ID: 959956533

View in Genome Browser
Species Human (GRCh38)
Location 3:112244749-112244771
Sequence TACAGAACAGAAGACTAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 249}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959956533_959956535 -5 Left 959956533 3:112244749-112244771 CCTAGCTAGTCTTCTGTTCTGTA 0: 1
1: 0
2: 1
3: 9
4: 249
Right 959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG 0: 1
1: 0
2: 2
3: 18
4: 176
959956533_959956536 -4 Left 959956533 3:112244749-112244771 CCTAGCTAGTCTTCTGTTCTGTA 0: 1
1: 0
2: 1
3: 9
4: 249
Right 959956536 3:112244768-112244790 TGTATCCACAGATGGAATTAGGG 0: 1
1: 0
2: 1
3: 16
4: 185
959956533_959956538 21 Left 959956533 3:112244749-112244771 CCTAGCTAGTCTTCTGTTCTGTA 0: 1
1: 0
2: 1
3: 9
4: 249
Right 959956538 3:112244793-112244815 AGAGCATGAAACCACACTAGAGG 0: 1
1: 0
2: 1
3: 5
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959956533 Original CRISPR TACAGAACAGAAGACTAGCT AGG (reversed) Intronic
900459190 1:2792647-2792669 TACAGAGGTAAAGACTAGCTGGG - Intronic
902847723 1:19125294-19125316 TACAGAACTGATGAATAACTGGG - Intronic
903025968 1:20430259-20430281 CACAAAAGAGAAGACAAGCTTGG + Intergenic
904682400 1:32238610-32238632 TACAGAAAAGAAAATTAGCCAGG + Intergenic
905535568 1:38719245-38719267 TACAGATGAGAAGACTGGATGGG - Intergenic
910680891 1:89863302-89863324 CACAGACCAGAAGACTACATGGG - Intronic
911199549 1:95031022-95031044 TCCAGACCAGAAGTTTAGCTGGG + Intronic
915217829 1:154351908-154351930 TCCATAACTGAAGACTGGCTGGG - Intergenic
915550479 1:156630204-156630226 AACAAAACAAAAAACTAGCTGGG - Intergenic
916401687 1:164456052-164456074 TCCAGAACACAAGACATGCTGGG + Intergenic
917328863 1:173861738-173861760 TACAGAAAAAAAAATTAGCTGGG + Intergenic
918425529 1:184405898-184405920 TACAGATCAGAAGATAAGATAGG - Intronic
921644372 1:217596879-217596901 AAAAGAAAAGAACACTAGCTAGG + Intronic
922282164 1:224136565-224136587 TACAAAAAAAAAAACTAGCTGGG + Intronic
922966812 1:229697463-229697485 TACAGAACCGATGGCTTGCTTGG - Intergenic
924712127 1:246538164-246538186 TGCAGACCAGAAGACCTGCTTGG + Intergenic
1063466539 10:6249011-6249033 TACAAAACACAAAATTAGCTAGG + Intergenic
1064387594 10:14911021-14911043 TACAGAGCAGAAGACCAGAGAGG + Intronic
1065441234 10:25755621-25755643 TACAAAAAAAAAAACTAGCTGGG + Intergenic
1066230719 10:33430203-33430225 AACAGAACAGAAGACTGAGTGGG - Intergenic
1069252405 10:66286113-66286135 TACATATCAGTAGACTTGCTGGG + Intronic
1069398759 10:68019311-68019333 TAAAGAACAGAAGAATAACAAGG + Intronic
1069463127 10:68613775-68613797 TAAAGTACAGAAAATTAGCTGGG + Intronic
1069667907 10:70176200-70176222 AAAAAAAAAGAAGACTAGCTAGG - Intergenic
1074999124 10:118782596-118782618 TCCAGAACACAAGAATTGCTCGG - Intergenic
