ID: 959961255

View in Genome Browser
Species Human (GRCh38)
Location 3:112302004-112302026
Sequence TCCCTGTGTTGAGGGGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959961255_959961260 8 Left 959961255 3:112302004-112302026 CCAGCACCCCCTCAACACAGGGA No data
Right 959961260 3:112302035-112302057 ACAAATTTTCCTTTGCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959961255 Original CRISPR TCCCTGTGTTGAGGGGGTGC TGG (reversed) Intergenic
No off target data available for this crispr