ID: 959956532

View in Genome Browser
Species Human (GRCh38)
Location 3:112244748-112244770
Sequence ACAGAACAGAAGACTAGCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 194}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959956532_959956535 -4 Left 959956532 3:112244748-112244770 CCCTAGCTAGTCTTCTGTTCTGT 0: 1
1: 0
2: 1
3: 11
4: 194
Right 959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG 0: 1
1: 0
2: 2
3: 18
4: 176
959956532_959956536 -3 Left 959956532 3:112244748-112244770 CCCTAGCTAGTCTTCTGTTCTGT 0: 1
1: 0
2: 1
3: 11
4: 194
Right 959956536 3:112244768-112244790 TGTATCCACAGATGGAATTAGGG 0: 1
1: 0
2: 1
3: 16
4: 185
959956532_959956538 22 Left 959956532 3:112244748-112244770 CCCTAGCTAGTCTTCTGTTCTGT 0: 1
1: 0
2: 1
3: 11
4: 194
Right 959956538 3:112244793-112244815 AGAGCATGAAACCACACTAGAGG 0: 1
1: 0
2: 1
3: 5
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959956532 Original CRISPR ACAGAACAGAAGACTAGCTA GGG (reversed) Intronic
900270907 1:1788145-1788167 ACAGAACACAGGAGTAGCGATGG + Intronic
900271461 1:1791543-1791565 ACAGAGCAGAAGCCTGGCTCAGG + Intronic
905328402 1:37174862-37174884 TAAGAACAGAAGACCAACTAGGG + Intergenic
907135142 1:52133272-52133294 AAAGAACAACAGACAAGCTATGG - Intergenic
907668695 1:56455422-56455444 ACAGAACAGAAGACATGTTGTGG - Intergenic
909587831 1:77311069-77311091 ACAGAAAAGAAGGCTGTCTAGGG - Intronic
910239507 1:85071333-85071355 ACAGGACAGAACACTGGCCAAGG - Intronic
911190766 1:94946332-94946354 AAAGAATACAAGCCTAGCTACGG - Intergenic
911477359 1:98390026-98390048 AGAGTCCAGAAGACAAGCTATGG + Intergenic
913566373 1:120076753-120076775 ACAGAACAGAAGAGTGGGAAAGG + Intergenic
913631758 1:120716796-120716818 ACAGAACAGAAGAGTGGGAAAGG - Intergenic
914287134 1:146237469-146237491 ACAGAACAGAAGAGTGGGAAAGG + Intergenic
914548166 1:148688211-148688233 ACAGAACAGAAGAGTGGGAAAGG + Intergenic
914618517 1:149383493-149383515 ACAGAACAGAAGAGTGGGAAAGG - Intergenic
915986738 1:160473584-160473606 ACAGAAGAGAAGACAGGGTAGGG + Intergenic
916920815 1:169464360-169464382 AAGGAAAAGAACACTAGCTAAGG - Exonic
916954499 1:169818261-169818283 ACAGAACAGAAGTGTAGGTAAGG + Intronic
918425528 1:184405897-184405919 ACAGATCAGAAGATAAGATAGGG - Intronic
921001010 1:211043011-211043033 AAAGAGCATAAGACAAGCTAAGG + Intronic
921134360 1:212246874-212246896 ACAGAACAGAACCCTATCCAGGG - Intergenic
921449147 1:215282658-215282680 ACAGAACAGAGGAGTTGGTAAGG + Intergenic
922180110 1:223226802-223226824 ACACCACAGAACACTAGCCAGGG - Intronic
923685967 1:236154128-236154150 ACAAAACCCAAGACTAGCCAGGG - Intronic
924204438 1:241697324-241697346 AAAGAAAAGAAGAATAGGTACGG - Intronic
924294758 1:242575092-242575114 CCAGAACAGAAAACTAGACACGG + Intergenic
1062837693 10:646886-646908 ACAGAACATAATTCTAGCAATGG - Intronic
1063033255 10:2257716-2257738 ACATTGCAGTAGACTAGCTATGG - Intergenic
1070688683 10:78508982-78509004 AAAGAACAGAATATTAGCGAAGG - Intergenic
1072057318 10:91772869-91772891 ACAAAACAAAAGACAAGATATGG - Intergenic
1074538222 10:114344192-114344214 ACAAAACACAACACAAGCTAAGG - Intronic