1077905252 11:6527939-6527961 TGCAGAACAGAGGAGTTGCTGGG - Intronic
1077939321 11:6823816-6823838 TCCAGAATTCAAGACTAGCTTGG + Intergenic
1078392954 11:10952397-10952419 TGCAGACCAGAAGACTCCCTCGG - Intergenic
1083472085 11:62890843-62890865 TACAGAAAAGAATGCTGGCTGGG + Intergenic
1083737692 11:64690999-64691021 GAAAGAACAGAAGAGGAGCTTGG - Intronic
1084143128 11:67247586-67247608 TACTTAACACAAAACTAGCTGGG - Intronic
1085110084 11:73880058-73880080 TACAGCAAATAAAACTAGCTGGG + Intronic
1086356360 11:86005157-86005179 TACACAACAGAAGCCAAGATAGG + Intronic
1088426402 11:109709570-109709592 CACACAGCAGAAGAATAGCTGGG - Intergenic
1088441633 11:109877369-109877391 CACAGCAGAGAAGATTAGCTGGG - Intergenic
1089694452 11:120208518-120208540 CACAGAACAGAGGGCTAGGTCGG + Intergenic
1090017020 11:123095208-123095230 TAAAGAAAAAAAGACTTGCTTGG - Intronic
1090475016 11:127012452-127012474 TACATAACAAAAGACTAGGAAGG - Intergenic
1090886479 11:130881386-130881408 TACAGAACAGAACACTAAAAGGG + Intronic
1091443116 12:527070-527092 AACAAAACAAAAAACTAGCTGGG - Intronic
1092340512 12:7671962-7671984 TACAGAAAAGAATACTGGCCAGG - Intergenic
1092621366 12:10274117-10274139 TACAAAACACAAAATTAGCTGGG + Intergenic
1093987254 12:25549529-25549551 CACAGAAGAGAAGACAAACTTGG - Exonic
1095403012 12:41836930-41836952 AAAAGAACAAAAGACTAGATCGG + Intergenic
1096185894 12:49580406-49580428 TACAGAGCAGAGGACCTGCTGGG + Intronic
1096853586 12:54460431-54460453 TACAGAACATAAGAATAACCTGG - Exonic
1097103872 12:56609032-56609054 TACAAAACAAAAAATTAGCTGGG - Intronic
1097870109 12:64594812-64594834 TCAAGACCAGAAGACCAGCTTGG - Intergenic
1098427177 12:70378108-70378130 TACAGAAAAAAAAATTAGCTGGG - Intronic
1098648993 12:72940958-72940980 GGCAGGACAGAAGCCTAGCTGGG - Intergenic
1098829462 12:75342077-75342099 TACAGAACTGAAGAACAGATTGG + Intronic
1098842981 12:75499388-75499410 TTCAGAACAGAGGAGTAACTAGG + Exonic
1100537350 12:95523441-95523463 TGCAGAACTGATGACTTGCTTGG + Intronic
1100933424 12:99637149-99637171 TACAAAAAAGAAAATTAGCTGGG + Intronic
1101686271 12:107025439-107025461 TACAGATGAGGAGACTAGATAGG - Intronic
1101727054 12:107396396-107396418 TACAGATGAGAAAACTGGCTGGG - Intronic
1103060176 12:117852265-117852287 TACAAAAAAAAAAACTAGCTGGG + Intronic
1103172386 12:118832853-118832875 TACAGAAAATAAAATTAGCTGGG - Intergenic
1103761955 12:123256835-123256857 ATCAGAACAGAAAGCTAGCTCGG + Exonic
1105581084 13:21697307-21697329 TACAAAACAAAAAATTAGCTGGG - Intronic
1106025588 13:25952665-25952687 AACAGAAAAGAAAACTGGCTAGG - Intronic
1107084370 13:36410081-36410103 TACAAAAAAGAAAATTAGCTGGG + Intergenic
1108321198 13:49292542-49292564 TACAGAAGGGAAGACTATATGGG - Exonic
1108360982 13:49667778-49667800 TAAAGAAGTGAAAACTAGCTGGG - Intronic
