ID: 959969745

View in Genome Browser
Species Human (GRCh38)
Location 3:112396291-112396313
Sequence ATGCATGTCAAGAAGTAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959969745_959969750 30 Left 959969745 3:112396291-112396313 CCCTTCTACTTCTTGACATGCAT No data
Right 959969750 3:112396344-112396366 TAAAATAAATGTACCTCAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959969745 Original CRISPR ATGCATGTCAAGAAGTAGAA GGG (reversed) Intergenic
No off target data available for this crispr