1074734500 10:116414879-116414901 ACAGAACAGAAGTTAAGGTAGGG + Intergenic
1075018453 10:118928699-118928721 AGAGGAAGGAAGACTAGCTAGGG + Intergenic
1079742449 11:24079775-24079797 ACAGAAGAGAAGACAAACTATGG + Intergenic
1082205127 11:49424158-49424180 AGAGAACAGAAACCTAGATAGGG - Intergenic
1083737691 11:64690998-64691020 AAAGAACAGAAGAGGAGCTTGGG - Intronic
1085690032 11:78657093-78657115 ACAGAACAGAAGGCCACCCATGG - Exonic
1086356361 11:86005158-86005180 ACACAACAGAAGCCAAGATAGGG + Intronic
1086649969 11:89276387-89276409 AAAGAACAGAAACCTAGATAGGG + Intronic
1087242887 11:95799939-95799961 AAAAAACAGAAGACAAGTTAGGG - Intronic
1087243149 11:95803090-95803112 ACAGAACAGGAGACTGATTAAGG + Intronic
1087558874 11:99758729-99758751 AAAGAACAGAAGACAGGATAAGG + Intronic
1090707639 11:129353722-129353744 ACAGAGCAGAAGACTTGACATGG - Intergenic
1091027130 11:132151576-132151598 ACAAAAGAGAAACCTAGCTAGGG - Intronic
1091212188 11:133871667-133871689 ACAGTACAGAAGAGCAGCTCTGG - Intergenic
1094042251 12:26130447-26130469 CAACAACAGAAAACTAGCTAAGG + Intronic
1094256588 12:28436122-28436144 ACAGAAAACAAGAATAGTTATGG - Intronic
1098570378 12:71981442-71981464 ACAACACAGAAAACCAGCTAGGG + Intronic
1098842982 12:75499389-75499411 TCAGAACAGAGGAGTAACTAGGG + Exonic
1101300882 12:103479372-103479394 AAAGAAAAGAAGACTAGGTGTGG + Intronic
1102606388 12:114070956-114070978 ACAGAACATCAGACCAACTACGG - Intergenic
1106807979 13:33331129-33331151 AGTGAAGAGAAGACTAGCAAGGG - Intronic
1107448003 13:40485268-40485290 ACAGAACAGAAGGCTTGCCCAGG + Intergenic
1107510792 13:41081995-41082017 ACAGACCAGTTGACTATCTAGGG + Intronic
1109187841 13:59291697-59291719 ACAGACCAGAAGACTCCCTTGGG + Intergenic
1109914161 13:68957977-68957999 AGACAATAGAAGACTAGATAAGG - Intergenic
1111533958 13:89577134-89577156 TCTGTATAGAAGACTAGCTAAGG + Intergenic
1112604051 13:100886323-100886345 ACAGAAAAAAATACTGGCTAAGG - Intergenic
1114305678 14:21420626-21420648 ACAGTAGAGAAGAGTAGGTATGG + Intronic
1114886522 14:26858694-26858716 ACAGAAAAGAAGACAAACTCTGG - Intergenic
1116184214 14:41576134-41576156 TGAGAACAAAAGACTAGCTCAGG + Intergenic
1117725267 14:58667149-58667171 AAAGAGCAGAAGAGTTGCTATGG + Intergenic
1119627541 14:76192819-76192841 AAAGAACTGAAGACTTTCTAAGG - Intronic
1119735467 14:76978745-76978767 ACAAAACAAAAAACTAGCTGTGG - Intergenic
1126373892 15:47975271-47975293 ACAGAACAGGAAACCAGGTAGGG + Intergenic
1126382554 15:48064338-48064360 AGAGAACAAAAGACTAACTTTGG + Intergenic
1130722203 15:86399520-86399542 ACAGAAGAGAAAACTGACTAGGG - Intronic
1130778791 15:87012730-87012752 GCAGTACAGCAGACTAGATAGGG + Intronic
1130887409 15:88105457-88105479 AAAGAACAAGTGACTAGCTAAGG + Intronic
1131735264 15:95325397-95325419 ACAGAACAGAATACTATCCCAGG + Intergenic
1132028256 15:98420803-98420825 ACGGCACAGAAGACTAGGTGAGG - Intergenic
1134276050 16:12777091-12777113 ACAGAACAGAGGACTTCCCAGGG + Intronic
1134390932 16:13819349-13819371 ACAGCACAGAATATTAGGTAGGG + Intergenic
1138793706 16:59941662-59941684 ACAGAAAAGAAAAATAGCTGAGG + Intergenic
1139082339 16:63538311-63538333 ACAGAACACAAGATTATCTGAGG - Intergenic