1109187840 13:59291696-59291718 TACAGACCAGAAGACTCCCTTGG + Intergenic
1109897258 13:68709417-68709439 TATAGAACAGAAGAAAACCTTGG - Intergenic
1109971479 13:69775993-69776015 TACAAAAAAAAAAACTAGCTTGG + Intronic
1110134540 13:72049092-72049114 TATAGAACAGAAGTCTGGATGGG + Intergenic
1111376585 13:87386850-87386872 TAAAGTACAAAAGACTATCTGGG - Intergenic
1112697330 13:101965086-101965108 TACAGAAAAAAAAATTAGCTGGG + Intronic
1113145427 13:107202605-107202627 TAAAGAAAAGAAGACTGTCTAGG - Intronic
1113960020 13:114120961-114120983 TCCAGAGCCCAAGACTAGCTCGG - Intronic
1116336331 14:43661591-43661613 TCCAGAATTGCAGACTAGCTTGG + Intergenic
1122063059 14:99149527-99149549 TACAAAAAATAAGATTAGCTGGG + Intergenic
1126547110 15:49885831-49885853 TCCAGAAGTGAAGAATAGCTTGG - Intronic
1127641358 15:60918824-60918846 AACAGACCTGAAGACTAGCCTGG - Intronic
1127966674 15:63927903-63927925 AACAAAACAAAAAACTAGCTAGG - Intronic
1131419322 15:92291059-92291081 TACAGAACAGAATTCATGCTGGG - Intergenic
1132581863 16:688446-688468 TACAAAACAAAAAATTAGCTGGG - Intronic
1133073228 16:3260647-3260669 TACTGAACACATGTCTAGCTAGG + Intergenic
1134276049 16:12777090-12777112 TACAGAACAGAGGACTTCCCAGG + Intronic
1138938619 16:61761837-61761859 TACAAAAAATAAAACTAGCTGGG + Intronic
1139399847 16:66672768-66672790 AACAAAACAAAAAACTAGCTGGG - Intronic
1143039213 17:4020498-4020520 TACAAAAAATAAGACTAGCCAGG - Intronic
1143901967 17:10181197-10181219 TACAGTACAAAAAATTAGCTGGG + Intronic
1149747835 17:59116503-59116525 TACAGAACAGAAAAGGAGGTAGG - Intronic
1149967119 17:61175975-61175997 AAAATAACAGAAGATTAGCTGGG + Intronic
1151029060 17:70714173-70714195 TACAAAACACTAGACAAGCTTGG + Intergenic
1153945965 18:10017634-10017656 CACAGAACAGAAGCCTGGCCCGG - Intergenic
1158830016 18:61266303-61266325 TACAGAACTGCAGAATAGATAGG + Intergenic
1162149496 19:8634717-8634739 AACAAAACAGAAAATTAGCTGGG + Intergenic
1163499376 19:17666762-17666784 GACAGAACAGAGGACTATCCTGG - Intronic
1163891794 19:20023150-20023172 TACAGAGCACAACACTAGGTTGG - Intronic
1164074760 19:21804082-21804104 TACAAAACAGAAAATTAGCTGGG + Intergenic
1164214357 19:23130816-23130838 TACAGAACCAAATTCTAGCTAGG + Intronic
1164320617 19:24141592-24141614 TACTGAACAGAGTACTAGGTTGG + Intergenic
1164403308 19:27918689-27918711 TAAAGAACAGAAGCGTACCTGGG + Intergenic
1166099612 19:40563884-40563906 TACAGAACAAAAAATTAGCCAGG + Intronic
1166167339 19:41000876-41000898 TAAAAAACACAAAACTAGCTGGG + Intronic
925303698 2:2834873-2834895 TACTGAAAAGAAGACTGGATGGG + Intergenic
926922649 2:17954297-17954319 TACAGCCCCGAAGACTAGGTAGG - Intronic
927555323 2:24027009-24027031 TAGAGAACTGAAGAATCGCTTGG + Intronic
927829217 2:26333978-26334000 TACAAAAAAAAAAACTAGCTGGG - Intronic
