ID: 959978086

View in Genome Browser
Species Human (GRCh38)
Location 3:112484189-112484211
Sequence ATTGATACACAACTGGATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 283}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959978084_959978086 4 Left 959978084 3:112484162-112484184 CCAGGAATCTCATGATAGATTTA 0: 1
1: 0
2: 0
3: 14
4: 162
Right 959978086 3:112484189-112484211 ATTGATACACAACTGGATCATGG 0: 1
1: 0
2: 0
3: 8
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959978086 Original CRISPR ATTGATACACAACTGGATCA TGG Intronic
902568246 1:17329979-17330001 CTTAAGAAACAACTGGATCATGG - Intronic
906744128 1:48209660-48209682 ATTCATACAAAACTGTATCCAGG - Intergenic
907503190 1:54898547-54898569 ATTCATACAAAACTGTATCCAGG - Intergenic
908378658 1:63573351-63573373 ATTCATACAGAACTGTATCCAGG - Intronic
909730220 1:78880221-78880243 ATTCATACAAAACTGCATCCAGG + Intergenic
909776290 1:79489263-79489285 ATTCATACAAAACTGTATCCAGG - Intergenic
909787881 1:79639413-79639435 ATTCATACAAAACTGTATCCAGG - Intergenic
911750284 1:101488649-101488671 ATTAATACAGAATTGGATAAAGG - Intergenic
911815068 1:102339095-102339117 AGTAATTCACCACTGGATCAGGG - Intergenic
912296844 1:108477963-108477985 ATTCATACAAAACTGTATCTAGG + Intergenic
913095179 1:115509790-115509812 ATTCATACAAAACTGCATCCAGG - Intergenic
913245631 1:116867775-116867797 ATTCATACAAAACTGCATCCAGG + Intergenic
913550100 1:119908864-119908886 ATTCATACCCATCTGGGTCATGG - Intergenic
915747063 1:158170307-158170329 ATTGATACAAAACTAGAACTTGG + Intergenic
919420470 1:197364139-197364161 ATGGAGACAAAACTGGATGAGGG - Intronic
921509662 1:216013189-216013211 ATTCATACAAAACTGTATCCAGG + Intronic
921765769 1:218971437-218971459 ACAGATACAGACCTGGATCATGG - Intergenic
922935280 1:229417950-229417972 ATTCATACAAAACTGTATCCAGG + Intergenic
1065077734 10:22097996-22098018 AAGGAAACACTACTGGATCATGG - Intergenic
1065890727 10:30119037-30119059 ATTCATTCAAAACTGCATCAAGG - Intergenic
1068522692 10:58094722-58094744 ATTCATACAAAACTGCATCCAGG - Intergenic
1068694886 10:59957001-59957023 CTTGGTACACCACTGGATGATGG + Exonic
1073014592 10:100387775-100387797 ATTCATACAAAACTGCATCCAGG + Intergenic
1074741193 10:116485840-116485862 ATTCATACAAAACTGTATCCAGG + Intergenic
1075803346 10:125166970-125166992 ATGGAGACACGACTGGATGAGGG - Intergenic
1077813373 11:5661138-5661160 ATTGATACTGAATAGGATCAAGG + Intergenic
1078045756 11:7912845-7912867 ATTCATACAAAACTGTATCCAGG - Intergenic
1079254763 11:18818532-18818554 ATTCAGATTCAACTGGATCATGG + Intergenic
1079726695 11:23887880-23887902 ATTCATACAAAACTGTATCCAGG - Intergenic
1081085254 11:38791507-38791529 ATTGATGTACAACTGGTCCAGGG - Intergenic
1084232685 11:67764685-67764707 ATTCATACAAAACTGTATCCAGG + Intergenic
1084243916 11:67842529-67842551 ATTCATACAAAACTGTATCCAGG - Intergenic
1084330851 11:68429368-68429390 ATTGACACACAAATGGATGCCGG - Intronic
1084355939 11:68638722-68638744 ATTCATACAAAACTGTATCCAGG + Intergenic
