 17:55385328-55385350 CTAGGGTGAAAAATCAATCAGGG - Intergenic
1149313550 17:55419341-55419363 CAAGTGTGAAACATAAAATGAGG + Intronic
1151095514 17:71492982-71493004 CTGCAGTGAAACATAAATTTTGG - Intergenic
1153201239 18:2649778-2649800 CTAGGAAGACACACAAATTCGGG - Intergenic
1153856067 18:9148625-9148647 CTAGAATGAAACCTAAGTTCTGG - Intronic
1154954186 18:21239601-21239623 CAAGGCAGAAACACAAATTCAGG + Intergenic
1166821989 19:45586187-45586209 GTAGGAGGAAACATACATTCAGG + Intronic
926606080 2:14899776-14899798 CCAGGGTAAAAAATAATTTCAGG - Intergenic
927593109 2:24373812-24373834 ATATGGTGAAATATATATTCTGG + Intergenic
928383589 2:30844456-30844478 TTAGGGTGATAAATATATTCTGG + Intergenic
930511532 2:52351240-52351262 CTAGGGAGAAATATACAATCAGG - Intergenic
931612005 2:64111066-64111088 CTAGGGAGAGAAATAAATGCAGG - Intronic
932840130 2:75074067-75074089 ATAAGTAGAAACATAAATTCTGG - Intronic
934233273 2:90206216-90206238 TTAGGGAGACACAGAAATTCAGG + Intergenic
935461946 2:103347178-103347200 CTTTGGTGAGACAGAAATTCTGG + Intergenic
935470939 2:103460017-103460039 CTAGGATGAATAATGAATTCTGG - Intergenic
935514664 2:104021559-104021581 CTATGGTAAAACATGACTTCTGG - Intergenic
939522383 2:143247064-143247086 CTAGCTTGAAACACACATTCAGG - Intronic
939797297 2:146661726-146661748 CTAAGGAGAAACAAAGATTCAGG + Intergenic
940473195 2:154126278-154126300 CTAGGGTAAAAAAAAAATACTGG + Intronic
942020663 2:171865024-171865046 CTATGATGAAAAATAAATTAGGG - Intronic
946113322 2:217439059-217439081 GTAGGGTGAATCAGAAATACAGG - Intronic
947028489 2:225765451-225765473 CTAGGTTTCAACATAAATTTGGG - Intergenic
948898768 2:240945234-240945256 CCAGGGTCAAAAGTAAATTCTGG - Intronic
1170345575 20:15382905-15382927 GAAAGGAGAAACATAAATTCAGG + Intronic
1172747025 20:37218633-37218655 CCAGGGTGATAAATATATTCTGG - Intronic
1179049434 21:37876041-37876063 CTAGTGTAAAACAAAAATGCAGG + Intronic
1182304864 22:29360952-29360974 CCAAGGTGACACATAAATTTTGG - Intronic
1183002914 22:34876604-34876626 CTAGCTTGGAACATACATTCAGG - Intergenic
949607534 3:5670971-5670993 CTGGGGTGACACATACATTCAGG - Intergenic
956814364 3:72894589-72894611 CTAGGTTGGAACACACATTCAGG - Intronic
956972391 3:74541643-74541665 ATAGGGAGGAACATAAATTAGGG + Intergenic
958863358 3:99470875-99470897 CTAGAGTGAAAAATAAATAGGGG - Intergenic
959956531 3:112244731-112244753 CTAGGGTGAAACATAAATTCTGG - Intronic
962759199 3:138493185-138493207 CTAGGGTGACACATGACTTAGGG - Intergenic
963445563 3:145402538-145402560 GTAGGGTGAAAAATAAATGAAGG - Intergenic
963765343 3:149329067-149329089 CTAGGGGAAATAATAAATTCAGG - Intronic
963783876 3:149513499-149513521 TAAGGGTGAAACATTAATTGGGG - Intergenic
964027059 3:152087299-152087321 CAAGGGTGAGACAAAAGTTCTGG + Intergenic
964028132 3:152103116-152103138 CTAGTGTGAAAAAAAAAATCTGG - Intergenic
966391242 3:179454612-179454634 CTAGGGTAAAACTTAAAAGCAGG - Intergenic
967736587 3:192959350-192959372 CTAGGGTCAAAAATAAATGGAGG + Intergenic
969816930 4:9693955-9693977 GTAGGGTGCAAGATAACTTCAGG - Intergenic
973972855 4:56231210-56231232 CTAGGGTTAAACAGAAAGCCAGG - Intronic
976793828 4:88910591-88910613 CTATGGGGAAACATAAAATAGGG - Intronic
979817837 4:125132573-125132595 CTAGGGCTCAACAGAAATTCAGG - Intergenic
982331659 4:154187646-154187668 CTAAGGTTGAACATAAATTTTGG - Intergenic
983988255 4:174087120-174087142 CAAGGGTCAAACTGAAATTCTGG - Intergenic
984620265 4:181944505-181944527 CTCTGGTGAAACATTATTTCTGG - Intergenic
986253188 5:6079991-6080013 CTACGGAGAAAAATAAATCCAGG + Intergenic
986349035 5:6859807-6859829 TTAGGGTGAACCCTAAATCCAGG + Intergenic
989315623 5:40075192-40075214 TTAGGCTGAAATAAAAATTCTGG + Intergenic
990301400 5:54452669-54452691 CTAGGGTGAAATATGGACTCAGG + Intergenic
991197821 5:63956918-63956940 CAAGAGTGAAAAATAAAATCAGG - Intergenic