927900910 2:26817594-26817616 TACAAAACAAAAAATTAGCTGGG - Intergenic
928971242 2:37031872-37031894 TAGATATCAGAAGACCAGCTAGG + Intronic
930040738 2:47121086-47121108 CACAGAACACAAGAAAAGCTGGG + Exonic
930957775 2:57224773-57224795 TACACTACAGAAGACTGACTGGG + Intergenic
931321168 2:61176103-61176125 TACAAAAAAAAAAACTAGCTGGG - Intergenic
931597440 2:63964719-63964741 AACTGAAGAAAAGACTAGCTTGG - Intronic
931903171 2:66813871-66813893 TAGAGAAAAGAAAACTAACTGGG - Intergenic
933879150 2:86651258-86651280 TACAGAAAAAAATATTAGCTGGG + Intronic
935104010 2:100022863-100022885 CACAGAACAACAGACAAGCTAGG + Intronic
935312210 2:101796127-101796149 GACAGGCCAGAAGACTAGATTGG - Intronic
935432990 2:102997934-102997956 TACAGTACAGAATTCTAGGTTGG + Intergenic
936012182 2:108931971-108931993 CACAGCCCAGAAGACCAGCTGGG + Intronic
937938943 2:127270186-127270208 TACAAAAAATAAAACTAGCTGGG - Intronic
938709899 2:133967240-133967262 TACAAAACAGAAAATTAGCCAGG - Intergenic
942122572 2:172792777-172792799 TACAGAAGTCAAGACTAGCTAGG - Intronic
942970400 2:181951165-181951187 TACTGAACTGAACTCTAGCTTGG + Intergenic
944989093 2:205214012-205214034 TAATGAACAGAAGACTAGGAGGG - Intronic
946349116 2:219136761-219136783 TAAAGATAAGAAAACTAGCTGGG - Intronic
947949310 2:234134119-234134141 TAGAGAAGAGGAGACCAGCTGGG + Intergenic
1170609979 20:17904720-17904742 TACATAACAGTAGAATTGCTGGG - Intergenic
1172079957 20:32332321-32332343 TAGAGAGCAGAAGAGTAGCTAGG + Exonic
1173083726 20:39894650-39894672 CACAGAAAAGAAACCTAGCTGGG + Intergenic
1173484226 20:43428617-43428639 AACAAAACAGAAAATTAGCTGGG - Intergenic
1174468144 20:50732810-50732832 TACAAAACAGGACACTGGCTGGG + Intronic
1175252854 20:57620129-57620151 TAAAGAATAGTAGACCAGCTGGG - Intronic
1175266625 20:57707429-57707451 CACAGAACACAGGACTAACTGGG + Intronic
1175555343 20:59849955-59849977 TACAAAACAAAAAATTAGCTGGG + Intergenic
1177931004 21:27283608-27283630 TACAGATCAGAAACCTAGATAGG + Intergenic
1180256225 21:46629910-46629932 TACAGAAAAAAAAATTAGCTGGG + Intergenic
1181657352 22:24314203-24314225 TACAAAAAACAAAACTAGCTGGG - Intronic
1182328711 22:29534796-29534818 TACAAAACAAAAAATTAGCTGGG + Intronic
1182687908 22:32135000-32135022 TAAAGATGAGAAGACAAGCTGGG - Intergenic
1183094339 22:35543079-35543101 CACACAGCAGATGACTAGCTGGG - Intronic
949784795 3:7728932-7728954 TACAAGAAAGAAGACCAGCTAGG - Intronic
950074802 3:10179863-10179885 TACAGAATAGAAAAATGGCTGGG - Intronic
950205511 3:11077132-11077154 TACAGATCAGAAAACTAGGGTGG + Intergenic
951251312 3:20396926-20396948 TACAGAACAGAATACCAGAGAGG - Intergenic
951753399 3:26061892-26061914 CACAGAACAGAAAACTAGCTGGG + Intergenic
954904205 3:54045823-54045845 ACCAGACCAGGAGACTAGCTTGG - Intergenic
