ID: 959956535

View in Genome Browser
Species Human (GRCh38)
Location 3:112244767-112244789
Sequence CTGTATCCACAGATGGAATT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959956530_959956535 20 Left 959956530 3:112244724-112244746 CCAACTTCCAGAATTTATGTTTC 0: 1
1: 0
2: 3
3: 59
4: 499
Right 959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG 0: 1
1: 0
2: 2
3: 18
4: 176
959956531_959956535 13 Left 959956531 3:112244731-112244753 CCAGAATTTATGTTTCACCCTAG 0: 1
1: 0
2: 0
3: 5
4: 150
Right 959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG 0: 1
1: 0
2: 2
3: 18
4: 176
959956533_959956535 -5 Left 959956533 3:112244749-112244771 CCTAGCTAGTCTTCTGTTCTGTA 0: 1
1: 0
2: 1
3: 9
4: 249
Right 959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG 0: 1
1: 0
2: 2
3: 18
4: 176
959956532_959956535 -4 Left 959956532 3:112244748-112244770 CCCTAGCTAGTCTTCTGTTCTGT 0: 1
1: 0
2: 1
3: 11
4: 194
Right 959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG 0: 1
1: 0
2: 2
3: 18
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959956535 Original CRISPR CTGTATCCACAGATGGAATT AGG Intronic
900475865 1:2876065-2876087 CTGCATCCGCAGAGGGAGTTGGG + Intergenic
905738891 1:40352186-40352208 CTGGGTCCACAGATGGACTTTGG - Intronic
911539969 1:99146468-99146490 CTGGATCCACAACTGCAATTTGG - Intergenic
912207595 1:107525579-107525601 GTGTATACACAGATGGAAGTTGG + Intergenic
921349297 1:214219163-214219185 CTGAACCCTCAGATGGAATGAGG + Intergenic
1063132507 10:3190328-3190350 CTGTATCAGCAGATGGAACGTGG + Intergenic
1064716006 10:18177290-18177312 CTTTATCCACAGAGGGTTTTGGG + Intronic
1065048632 10:21767264-21767286 GTGGATCCACAGAAAGAATTTGG + Intronic
1065735189 10:28745133-28745155 ATGTATTCACAGGTGGAATAGGG + Intergenic
1069778072 10:70938304-70938326 CTGGATCCTCAGATCGATTTGGG - Intergenic
1070012238 10:72487435-72487457 CTGTAACCACAGATGAAACATGG + Intronic
1070909771 10:80107845-80107867 CTGAATGCAAAGATGGAATGAGG + Intergenic
1071639129 10:87288266-87288288 CTGTTTCCTCAGCTGCAATTGGG - Intergenic
1071656108 10:87449683-87449705 CTGTTTCCTCAGCTGCAATTGGG + Intergenic
1073031965 10:100533688-100533710 CTGTAACAAGAGATTGAATTAGG - Intronic
1078351449 11:10598082-10598104 CTATATCCTCAGATGGAATTTGG - Intronic
1078550848 11:12279718-12279740 CTGTCTCCACACATGGAACTCGG + Intronic
1080579709 11:33632233-33632255 CTGTATCCACAGGTGGACTCTGG + Intronic
1080731124 11:34954363-34954385 CTGTGTACACAGATGAGATTAGG + Intronic
1081719638 11:45278701-45278723 CTGTACCCAAAGAAGGAACTAGG + Intronic
1084790016 11:71469043-71469065 CTGAATCCACAGATCAACTTAGG - Intronic
1084994142 11:72958888-72958910 CTGTTTCCATAGATGGAAATGGG - Intronic
1086075950 11:82852400-82852422 ATGTATACACTGATGGTATTAGG + Intronic
1086402035 11:86468902-86468924 CTGTTTCCAGAGAAGGAATCTGG + Intronic
1090101475 11:123801780-123801802 CTGTATTCAAAGAAGAAATTAGG - Intergenic
1092243704 12:6851227-6851249 GTGCATCCAGAGGTGGAATTGGG - Exonic