1140517375 16:75553637-75553659 AAAGAAAAGAAGAAAAGCTAGGG + Intronic
1140700705 16:77579114-77579136 AGAGGACAGAAAACTGGCTAAGG + Intergenic
1142286150 16:89172301-89172323 ACAAAACCCAAGACTAGCCAGGG - Intronic
1144414138 17:15030262-15030284 ACAAAACAAAATACTGGCTAAGG + Intergenic
1144546822 17:16204883-16204905 ACATTACAAAAGAATAGCTAGGG + Intronic
1144712665 17:17412548-17412570 ACAGAAGAGAAGACTATGAATGG - Intergenic
1145299552 17:21622482-21622504 ACATTACAAAAGAATAGCTAGGG - Intergenic
1145350730 17:22080792-22080814 ACATTACAAAAGAATAGCTAGGG + Intergenic
1146428291 17:32764897-32764919 ACAGAACAAGAGGCCAGCTACGG - Exonic
1147765361 17:42831902-42831924 AAAGCACAGAAGACTGACTATGG - Intronic
1148577056 17:48719594-48719616 ACACAAACGAATACTAGCTAAGG - Intergenic
1151002420 17:70393101-70393123 ACAGAACTAAAAACTAGCCATGG - Intergenic
1153147258 18:2047647-2047669 TCAGGACAGAAGTCTAGCTCAGG - Intergenic
1157864482 18:51168920-51168942 CCAGAACAGAAAAGAAGCTAGGG + Intergenic
1159652279 18:70991402-70991424 AAAGAACAGAGAACTAGCAATGG + Intergenic
1161955990 19:7495368-7495390 ACAAAACAAAAGAGCAGCTAGGG - Intronic
1164214358 19:23130817-23130839 ACAGAACCAAATTCTAGCTAGGG + Intronic
925667967 2:6281900-6281922 ACAGAACAGAATATTAGAAATGG - Intergenic
925691663 2:6530599-6530621 AAAAAACAGAAGACTAACTCTGG - Intergenic
925845759 2:8031833-8031855 ACAGAACTGAAGAATATCCAAGG + Intergenic
926006874 2:9379286-9379308 ACAGATCATAAGACAAGCAAAGG + Intronic
930040739 2:47121087-47121109 ACAGAACACAAGAAAAGCTGGGG + Exonic
931441231 2:62292195-62292217 AGTGAAAAGAAGACTAGCTCTGG + Intergenic
931597439 2:63964718-63964740 ACTGAAGAAAAGACTAGCTTGGG - Intronic
935104011 2:100022864-100022886 ACAGAACAACAGACAAGCTAGGG + Intronic
935514371 2:104018407-104018429 AAAGCACAGAAGACTAGTTCCGG - Intergenic
935735733 2:106105448-106105470 AAAGAACACAAGCCAAGCTATGG - Intronic
936380099 2:111976833-111976855 AAAGAACAGAAAAAGAGCTATGG - Intronic
940504549 2:154536430-154536452 ACAGAAAAGAAAACTAGCAGCGG - Intergenic
940897558 2:159095244-159095266 ACAGATCAGAAAACTCACTAGGG - Intronic
941464696 2:165812259-165812281 TTAGAACACAAGAATAGCTAGGG - Intergenic
941859833 2:170267589-170267611 ACAGAGCTCAAGACCAGCTAAGG - Intronic
944400700 2:199322840-199322862 ACACAACAGAAGATTTGTTAGGG + Intronic
945415035 2:209560147-209560169 ACAGAACAGATGAAAGGCTATGG + Intronic
945729430 2:213515415-213515437 ACAGGGCAATAGACTAGCTAGGG - Intronic
948631077 2:239303078-239303100 ACTGAACAGAAGCCCAGCTCAGG + Intronic
948745459 2:240089624-240089646 ACAGAACAGAAGAGGGGCGAAGG + Intergenic
1169675972 20:8155419-8155441 TCATAAGAGAAGACTATCTATGG - Intronic
1170228716 20:14021341-14021363 ACAATACAAAAGACTAGGTAAGG - Intronic
1173083727 20:39894651-39894673 ACAGAAAAGAAACCTAGCTGGGG + Intergenic
1174109038 20:48185078-48185100 GAAGAAGAGAAGACTAGATAGGG - Intergenic
1175266626 20:57707430-57707452 ACAGAACACAGGACTAACTGGGG + Intronic
1175278892 20:57789266-57789288 ACACAACAGAACACTAGCCCAGG - Intergenic
1176650232 21:9539289-9539311 ACATTACAAAAGAATAGCTAGGG - Intergenic