1084828771 11:71752031-71752053 ATTCATACAAAACTGTATCCAGG + Intergenic
1086427282 11:86697685-86697707 ATTAATTCAAAAATGGATCATGG + Intergenic
1087100054 11:94354869-94354891 ATTCATACAAAACTGTATCCAGG + Intergenic
1087128206 11:94646633-94646655 ATTTATACAAAACTGTATCCAGG + Intergenic
1087270953 11:96111104-96111126 ATTGATGCAGAGATGGATCAAGG - Intronic
1087702051 11:101445832-101445854 CATGAAAGACAACTGGATCATGG + Intergenic
1089470670 11:118717690-118717712 ATTCATACAAAACTGTATCCAGG - Intergenic
1089988063 11:122832143-122832165 ATTCATACAGAACTGTATCCAGG + Intergenic
1090526378 11:127543209-127543231 ATTCATACAAAACTGTATCCAGG - Intergenic
1090546069 11:127769567-127769589 ATTCATACAAAACTGTATCCAGG - Intergenic
1091256741 11:134194518-134194540 ATTCATATACAACAGGATCAGGG + Intronic
1092474868 12:8809904-8809926 ATTCATACAAAACTGTATCCAGG + Intergenic
1093269204 12:17038030-17038052 AATGATACACACTGGGATCAAGG - Intergenic
1093303020 12:17477793-17477815 ATTCATACAAAACTGCATCCAGG + Intergenic
1093459499 12:19395547-19395569 ATTGCTGCACAACTGGAGCAGGG - Intergenic
1093579192 12:20768338-20768360 ATTAATACAAAACTGTATCCAGG + Intergenic
1095538830 12:43284657-43284679 AATGAAACAGAACTGGATCTTGG - Intergenic
1098920385 12:76297102-76297124 ATTCATACAAAACTGCATCCAGG + Intergenic
1100561744 12:95754188-95754210 ATTCATACAAAACTGTATCCAGG + Intronic
1101169440 12:102074620-102074642 ATTGATACGCAGCTGAAACATGG + Intronic
1102116303 12:110405710-110405732 ATTCATACAAAACTGCATCCAGG - Intergenic
1102894993 12:116591826-116591848 CTTCAGGCACAACTGGATCAAGG - Intergenic
1103369098 12:120404661-120404683 ACTGATTTACAACTGGATCAAGG - Intergenic
1105910467 13:24860792-24860814 TTTGATACACTATTGGATGAGGG + Intronic
1106073579 13:26437360-26437382 ATTGGTACACAACAGAATGAAGG + Intergenic
1107103238 13:36616879-36616901 GTAGTTAAACAACTGGATCAAGG + Intergenic
1107219866 13:37969656-37969678 ATTCATACAAAACTGTATCCAGG - Intergenic
1108281585 13:48867337-48867359 ATTCATACAAAACTGTATCCAGG - Intergenic
1109344014 13:61093758-61093780 ATTCATACAGAACTGTATCCAGG + Intergenic
1110845802 13:80189260-80189282 ATTCATACAAAACTGTATCCAGG + Intergenic
1111217149 13:85159379-85159401 ATTGATACAGAAGTGGGGCAGGG + Intergenic
1111491288 13:88979046-88979068 ATTGATATACAATGGAATCAAGG - Intergenic
1111992887 13:95134334-95134356 ATAAATACATAACGGGATCAAGG + Intronic
1112768982 13:102774676-102774698 ATTCATACACAAGAGGTTCACGG - Intergenic
1114961698 14:27899564-27899586 ATTCATACAGATCTGGTTCATGG + Intergenic
1116573840 14:46548938-46548960 ATTCATACAAAACTGTATCCAGG + Intergenic
1116702915 14:48263049-48263071 ATTCATACAAAACTGTATCCAGG - Intergenic
1117174779 14:53134853-53134875 ATTCATACAAAACTGCATCCAGG + Intronic
1117957491 14:61133891-61133913 ATTCATACAAAACTGTATCCAGG - Intergenic
1118596591 14:67440435-67440457 CTTGATCCACTGCTGGATCATGG + Intergenic
