ID: 959963891

View in Genome Browser
Species Human (GRCh38)
Location 3:112332608-112332630
Sequence GAGAAGAAGGAGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6477
Summary {0: 3, 1: 38, 2: 202, 3: 1151, 4: 5083}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959963884_959963891 20 Left 959963884 3:112332565-112332587 CCTGGACCACAGAGCGAGACTCC 0: 18
1: 1484
2: 33479
3: 88856
4: 142137
Right 959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG 0: 3
1: 38
2: 202
3: 1151
4: 5083
959963883_959963891 24 Left 959963883 3:112332561-112332583 CCAGCCTGGACCACAGAGCGAGA 0: 30
1: 2430
2: 51528
3: 155797
4: 230123
Right 959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG 0: 3
1: 38
2: 202
3: 1151
4: 5083
959963886_959963891 -1 Left 959963886 3:112332586-112332608 CCGTCTCAAGAAGAAGAAGAAGG 0: 3
1: 2
2: 35
3: 360
4: 3862
Right 959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG 0: 3
1: 38
2: 202
3: 1151
4: 5083
959963885_959963891 14 Left 959963885 3:112332571-112332593 CCACAGAGCGAGACTCCGTCTCA 0: 452
1: 1147
2: 2211
3: 2450
4: 2239
Right 959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG 0: 3
1: 38
2: 202
3: 1151
4: 5083

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959963891 Original CRISPR GAGAAGAAGGAGAAGGAGAA GGG Intronic
Too many off-targets to display for this crispr