1179240615 21:39587544-39587566 TCAGGACAGAAGAATAGATAAGG + Intronic
1183145815 22:35990643-35990665 ACCAGACATAAGACTAGCTAAGG + Intronic
1184543302 22:45145242-45145264 AAAGAACAGAAGACCAGTCACGG - Intergenic
1184629493 22:45764366-45764388 ATAGAACAGAAGCCTTGCTAAGG - Intronic
1185361150 22:50407772-50407794 ACAGGAAAGAAGACTGGCCAAGG - Intronic
949173928 3:1035264-1035286 ACAGACCAGAAGATTCCCTAGGG - Intergenic
949232199 3:1763856-1763878 ACAGAAAAGAAGAAAAGATAAGG + Intergenic
951753400 3:26061893-26061915 ACAGAACAGAAAACTAGCTGGGG + Intergenic
952277662 3:31892850-31892872 ACGGACCAGCAGACTAGCCAGGG + Intronic
955790465 3:62583807-62583829 AAAGAACAGGAGCCTAGCCATGG - Intronic
957325301 3:78684644-78684666 ACACTACAGATGACTAGCTCTGG + Intronic
958042054 3:88238513-88238535 ACAGAACAGAAAACAATTTATGG + Intergenic
959553565 3:107692026-107692048 ACAGTAAAGAACAGTAGCTAAGG + Intronic
959956532 3:112244748-112244770 ACAGAACAGAAGACTAGCTAGGG - Intronic
962174857 3:133142317-133142339 GCAGAATATGAGACTAGCTACGG + Intronic
962376129 3:134860228-134860250 CCAGAACAGGAGACTGGCTGAGG - Intronic
964177667 3:153844441-153844463 ACAGAACAGAAAACAAGATGGGG + Intergenic
964213031 3:154249176-154249198 ACAGAACAGAACATTGGCTGAGG - Intronic
964450974 3:156813031-156813053 AGATAAATGAAGACTAGCTAAGG - Intergenic
964927561 3:161976933-161976955 AAAGAACAAAAGACAACCTAGGG - Intergenic
965490159 3:169325174-169325196 ACAGAACAGGAGCACAGCTACGG + Intronic
965899543 3:173621591-173621613 ACAGGAAAGGAGACTAGATATGG + Intronic
968638490 4:1696594-1696616 ACAGAACAAAAAAACAGCTAGGG + Intronic
969233813 4:5851227-5851249 AAAGAACAGAAGCCCAGCTGGGG + Intronic
972474318 4:39436103-39436125 ACGGAGCAGAAGACAAGCTGAGG + Intronic
972959310 4:44432928-44432950 ACAGAAGAGAAGAGTGGTTATGG - Intronic
973193408 4:47412736-47412758 ACAGACCAGAAGACCTGCTTGGG - Intronic
976809984 4:89090167-89090189 ACAGAACAGGAGATTCCCTAGGG - Intronic
978079820 4:104578593-104578615 ACAGATCTGAAGATCAGCTAGGG + Intergenic
980515521 4:133852910-133852932 TCATAACAGAAGACAAGATAGGG - Intergenic
980791511 4:137626482-137626504 GCAGATCAGAAGAGTTGCTATGG + Intergenic
982943093 4:161583411-161583433 ACAGAAAATAAGACAAGATAGGG - Intronic
988230541 5:28472601-28472623 ACAGAGCAGAAGACAAACAAGGG - Intergenic
993815317 5:92537307-92537329 TCATAACAGAAGATTAGATATGG + Intergenic
994455977 5:100008545-100008567 AGAGAATGGAAGACAAGCTACGG - Intergenic
994859443 5:105169347-105169369 ACACAACCACAGACTAGCTATGG - Intergenic
995020841 5:107365714-107365736 ACAGAACAGAAGATTAGGCTTGG - Intergenic
996809644 5:127501763-127501785 ACAGACCAGAAGACTAGGAAGGG + Intergenic
997609873 5:135208367-135208389 ACAGACAAGATGACCAGCTAGGG + Intronic
998576209 5:143319923-143319945 ACAGAACTGAAGCCAAGCCATGG + Intronic
999190352 5:149742480-149742502 ACAGAAGGGCAGACTGGCTAAGG + Intronic
1000387493 5:160688500-160688522 GCAGGTCAGAAGACTAGCTCTGG + Intronic
1000774091 5:165395607-165395629 ACAGAACAACAGACTATCTCAGG - Intergenic
1004046630 6:12031424-12031446 AGAGACTAGAAGACTAGCCAGGG - Intronic
1004427196 6:15514371-15514393 CCAGTACAGAAGCCTAGCTTAGG + Intronic