1092593270 12:9971388-9971410 CTGAAGCCACAGATGAGATTTGG + Intronic
1094427185 12:30327964-30327986 TTGGATCCACAGCTGCAATTTGG - Intergenic
1095107789 12:38256605-38256627 CAATCTCCACAGATTGAATTGGG - Intergenic
1098822417 12:75249685-75249707 ATGTATCCACAGAAGCAAATGGG - Intergenic
1100188998 12:92170625-92170647 CTGTAGCCATGGATGGAAGTGGG - Intergenic
1101919917 12:108924105-108924127 CTGTGTCCTCAGATGGCATAAGG - Intronic
1102879496 12:116473519-116473541 CTGTATCCTCACATGGAAGAAGG - Intergenic
1104176523 12:126338341-126338363 CTGTATCCACTGATGGTTATCGG + Intergenic
1106402442 13:29443323-29443345 CTGTGTCCCCTGATGCAATTGGG + Intronic
1107843739 13:44488859-44488881 CTGAATCTACAGATGAATTTGGG - Intronic
1110136504 13:72073777-72073799 CTGTATCCTCACATGGAAGCGGG - Intergenic
1110221867 13:73082376-73082398 ATCTAACCAAAGATGGAATTTGG - Intergenic
1111500434 13:89112842-89112864 ATATAACCACAAATGGAATTAGG - Intergenic
1112630151 13:101152129-101152151 CTGAAGCCACAGATAGAAATTGG + Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114173159 14:20295047-20295069 CTATATCCATAGTTGAAATTTGG - Intronic
1118182009 14:63503168-63503190 CTGTATGTACAGAGGGATTTTGG + Intronic
1126618223 15:50608547-50608569 CTGTCTCCACTGATGAAAATAGG - Intronic
1127003141 15:54533807-54533829 ATGTGTCCACAGTTGGGATTGGG + Intronic
1127066511 15:55245217-55245239 CTGTCTCCACTTATGGAAATGGG - Intronic
1128458521 15:67847941-67847963 CTGTATCCACATGTGGAGGTAGG + Intergenic
1134078513 16:11308886-11308908 CTGGGTCCACAGCTGCAATTTGG + Intronic
1136991749 16:35156310-35156332 CTGAATCCACAGATTGCTTTGGG + Intergenic
1138539843 16:57681200-57681222 ATGTATCCACAGGGGGAATCTGG - Intronic
1146014253 17:29219781-29219803 TTGTATCCACGGATGAAAATAGG - Intergenic
1146372082 17:32271107-32271129 CTGAATCAACAGAAGGAATCAGG - Intronic
1147723765 17:42554187-42554209 TTGTAGCCTCAGATGGATTTGGG + Intronic
1148029003 17:44607289-44607311 CTTTATCCACAGATGGGCATTGG - Intergenic
1151401111 17:73856753-73856775 CTCTCTCCACAGATGTAATCAGG + Intergenic
1158578062 18:58657120-58657142 CTGTATCCACAGGAACAATTTGG + Intergenic
1167027414 19:46931020-46931042 CAGTACCTACAGAGGGAATTAGG + Intronic
1168112054 19:54198386-54198408 CTGTAACCCCAGGTGGGATTTGG - Intergenic
926776779 2:16430962-16430984 CTGTATCCACTGCTGAAGTTAGG + Intergenic
928906477 2:36373517-36373539 CTGTACCCAAAGATGGCACTTGG + Intronic
929106925 2:38374758-38374780 CTTTTTCCACAGTTGGTATTAGG - Intronic
930351382 2:50259958-50259980 CTGCATGTACAGATGAAATTGGG + Intronic
931175194 2:59847367-59847389 CTGATTCCACAGCTGGAAATTGG - Intergenic
931197770 2:60069104-60069126 GTGTCTCCACAGATAGACTTGGG + Intergenic
933754667 2:85628838-85628860 CTTTAACCACAGAGGGGATTAGG - Intronic
934051117 2:88211845-88211867 CTGTCTCTCCAGATGCAATTGGG - Intergenic
935233868 2:101121663-101121685 CTGTTTCAACATATGGATTTGGG + Intronic
935614690 2:105065043-105065065 CTGTCTCCACTGATAGAATGAGG + Intronic
935845187 2:107158421-107158443 CAGTATGAAAAGATGGAATTGGG - Intergenic
