ID: 959963884

View in Genome Browser
Species Human (GRCh38)
Location 3:112332565-112332587
Sequence GGAGTCTCGCTCTGTGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265974
Summary {0: 18, 1: 1484, 2: 33479, 3: 88856, 4: 142137}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959963884_959963889 13 Left 959963884 3:112332565-112332587 CCTGGACCACAGAGCGAGACTCC 0: 18
1: 1484
2: 33479
3: 88856
4: 142137
Right 959963889 3:112332601-112332623 GAAGAAGGAGAAGAAGGAGAAGG 0: 43
1: 343
2: 1707
3: 4803
4: 11143
959963884_959963890 19 Left 959963884 3:112332565-112332587 CCTGGACCACAGAGCGAGACTCC 0: 18
1: 1484
2: 33479
3: 88856
4: 142137
Right 959963890 3:112332607-112332629 GGAGAAGAAGGAGAAGGAGAAGG 0: 42
1: 433
2: 1903
3: 4832
4: 14105
959963884_959963891 20 Left 959963884 3:112332565-112332587 CCTGGACCACAGAGCGAGACTCC 0: 18
1: 1484
2: 33479
3: 88856
4: 142137
Right 959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG 0: 3
1: 38
2: 202
3: 1151
4: 5083
959963884_959963888 7 Left 959963884 3:112332565-112332587 CCTGGACCACAGAGCGAGACTCC 0: 18
1: 1484
2: 33479
3: 88856
4: 142137
Right 959963888 3:112332595-112332617 GAAGAAGAAGAAGGAGAAGAAGG 0: 31
1: 510
2: 1581
3: 4255
4: 10596
959963884_959963887 -2 Left 959963884 3:112332565-112332587 CCTGGACCACAGAGCGAGACTCC 0: 18
1: 1484
2: 33479
3: 88856
4: 142137
Right 959963887 3:112332586-112332608 CCGTCTCAAGAAGAAGAAGAAGG 0: 1
1: 2
2: 10
3: 109
4: 1040

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959963884 Original CRISPR GGAGTCTCGCTCTGTGGTCC AGG (reversed) Intronic
Too many off-targets to display for this crispr