955074074 3:55596416-55596438 TACAGAAAACAAAATTAGCTTGG + Intronic
956364674 3:68487589-68487611 TACAGAAAAAAAAATTAGCTGGG + Intronic
958705996 3:97656142-97656164 TACCAAACAGAAGGCTACCTTGG - Intronic
959956533 3:112244749-112244771 TACAGAACAGAAGACTAGCTAGG - Intronic
962067813 3:132001215-132001237 TAGAGAACAGAAGGTCAGCTAGG + Intronic
962798606 3:138870178-138870200 TACAAAACCGAAAATTAGCTGGG + Intergenic
964177666 3:153844440-153844462 AACAGAACAGAAAACAAGATGGG + Intergenic
967122191 3:186392000-186392022 TACAGATGAGAAGACAGGCTTGG - Intergenic
968498082 4:929556-929578 TAAAAAAGTGAAGACTAGCTAGG + Intronic
968534949 4:1118960-1118982 TACAGATCAAAAGCCAAGCTGGG - Intergenic
969233812 4:5851226-5851248 AAAAGAACAGAAGCCCAGCTGGG + Intronic
970433443 4:16010449-16010471 TAGAGAACAGAATGGTAGCTTGG + Intronic
970451206 4:16168271-16168293 TACAAAAAAGAAAATTAGCTGGG - Intronic
971361565 4:25942800-25942822 TTCAAACCAGGAGACTAGCTTGG - Intergenic
972731553 4:41800020-41800042 TACAAAACAAAAAATTAGCTGGG + Intergenic
972839673 4:42915580-42915602 TACAAAACAACAGAGTAGCTTGG + Intronic
973193409 4:47412737-47412759 CACAGACCAGAAGACCTGCTTGG - Intronic
973226087 4:47786378-47786400 TACAGAAAAAAAAATTAGCTGGG + Intronic
973769523 4:54193607-54193629 TACAAAATAGAAGAATAGATTGG + Intronic
973983151 4:56323635-56323657 TACAAAACAAAAGGCTAGCTGGG + Intronic
974376136 4:61078668-61078690 TACAAAAAAGAAAAATAGCTAGG + Intergenic
975760220 4:77612976-77612998 TACAGAAATAAAAACTAGCTGGG + Intergenic
976545561 4:86331359-86331381 AACAGAACATAGGACCAGCTTGG + Intronic
978531510 4:109719458-109719480 TAAAGAACAGAAGACTTGGAAGG + Intronic
979383366 4:120034966-120034988 AAGAGAACAGAAGATTATCTAGG - Intergenic
980139894 4:128902066-128902088 TACAAAACACAAGATTAGCCAGG - Intronic
980515522 4:133852911-133852933 TTCATAACAGAAGACAAGATAGG - Intergenic
982321632 4:154082944-154082966 TACAGTACTGAGGAGTAGCTTGG + Intergenic
982688779 4:158525082-158525104 TCCAGAACAGACCATTAGCTTGG + Intronic
982776978 4:159452160-159452182 TACACAACAGAATACTATTTAGG + Intergenic
982812172 4:159839713-159839735 TAAAAAACAGAAAACTAACTGGG - Intergenic
984382001 4:179006192-179006214 TTCAAAACAGAAGAGTAGCAGGG - Intergenic
984921686 4:184769994-184770016 CACAGAACGGAAGCCTCGCTGGG + Intronic
986683652 5:10256550-10256572 TACAAAACAAAAAACTAGCCAGG + Intronic
986736641 5:10673406-10673428 TGCAGAACAGCAGAATAGCATGG + Intergenic
987651958 5:20752809-20752831 TACAGAATAGAAAACTACTTTGG - Intergenic
988743605 5:34108669-34108691 TACAGAATAGAAAACTACTTTGG + Intronic
989164022 5:38417404-38417426 TACAGAGCTGAAGATTAGATGGG - Intronic
989473946 5:41852901-41852923 TACAGAAAACAAAAGTAGCTGGG + Intronic
990070426 5:51776274-51776296 TAGAAAACAGTAGATTAGCTGGG - Intergenic