937888790 2:126919231-126919253 CGGTATCCAGAGATTGTATTGGG + Intergenic
939081362 2:137665299-137665321 TTTTATCCATGGATGGAATTTGG + Intronic
940492551 2:154382153-154382175 CTGTGTCCATAGAGGGGATTGGG - Intronic
942013177 2:171785392-171785414 CTGTATCCACCGATGTGATCAGG + Exonic
942590352 2:177538160-177538182 CTGTTTCCAAAGATGTTATTGGG - Exonic
947017327 2:225635730-225635752 CTGCATTTATAGATGGAATTTGG + Intronic
947109964 2:226708068-226708090 TTATATCCACAGAGGGACTTGGG - Intergenic
948201337 2:236131465-236131487 GTGTATCCACAGATGGGTTTAGG + Exonic
1168814402 20:727046-727068 CTCTACCCACAGATGAACTTGGG + Intergenic
1169363874 20:4975234-4975256 CTGCATTCCCAGAAGGAATTGGG - Intronic
1169958443 20:11131855-11131877 CAGTATCCTCAGATGGAATGAGG + Intergenic
1170173702 20:13443364-13443386 CTATATCCACAGAGGGAACTGGG + Intronic
1170324814 20:15145177-15145199 CTGTATTCACAGATGACATTTGG + Intronic
1170550861 20:17474845-17474867 CTGAGCCCACAGATGGAATGAGG + Intronic
1171371735 20:24666764-24666786 CTGTGTCCACTGAGGGGATTAGG - Intergenic
1172992483 20:39046862-39046884 GTTCATGCACAGATGGAATTCGG + Intergenic
1183725601 22:39587557-39587579 CTGTGGCCACAGGTGGAATGAGG + Intronic
1184142728 22:42587685-42587707 CTGGCTCCACAGATGGAGATGGG + Intronic
1184887495 22:47355338-47355360 GAGTAGCCACAGATGGCATTTGG + Intergenic
950067297 3:10123259-10123281 CTGTTTTCACAGATGGAATGTGG + Intronic
951649310 3:24932020-24932042 AGGTATCCAAAGATGGAACTTGG - Intergenic
952732093 3:36649373-36649395 CTGTAATAACAGATGGAATGAGG - Intergenic
952996181 3:38884678-38884700 CTATATCCACTCAAGGAATTAGG + Intronic
953522669 3:43657845-43657867 CTGCTTTCAAAGATGGAATTTGG - Intronic
953735095 3:45487143-45487165 CTGTAACCACAGAATGTATTTGG - Intronic
954253409 3:49386141-49386163 CTGAATCTACAGATCGATTTGGG + Intronic
957816636 3:85308623-85308645 CTATTTCCACAGGTGGTATTGGG - Intronic
959473623 3:106783425-106783447 CTGTCTTAACAGATTGAATTTGG - Intergenic
959581086 3:107983341-107983363 CTGGGACCAAAGATGGAATTAGG - Intergenic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960175124 3:114508588-114508610 CTATATCTAAAGATGGACTTTGG + Intronic
962742334 3:138370860-138370882 CTGGATCCACACCTGGCATTAGG + Intronic
963067002 3:141271928-141271950 CTGTCGCCACAGAAGGAAGTGGG + Intronic
963351811 3:144160844-144160866 CTGTATCCACAGTTAGAATGTGG + Intergenic
963398411 3:144763811-144763833 TTGTATGCCCAGATGGAATATGG - Intergenic
965761248 3:172079342-172079364 CTTTCTCCAAAGATGGAGTTTGG + Intronic
968569267 4:1331100-1331122 TTGTCTCCAGAGATGGAATGAGG + Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969406025 4:6992333-6992355 GTGTATTCACAGATGATATTGGG + Intronic
970008465 4:11432359-11432381 CTTTATCCACAAAGGAAATTGGG + Intergenic
970067295 4:12113128-12113150 CAATATCCAAAGATGGAATCAGG - Intergenic
971490533 4:27207753-27207775 CAGTATCTAGAGATGGAATCAGG + Intergenic
971606250 4:28661618-28661640 CTGTATCCCCAGAGGGGAGTAGG - Intergenic