1119022799 14:71129329-71129351 ATTCATACAAAACTGTATCCAGG + Intergenic
1120255346 14:82111881-82111903 ATAGATACAAAAATGGATCTAGG - Intergenic
1123141850 14:106087620-106087642 ATTCATACACCACCGAATCAGGG + Intergenic
1126178825 15:45765190-45765212 ATTGCTACACAACGGGAGCAAGG - Intergenic
1131120279 15:89818395-89818417 ATTGATAAACGACTTGAACACGG - Intergenic
1131956391 15:97740530-97740552 ATTGATACAGAACAGGCACATGG - Intergenic
1132263453 15:100445531-100445553 ATTCATACAAAACTGTATCCAGG + Intronic
1135833300 16:25798248-25798270 ACTGATACACTACTGTATCCTGG - Intronic
1136530372 16:30864398-30864420 ATTAATACAAAACTGCATCCAGG + Intronic
1148317858 17:46719677-46719699 ATTGATGCAAAAATGGATAAAGG - Intronic
1149086614 17:52725008-52725030 ACTGATACATAAATGGAACACGG + Intergenic
1149360456 17:55889560-55889582 ATAGATAAACATCTGGATGAAGG - Intergenic
1153520609 18:5949901-5949923 ATTGCTAACCAACTGGCTCATGG - Intergenic
1154251880 18:12751594-12751616 CTTCAGACACAACTGGATCGGGG + Intergenic
1155696612 18:28693702-28693724 ATTCATACAAAACTGTATCCAGG - Intergenic
1155942013 18:31809386-31809408 ATTCATACAAAACTGTATCCAGG + Intergenic
1158400054 18:57113842-57113864 ATTGATAGACAAATGAATAATGG - Intergenic
1159164878 18:64686652-64686674 ATTCATACAAAACTGTATCCAGG + Intergenic
1159337927 18:67094265-67094287 GATGATACATAACTGAATCAAGG + Intergenic
1163944014 19:20519468-20519490 ATTCATACAAAACTGCATCCAGG - Intergenic
1163977547 19:20866494-20866516 ATTCATACAAAACTGCATCCAGG - Intergenic
1164202042 19:23027051-23027073 ATTCATACAAAACTGCATCCAGG - Intergenic
1164459010 19:28431869-28431891 ATTCATACAAAACTGTATCCAGG - Intergenic
1166905152 19:46102994-46103016 ATTCATACAAAACTGCATCCAGG - Intergenic
1167754045 19:51399868-51399890 ATTCAGACTCAACTGGCTCATGG + Intergenic
1167902532 19:52632776-52632798 ATTCATACAAAACTGTATCCAGG + Intronic
1168211645 19:54894957-54894979 ATTCATACAAAACTGCATCCAGG - Intergenic
1168227597 19:55007485-55007507 ATTCATACAAAACTGTATCCAGG - Intergenic
925828443 2:7873400-7873422 ATTCATACAAAACTGTATCCAGG - Intergenic
927332492 2:21882101-21882123 ACTGCTACACAACTGGATCCTGG - Intergenic
928770345 2:34697121-34697143 ATTCATACAAAACTGTATCCAGG - Intergenic
928779318 2:34801655-34801677 ATTCATACAAAACTGTATCCAGG - Intergenic
928857571 2:35818103-35818125 ATTCATACAAAACTGTATCCAGG + Intergenic
928997353 2:37307114-37307136 TTGGATGCACAACTGGAGCAGGG - Intronic
929076286 2:38081448-38081470 ATTCATACAAAACTGTATCCAGG - Intronic
929510006 2:42559144-42559166 TTAGATAGACAACTGGATCTGGG - Intronic
930789643 2:55311338-55311360 ATTAATACACAGGTGTATCATGG - Intronic
931040399 2:58291760-58291782 ATTCCTACACAACTGGAGAATGG - Intergenic
931043002 2:58318727-58318749 ATTCATACAAAACTGTATCCAGG + Intergenic
931948663 2:67336885-67336907 ATTCATACAAAACTGTATCCAGG + Intergenic
932296248 2:70625739-70625761 ATTCATACAAAACTGTATCCAGG + Intronic
933138389 2:78763161-78763183 ATTAATACATAACTGCATCCAGG + Intergenic