990484423 5:56243650-56243672 TACAAAAAAGAAGATTGGCTGGG - Intergenic
992621470 5:78597648-78597670 TACAGAACAAAAGAAAAGTTGGG + Intronic
993206020 5:84879213-84879235 TACATAACAGAGGAATTGCTTGG + Intergenic
993382616 5:87224980-87225002 AACAAAACAAAAAACTAGCTAGG + Intergenic
995634975 5:114177430-114177452 TACAAAACAGCATATTAGCTGGG - Intergenic
995925062 5:117362342-117362364 TATAGAAGAGAAGACTGGCCGGG - Intergenic
996187331 5:120493069-120493091 TACAGAGCAGCAGAGTTGCTGGG + Intronic
996809643 5:127501762-127501784 TACAGACCAGAAGACTAGGAAGG + Intergenic
996992298 5:129650021-129650043 TACAGAAAAAAAAATTAGCTGGG + Intronic
997176184 5:131780389-131780411 CACAGAACAGAAGTCTATGTAGG + Intronic
997541095 5:134663222-134663244 TAAAGAACAAAAGATTAGCCAGG - Intronic
998193653 5:140047309-140047331 AAAAGAAAAGAAAACTAGCTGGG - Intergenic
998448042 5:142213366-142213388 TGAGGAACAGAAGACAAGCTGGG - Intergenic
999123013 5:149224519-149224541 CACTGAACAGAAGCCTGGCTTGG - Intronic
999958460 5:156727502-156727524 TATAGAACTGAAGAATACCTAGG + Intronic
1000331658 5:160210568-160210590 TGCAGAACAGAAGTCAAGGTGGG + Intronic
1001222927 5:169918329-169918351 TACTGAGCAGAAGAATCGCTGGG - Intronic
1001278548 5:170368886-170368908 CACAGAACAGAAGGCTGGTTTGG - Intronic
1001767307 5:174260708-174260730 TAGAGAAGAGAAGACTAAATGGG + Intergenic
1001962857 5:175890741-175890763 TGCAGCACAGCAGACTAGCCTGG + Intergenic
1002865688 6:1120127-1120149 TACACAACTGAAGAGAAGCTTGG + Intergenic
1002868628 6:1146299-1146321 CACGGACCAGAAGAGTAGCTGGG + Intergenic
1003817792 6:9861771-9861793 TACAGAAAAGGAGACTGGATTGG - Intronic
1006678728 6:35781904-35781926 TACAGAAAAAAAAATTAGCTGGG - Intronic
1006681912 6:35803285-35803307 AACAAAACAAAAAACTAGCTGGG + Intergenic
1007855720 6:44854340-44854362 TACAGACCAGAAGAGAAGCAAGG - Intronic
1009629959 6:66184203-66184225 TAGAGTACAGAGTACTAGCTAGG - Intergenic
1009650090 6:66464808-66464830 GACTGAAGAGAAGTCTAGCTAGG + Intergenic
1012071667 6:94627128-94627150 TAAACAACGGAAGACTTGCTGGG + Intergenic
1014983917 6:127979059-127979081 TACAGAAAAAAAGACAAGCTTGG + Intronic
1015139451 6:129913059-129913081 TACAGAAGAAAAGAAGAGCTTGG + Intergenic
1015530751 6:134219141-134219163 AACAGAAAAGAAAATTAGCTGGG - Intronic
1017831206 6:158131025-158131047 TACAAAACAGAAGAGTAGTGGGG + Intronic
1017970973 6:159312641-159312663 TACAGCAGAGAGGACTGGCTTGG - Intergenic
1020000082 7:4750601-4750623 TACAGAAAACAAAATTAGCTGGG - Intronic
1020236036 7:6356249-6356271 TACAAAAAAAAAGATTAGCTGGG + Intergenic
1020580555 7:9993962-9993984 TTAAGAAGAGAAGTCTAGCTAGG + Intergenic
1021539894 7:21745950-21745972 TACAGAAAAGAAGATCAGTTAGG + Intronic
1021753685 7:23830108-23830130 TACAAAACATAAAATTAGCTAGG - Intronic