973718925 4:53704090-53704112 CTGTATCAACAGTTGTACTTCGG + Intronic
975525484 4:75344196-75344218 CAGTATCCAAAGATGACATTGGG + Intergenic
976399924 4:84596059-84596081 CTCTATCCCCAAATGGAATCGGG - Intronic
979553604 4:122019348-122019370 CTGTATTCACAGACTGTATTGGG - Intergenic
980750196 4:137077506-137077528 CTGGATCCACAGCTGCAGTTTGG + Intergenic
980985710 4:139692350-139692372 CTGTATTCCCAGAAGGAATTGGG - Intronic
981305376 4:143241524-143241546 CTGTATCCAGGGATAGAATGGGG + Intergenic
981813170 4:148798694-148798716 CTGATTCCACAGAGGGCATTGGG + Intergenic
983552626 4:169032989-169033011 CTGTTTCCACAGGTGTAAATTGG - Intergenic
985885498 5:2674478-2674500 CTGTATCCACCCATGGTCTTGGG - Intergenic
986378227 5:7155493-7155515 CTGGCTCCACAGAGTGAATTAGG + Intergenic
987161023 5:15142834-15142856 CTGTATCCTCAGATTCAATCAGG + Intergenic
987692268 5:21282605-21282627 CTGAATGCAAAGATGGAATGAGG - Intergenic
987811582 5:22843228-22843250 GTGTTTTCACAGATAGAATTGGG - Intronic
990265677 5:54072350-54072372 GTTTATCCACAGCTGCAATTAGG - Intronic
990928480 5:61057486-61057508 ATGTATTCACAGATGGACTGGGG + Intronic
991632273 5:68668027-68668049 ATGGAACCACAGATGGAGTTAGG - Intergenic
991748092 5:69767446-69767468 CTGAATGCAAAGATGGAATGAGG + Intergenic
991799672 5:70347293-70347315 CTGAATGCAAAGATGGAATGAGG + Intergenic
991828925 5:70662745-70662767 CTGAATGCAAAGATGGAATGAGG - Intergenic
991892030 5:71346722-71346744 CTGAATGCAAAGATGGAATGAGG + Intergenic
991949157 5:71931256-71931278 CTGTCTCCAAAGATGAATTTGGG + Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
996081223 5:119260459-119260481 CTGTATCCTCACATGGTCTTTGG - Intergenic
996925214 5:128817280-128817302 CTGTTTTCATAGATTGAATTGGG - Intronic
998099370 5:139419368-139419390 CTGTCTCCAGAGAGGGAAATAGG + Intronic
998402546 5:141855541-141855563 CTCTATCCTCAGATGAAATTGGG + Intronic
999897042 5:156045851-156045873 CTGTAGCCACAGTGGGAGTTAGG + Intronic
1001577535 5:172773914-172773936 CTGTAACCACAGAAGGAGTGAGG + Intergenic
1003810002 6:9768557-9768579 CAGAGTCCAGAGATGGAATTAGG - Intronic
1004399161 6:15272570-15272592 TTGTTTCCACAGCTGCAATTTGG - Intronic
1005592718 6:27345449-27345471 CAGTATCCATAGCTGGAGTTTGG + Intergenic
1008795167 6:55294169-55294191 CTGTATGCAAAGATGGGACTCGG - Intergenic
1010388154 6:75306009-75306031 CTGTCTTCACAAATGGAAGTTGG + Intronic
1012466479 6:99521717-99521739 CTGCATCCACAGATAAAAGTTGG - Intronic
1012960482 6:105616661-105616683 CTGTCCCCACAGATGGAATGAGG - Intergenic
1015389726 6:132668004-132668026 ATGTCTCCACATGTGGAATTTGG + Intergenic
1016074272 6:139777562-139777584 CAGTATCACCAGAGGGAATTGGG + Intergenic
1017207546 6:151819772-151819794 ATTTTTCCACAGATGGAACTGGG - Intronic
1018789246 6:167133671-167133693 TTGTATCTACAGATCGATTTGGG + Intronic
1020390638 7:7654299-7654321 CTGTATTCAGTGATGGAAATAGG + Intronic
1020612126 7:10411564-10411586 GTGTAACATCAGATGGAATTTGG + Intergenic
1021336913 7:19414621-19414643 TTGGATCCACAGATTGAATTAGG + Intergenic