994209400 5:97071694-97071716 CTATGAAGAAACATAAAATCTGG + Intergenic
995298394 5:110547630-110547652 CATAGATGAAACATAAATTCAGG - Intronic
995612766 5:113927775-113927797 ATAGGCAGAAAAATAAATTCAGG + Intergenic
997005236 5:129808723-129808745 AGAGGGTGAAACATAAAGTATGG + Intergenic
998696772 5:144649708-144649730 CTAGGGTAAAAGATTAATGCTGG + Intergenic
1000619111 5:163462387-163462409 TTAGGTTGAAATATAAATTTTGG - Intronic
1001382521 5:171313751-171313773 CTAGGGTGACTCAGAACTTCGGG + Intergenic
1003352954 6:5336813-5336835 CAAGGGTGAAAAAGAAATTGTGG - Intronic
1006768140 6:36526962-36526984 GGAGGGTGGATCATAAATTCAGG + Intronic
1007907941 6:45482785-45482807 CTTGGGTGAAACATAATTATGGG - Intronic
1008096228 6:47342416-47342438 CTAAGGTGGAGCCTAAATTCAGG - Intergenic
1013669110 6:112378929-112378951 CAAGAATGAAACATAAATTGTGG - Intergenic
1014405909 6:121050513-121050535 TGAGGGTGAAAGATAAATTAAGG - Intergenic
1017795368 6:157839689-157839711 CCAGGGTGAAGCATAATTTGAGG + Intronic
1020552815 7:9628332-9628354 GTAGCGTGACACATACATTCGGG - Intergenic
1020767380 7:12340964-12340986 CTAGGGTGAAAAATAAAATTGGG - Intronic
1021260491 7:18451021-18451043 CTAGGTTCCAACATAAATTTTGG - Intronic
1021881424 7:25098798-25098820 GTAGGGTGAAAGAAAAAATCAGG - Intergenic
1024214613 7:47237584-47237606 CTGGAGGGAAACATAATTTCAGG + Intergenic
1024559161 7:50628818-50628840 ATTGAGTGACACATAAATTCTGG - Intronic
1027635811 7:80671599-80671621 CTAGAGTTAAACATAAAATTTGG + Intronic
1027685195 7:81271710-81271732 CAAGATTGATACATAAATTCAGG + Intergenic
1027981187 7:85224707-85224729 GTAGGGTGAAAGATAATTACAGG - Intergenic
1030080661 7:105775095-105775117 CTAGGGCAAAACATAAATTGGGG - Intronic
1030675833 7:112384519-112384541 CTAGGGAGAAAAATAAAGTAGGG - Intergenic
1031578477 7:123443708-123443730 CTAGGCAGAAACACAAATTTGGG + Intergenic
1031793138 7:126135436-126135458 CTTGGGTGAGAAATAAATACAGG + Intergenic
1032519502 7:132533342-132533364 CTTGGGTGGAACATAAACTCAGG + Intronic
1033466969 7:141601293-141601315 CTTGGGTGAAATAAACATTCAGG - Intronic
1034099920 7:148442129-148442151 CTAGGATGAAACAGACCTTCAGG + Intergenic
1041511713 8:58660221-58660243 CTAAGAGGAAACATCAATTCTGG + Intergenic
1042028583 8:64449577-64449599 CCAGTGTGAAACAAAAATGCTGG + Intergenic
1042990839 8:74637909-74637931 CTAGAGTCAAACACATATTCTGG - Intronic
1047106233 8:121733564-121733586 CTTGGGTTAAAGATAAAATCAGG + Intergenic
1047361278 8:124171856-124171878 CTAGCTTGAAACACACATTCAGG - Intergenic
1047802100 8:128320612-128320634 CTTGAGTTAAACATAAGTTCCGG - Intergenic
1048709283 8:137189874-137189896 CTAGGAGGAAAAATACATTCGGG + Intergenic
1051387662 9:16526995-16527017 CTAGGTTGAGACCTAAATGCAGG + Intronic
1053486612 9:38461926-38461948 CTAGGGGTAAGCATGAATTCAGG - Intergenic
1055373974 9:75628710-75628732 TCAGGATGAAACATAAATTTTGG + Intergenic
1185768555 X:2747030-2747052 CCAGGGTGAATCACAAAGTCAGG + Intergenic
1186002848 X:5033409-5033431 AAAGGGTGAAACAGAAGTTCAGG - Intergenic
1187471248 X:19571226-19571248 CTAGGCTGAAATAGAAGTTCAGG + Intronic
1189697241 X:43676820-43676842 CTAAGAAGAAAAATAAATTCAGG + Intronic
1190934957 X:54990991-54991013 CAATGGTGAAACTTAAAATCGGG + Intronic
1191779386 X:64849515-64849537 CTACTATAAAACATAAATTCAGG + Intergenic
1193813383 X:86077858-86077880 CTCTGGTGAAACATAATTTATGG - Intergenic
1197792448 X:130269158-130269180 CTACAGAGAAACATGAATTCTGG + Intergenic
1197792463 X:130269409-130269431 CTACAGAGAAACATGAATTCTGG - Intergenic
1198794983 X:140385110-140385132 CTAGGATGAATCATACATTTGGG - Intergenic
1199804837 X:151288312-151288334 CAAAGCTGAAACAAAAATTCAGG + Intergenic
1201301814 Y:12511951-12511973 CCAGGGTGAATCACAAAGTCAGG - Intergenic
1201403286 Y:13626523-13626545 CTAAGCTGAAAAATTAATTCAGG + Intergenic