ID: 959961921

View in Genome Browser
Species Human (GRCh38)
Location 3:112307054-112307076
Sequence GCCTCCGGAGTGGCCACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959961921_959961927 8 Left 959961921 3:112307054-112307076 CCTGCTGTGGCCACTCCGGAGGC No data
Right 959961927 3:112307085-112307107 CTATGCACGGCAGAAGCTTGAGG No data
959961921_959961925 -5 Left 959961921 3:112307054-112307076 CCTGCTGTGGCCACTCCGGAGGC No data
Right 959961925 3:112307072-112307094 GAGGCTGGCCAGTCTATGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959961921 Original CRISPR GCCTCCGGAGTGGCCACAGC AGG (reversed) Intergenic
No off target data available for this crispr