ID: 959973663

View in Genome Browser
Species Human (GRCh38)
Location 3:112434470-112434492
Sequence CAGTTTACTCAACTGAAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959973656_959973663 27 Left 959973656 3:112434420-112434442 CCATCAGCTGCTTTCCAAAACAT No data
Right 959973663 3:112434470-112434492 CAGTTTACTCAACTGAAAGATGG No data
959973657_959973663 13 Left 959973657 3:112434434-112434456 CCAAAACATGTTCTTGTACCAGT No data
Right 959973663 3:112434470-112434492 CAGTTTACTCAACTGAAAGATGG No data
959973659_959973663 -10 Left 959973659 3:112434457-112434479 CCCCTCTGAGCCTCAGTTTACTC 0: 10
1: 451
2: 2152
3: 5645
4: 10137
Right 959973663 3:112434470-112434492 CAGTTTACTCAACTGAAAGATGG No data
959973658_959973663 -5 Left 959973658 3:112434452-112434474 CCAGTCCCCTCTGAGCCTCAGTT No data
Right 959973663 3:112434470-112434492 CAGTTTACTCAACTGAAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959973663 Original CRISPR CAGTTTACTCAACTGAAAGA TGG Intergenic
No off target data available for this crispr