1007642825 6:43356427-43356449 ATAGAAAAGAAAACAAGCTAGGG - Intronic
1008040444 6:46792206-46792228 AAAGAACAGGAGATTATCTAAGG - Intergenic
1009314593 6:62202578-62202600 ACATAACAGTAGACTACCCAAGG - Intronic
1009650091 6:66464809-66464831 ACTGAAGAGAAGTCTAGCTAGGG + Intergenic
1009849909 6:69182416-69182438 AAAAAACAGAAGGCTAGTTAAGG + Intronic
1013087410 6:106868177-106868199 ACAGAACAGGAGTCTGGCAATGG - Intergenic
1015062584 6:128984457-128984479 AGAGAAAAGAACAGTAGCTAAGG - Intronic
1016093146 6:140003450-140003472 ACAGAACAAAAGGCTGGGTAAGG + Intergenic
1020580556 7:9993963-9993985 TAAGAAGAGAAGTCTAGCTAGGG + Intergenic
1022814079 7:33897308-33897330 ACTGCACAGAAGACTAGATGAGG + Intergenic
1025276855 7:57589585-57589607 ACATTACAAAAGAATAGCTAGGG - Intergenic
1028077942 7:86537757-86537779 ACAGAAAAGAATATTAGCTCTGG + Intergenic
1028644143 7:93076715-93076737 ACAGTACAGCATACTGGCTATGG + Intergenic
1028837370 7:95389859-95389881 ACAGAACTGGAGACTAGCCTAGG + Intronic
1028925673 7:96354809-96354831 ACAGAAAAGAATACTAGCTCAGG + Intergenic
1033083612 7:138321478-138321500 AAAGAAAAAAAGACCAGCTAAGG + Intergenic
1042123830 8:65516696-65516718 ACACAACAGAAGACAAGCAAAGG - Intergenic
1044150114 8:88765681-88765703 AGAGAATAGAAGACTACCTGAGG + Intergenic
1045638528 8:104221929-104221951 ACAGAACAGCAGACAGGCCAGGG - Intronic
1048642637 8:136381231-136381253 ACAGGACTGAAGATTTGCTAGGG - Intergenic
1048787510 8:138065988-138066010 AGAGAAAAGAAGAATAGCTGAGG - Intergenic
1050066735 9:1767886-1767908 AAAGAACAGAGGACTACCAATGG - Intergenic
1051119304 9:13734411-13734433 ACAGAACAGAAGATGGGTTAGGG - Intergenic
1052396220 9:27941443-27941465 AAAGAAAAGAAGAATAGCAAAGG + Intergenic
1055978779 9:81979955-81979977 ACATATTAGTAGACTAGCTATGG - Intergenic
1057119262 9:92556776-92556798 ACACAACAGCAGAGTAGATAAGG - Intronic
1057261249 9:93586087-93586109 AATGTGCAGAAGACTAGCTAAGG - Intronic
1058908713 9:109501257-109501279 ACAGAAGAGAAAACAATCTAGGG + Intergenic
1059398583 9:114054510-114054532 ACAGAACAAGAGACTAAGTAAGG + Exonic
1059508914 9:114825749-114825771 ACAAAACAGAAAACTGCCTATGG + Intergenic
1203627973 Un_KI270750v1:42844-42866 ACATTACAAAAGAATAGCTAGGG - Intergenic
1187805161 X:23111476-23111498 AGAGAACCTAAGACCAGCTATGG - Intergenic
1187823868 X:23315524-23315546 ACAGAAAAGAGAACTAGCCATGG - Intergenic
1189121666 X:38401652-38401674 ACAGAACATAAGATGAGATATGG - Intronic
1191153054 X:57241850-57241872 ACAGCACAGAAAAGCAGCTATGG + Intergenic
1193186685 X:78521646-78521668 ACAGAACAGAAGAAGAGATAAGG + Intergenic
1193187010 X:78525286-78525308 ACAGAACAGAAGAAGAGATAAGG + Intergenic
1193421673 X:81290883-81290905 AAAGAACAAAATACTGGCTATGG + Intronic
1193593305 X:83417160-83417182 ACAGAATGGTAGACAAGCTAAGG + Intergenic
1195464497 X:105165403-105165425 AGAGAACAGTAGAGTAGATAGGG - Intronic
1195794035 X:108623832-108623854 ACAGAAAAGAAGCCTTGCAAGGG - Intronic
1196780092 X:119376012-119376034 CCAGAACATAAGACTAGGTAAGG + Intergenic
1197253687 X:124240459-124240481 ATAAAACTGAAGACTAGATAGGG + Intronic
1200777117 Y:7179389-7179411 ATAGAACATTAGACCAGCTATGG + Intergenic