ID: 959962313

View in Genome Browser
Species Human (GRCh38)
Location 3:112312426-112312448
Sequence TCCTTATGTTGAGAGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959962313_959962314 8 Left 959962313 3:112312426-112312448 CCAGCACTCTCTCAACATAAGGA No data
Right 959962314 3:112312457-112312479 ACAAATTTTCCTTTGTTTTATGG 0: 26
1: 17
2: 18
3: 83
4: 931

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959962313 Original CRISPR TCCTTATGTTGAGAGAGTGC TGG (reversed) Intergenic
No off target data available for this crispr