1022171500 7:27836341-27836363 CTGTCCCCTCTGATGGAATTAGG + Intronic
1023597032 7:41840899-41840921 CTGAATCCACAGATCAAGTTGGG + Intergenic
1024007393 7:45236735-45236757 ATGTATGCAGAGATGGACTTTGG + Intergenic
1025161745 7:56667183-56667205 CTGTCTCCACAGTTGGAATTGGG + Intergenic
1025223915 7:57140105-57140127 CTCTCTCCACAGTTGGAATTGGG + Intergenic
1025745745 7:64241314-64241336 CTGTCTCCACAATTGGGATTGGG - Intronic
1025927241 7:65969994-65970016 CTGTTTTCACAGATGGTCTTTGG - Intronic
1026319152 7:69253956-69253978 CTGTATCCACTGCTGTCATTTGG + Intergenic
1027711371 7:81605641-81605663 CTGTGTTCACAGATCGAATTCGG + Intergenic
1028876082 7:95824834-95824856 CGGTTTACACAGAAGGAATTCGG + Intronic
1029045818 7:97627105-97627127 CTCTCTCCACAGACGGAAGTAGG - Intergenic
1029321357 7:99763455-99763477 CTGTATCCACATATGGACACAGG - Intronic
1029804427 7:102981692-102981714 CTGTGTCCACACATGGCAGTAGG + Intronic
1029819573 7:103132932-103132954 CTGTTTCCACAGATTGATTGGGG - Intronic
1030695258 7:112578090-112578112 CTGTATCCACTGATGGTGATAGG - Intergenic
1030750967 7:113232315-113232337 CTGTTTCCACATATGTAATATGG - Intergenic
1030906524 7:115190270-115190292 CTATTTCCACAGATAAAATTTGG - Intergenic
1034433419 7:151051971-151051993 CTGTCTCCACAGGTGACATTGGG + Exonic
1035028993 7:155845074-155845096 CTGTGACCACAGATAGAAATCGG - Intergenic
1036545266 8:9762600-9762622 CTGTAACAACAGATAAAATTGGG + Intronic
1036911754 8:12763376-12763398 CTGTATCCCCACATGGAAGAAGG + Intergenic
1042396981 8:68304285-68304307 ATGTATCCAGAAGTGGAATTGGG - Exonic
1043378210 8:79673644-79673666 CTGTTTCCTCAGATGTAAATTGG + Intergenic
1045338253 8:101228237-101228259 CTTTGTCCACGGATGAAATTTGG - Intergenic
1045420242 8:102007414-102007436 ATGTATCAACTGATGAAATTCGG - Intronic
1045440605 8:102205217-102205239 CAGTATCTACAAATGAAATTTGG + Exonic
1046582392 8:116109584-116109606 TTGTATACACAGATATAATTAGG + Intergenic
1047853835 8:128888397-128888419 CTGTAACTACAGTAGGAATTAGG + Intergenic
1049952354 9:657644-657666 CTGTAACCAGAGACTGAATTTGG - Intronic
1050856685 9:10366192-10366214 CTGTATTTACAGATGGCATAGGG - Intronic
1052601776 9:30642274-30642296 CTGTTTCCACACAAGAAATTTGG - Intergenic
1053227744 9:36375526-36375548 CTGTATCCTCAAAGGCAATTAGG - Intronic
1055696465 9:78890238-78890260 CTGTATCCAGACATTGCATTTGG - Intergenic
1056964313 9:91153251-91153273 ATGTATCCACAGGAGCAATTGGG + Intergenic
1203624679 Un_KI270750v1:2766-2788 CTTTAACCATAGAAGGAATTTGG - Intergenic
1185815592 X:3152190-3152212 ATGGAACCACTGATGGAATTTGG - Intergenic
1187499996 X:19831826-19831848 ATGTGTCCCCAGATGGAATTGGG - Intronic
1187830192 X:23373449-23373471 CTATATCCACAGCTTAAATTTGG + Intronic
1188254677 X:27947073-27947095 CGGTAATCACAGATGCAATTCGG + Intergenic
1190969776 X:55337252-55337274 ATGTATCCACAGAAGTAGTTTGG - Intergenic
1192116693 X:68418395-68418417 CTGTGTGCAAAGATGGTATTAGG + Intronic
1199473995 X:148226137-148226159 CTGGTTCCTCAGATGGAGTTAGG + Intergenic