ID: 959961919

View in Genome Browser
Species Human (GRCh38)
Location 3:112307053-112307075
Sequence CCTCCGGAGTGGCCACAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959961919_959961925 -4 Left 959961919 3:112307053-112307075 CCCTGCTGTGGCCACTCCGGAGG No data
Right 959961925 3:112307072-112307094 GAGGCTGGCCAGTCTATGCACGG No data
959961919_959961927 9 Left 959961919 3:112307053-112307075 CCCTGCTGTGGCCACTCCGGAGG No data
Right 959961927 3:112307085-112307107 CTATGCACGGCAGAAGCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959961919 Original CRISPR CCTCCGGAGTGGCCACAGCA GGG (reversed) Intergenic