1022427147 7:30279707-30279729 TACGGAAGTGAAGACTAGCTTGG - Intergenic
1022896321 7:34753407-34753429 TCAAGAACAGAAGACCAGCCAGG + Intronic
1026605031 7:71808530-71808552 TACCAAACAGAAGCCTTGCTGGG - Intronic
1028858743 7:95622674-95622696 TAAAGTACAGAAGACTAGGCAGG - Intergenic
1030174927 7:106642528-106642550 AACTGAAGAGAAGTCTAGCTGGG - Intergenic
1030418616 7:109278220-109278242 TAAAGAACAAAACACTAGTTAGG - Intergenic
1030555996 7:111024464-111024486 CAGAGCACAGAAGACTACCTGGG - Intronic
1031212897 7:118853841-118853863 TATATAAAAGAAGACTAGTTTGG - Intergenic
1031427505 7:121624005-121624027 CACAGAAAAGAAAGCTAGCTAGG + Intergenic
1035477522 7:159153700-159153722 TGGAGAACAGAAGGCAAGCTTGG + Intergenic
1038179704 8:25214849-25214871 TACAGCACAGAGGACCAGATGGG + Intronic
1039024741 8:33245443-33245465 AACAAAACAGAAGAGTTGCTTGG - Intergenic
1044976475 8:97670326-97670348 AACAAAACAAAAGACCAGCTTGG + Intronic
1045748966 8:105459205-105459227 AACAAAACAAAAAACTAGCTGGG - Intronic
1046136208 8:110030849-110030871 TACAGAACAGGAAAGTAGTTTGG + Intergenic
1047353340 8:124096705-124096727 TATAGAACAGAATCCTGGCTGGG + Intronic
1048989032 8:139750579-139750601 TAGAGAAGAGAGGACTTGCTGGG + Intronic
1049814099 8:144590061-144590083 TGCAGAACACAAGGCCAGCTTGG + Intronic
1050672841 9:8017207-8017229 TACAGAAGAGAAGACCACCTAGG - Intergenic
1051119305 9:13734412-13734434 TACAGAACAGAAGATGGGTTAGG - Intergenic
1051942228 9:22521637-22521659 TCCAGAACAAAAGACTATCCTGG + Intergenic
1052328060 9:27238512-27238534 TACAAAAAATAAAACTAGCTGGG + Intergenic
1053102786 9:35385249-35385271 TGCAGAACAGTAGAAGAGCTGGG + Intronic
1056118035 9:83460353-83460375 TTGAGAACAGAAGATGAGCTTGG - Intronic
1057460263 9:95254582-95254604 TACAGACCAGAAGATTCCCTTGG + Intronic
1058374634 9:104308374-104308396 TACAAAAGAAAAAACTAGCTGGG + Intergenic
1058908712 9:109501256-109501278 TACAGAAGAGAAAACAATCTAGG + Intergenic
1059878738 9:118666210-118666232 TACAGAACAGAGGATTAGTAAGG - Intergenic
1060986090 9:127819767-127819789 CTCAGAACACAAGACAAGCTTGG - Intronic
1062308770 9:135924491-135924513 TAAAAAACACGAGACTAGCTTGG + Intergenic
1187653413 X:21438713-21438735 TATAAGACAGAAGACAAGCTGGG + Intronic
1187930033 X:24285512-24285534 TACAAAACATAAAATTAGCTGGG - Intergenic
1187936699 X:24343279-24343301 TACAGAAAAGAGGGCTACCTTGG + Intergenic
1191820844 X:65305854-65305876 TACAGAACAGAAAACAGGTTCGG - Intergenic
1193115632 X:77772635-77772657 TACAAAAAAAAAAACTAGCTGGG - Intronic
1195519634 X:105816241-105816263 TACAAAAGAAAAGATTAGCTGGG - Intergenic
1197051502 X:122064284-122064306 TACAAAACAGAAAATTAGCCGGG + Intergenic
1197929797 X:131682465-131682487 TACCTTAAAGAAGACTAGCTGGG + Intergenic
1201457291 Y:14182653-14182675 TACAGAAGAGATTACTAGTTGGG - Intergenic