ID: 959961916

View in Genome Browser
Species Human (GRCh38)
Location 3:112307026-112307048
Sequence TGTTATTTCTACTAGTTACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959961916_959961918 1 Left 959961916 3:112307026-112307048 CCACGTAACTAGTAGAAATAACA No data
Right 959961918 3:112307050-112307072 CAGCCCTGCTGTGGCCACTCCGG No data
959961916_959961917 -8 Left 959961916 3:112307026-112307048 CCACGTAACTAGTAGAAATAACA No data
Right 959961917 3:112307041-112307063 AAATAACAGCAGCCCTGCTGTGG No data
959961916_959961925 23 Left 959961916 3:112307026-112307048 CCACGTAACTAGTAGAAATAACA No data
Right 959961925 3:112307072-112307094 GAGGCTGGCCAGTCTATGCACGG No data
959961916_959961920 4 Left 959961916 3:112307026-112307048 CCACGTAACTAGTAGAAATAACA No data
Right 959961920 3:112307053-112307075 CCCTGCTGTGGCCACTCCGGAGG No data
959961916_959961922 8 Left 959961916 3:112307026-112307048 CCACGTAACTAGTAGAAATAACA No data
Right 959961922 3:112307057-112307079 GCTGTGGCCACTCCGGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959961916 Original CRISPR TGTTATTTCTACTAGTTACG TGG (reversed) Intergenic
No off target data available for this crispr