ID: 959961925

View in Genome Browser
Species Human (GRCh38)
Location 3:112307072-112307094
Sequence GAGGCTGGCCAGTCTATGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959961921_959961925 -5 Left 959961921 3:112307054-112307076 CCTGCTGTGGCCACTCCGGAGGC No data
Right 959961925 3:112307072-112307094 GAGGCTGGCCAGTCTATGCACGG No data
959961919_959961925 -4 Left 959961919 3:112307053-112307075 CCCTGCTGTGGCCACTCCGGAGG No data
Right 959961925 3:112307072-112307094 GAGGCTGGCCAGTCTATGCACGG No data
959961916_959961925 23 Left 959961916 3:112307026-112307048 CCACGTAACTAGTAGAAATAACA No data
Right 959961925 3:112307072-112307094 GAGGCTGGCCAGTCTATGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959961925 Original CRISPR GAGGCTGGCCAGTCTATGCA CGG Intergenic
No off target data available for this crispr