935738634 2:106126978-106127000 GATGATACACAAATGGAACACGG + Intronic
936775706 2:115970213-115970235 ATTGTTAAACAACCGGATCTTGG + Intergenic
937103714 2:119291308-119291330 ATGGATACACAGCTTGTTCAAGG - Intergenic
940346242 2:152631813-152631835 ATTGATGCTTAACTGGCTCAAGG - Intronic
940675430 2:156720743-156720765 ATTCATACAAAACTGTATCCAGG - Intergenic
943421196 2:187671173-187671195 ATTCATACAAAACTGTATCCAGG - Intergenic
943460726 2:188169347-188169369 ATTCATACAAAACTGTATCCAGG - Intergenic
943835782 2:192512499-192512521 ATTCATACAAAACTGTATCCAGG + Intergenic
943859571 2:192843769-192843791 ATTGGGAGACAACTGAATCATGG - Intergenic
944251902 2:197587089-197587111 ATTCATACAAAACTGCATCCAGG + Intronic
945362081 2:208904803-208904825 ATTCATACAAAACTGTATCCAGG + Intergenic
946780480 2:223189369-223189391 ATTCATACAAAACTGTATCCAGG - Intronic
946871283 2:224087997-224088019 ATTCATACAAAACTGCATCCAGG - Intergenic
946886893 2:224230317-224230339 ATTCATACAAAACTGCATCCAGG + Intergenic
946893663 2:224301683-224301705 ATTCATACAAAACTGTATCCAGG + Intergenic
948621964 2:239241072-239241094 ATTGAGACAGAACTGGATTCCGG - Intronic
1170219666 20:13928970-13928992 ATTGCTACAAAACAGCATCACGG - Intronic
1172983266 20:38961567-38961589 ATCGATTCAGAATTGGATCAAGG + Intergenic
1173763389 20:45584895-45584917 ATTCATACAAAACTGTATCCAGG - Intergenic
1173782095 20:45764564-45764586 ATTCATACAAAACTGTATCCAGG + Intronic
1175288297 20:57853106-57853128 ATTTCTAAATAACTGGATCATGG - Intergenic
1176525589 21:7865207-7865229 CTTAATACACTACTTGATCATGG + Intergenic
1177265093 21:18772807-18772829 ATTTATGAACAACTGGACCAGGG - Intergenic
1177670854 21:24224623-24224645 ATTGCACCACAACTGGAACATGG - Intergenic
1178659609 21:34495220-34495242 CTTAATACACTACTTGATCATGG + Intergenic
1181583600 22:23841338-23841360 ATTGATCTACTACTGGATGACGG - Intergenic
1182941084 22:34278150-34278172 ATTGGAAGACAACTGGAGCAGGG - Intergenic
1183464480 22:37972851-37972873 ATTGGCACAGAATTGGATCAGGG + Exonic
949161703 3:891353-891375 ATTCATACAAAACTGTATCCAGG - Intergenic
949827826 3:8182036-8182058 ATTCATACAAAACTGTATCCAGG + Intergenic
950242378 3:11383179-11383201 TTTGATCCTCAACTGGATCCTGG - Intronic
951222450 3:20083106-20083128 ATTGATGCACATCTTGATGAGGG + Intronic
952343132 3:32461601-32461623 ATTCATACAAAACTGTATCCAGG - Intronic
952895671 3:38076987-38077009 ATTCATACAAAACTGTATCCAGG - Intronic
953840752 3:46388375-46388397 ATTCATACAAAACTGCATCCAGG - Intergenic
958422433 3:93943412-93943434 ATTCATACAAAACTGTATCCAGG + Intronic
958574328 3:95928019-95928041 ATTGAATCACCACTGGATCCAGG - Intergenic
959978086 3:112484189-112484211 ATTGATACACAACTGGATCATGG + Intronic
960917675 3:122713446-122713468 TTTCATACACACCTGAATCAGGG - Exonic
961881435 3:130064296-130064318 ATTCATACAAAACTGTATCCAGG + Intergenic
961892023 3:130138287-130138309 ATTCATACAAAACTGTATCCAGG - Intergenic
963111505 3:141692382-141692404 ATTCATACAAAACTGTATCCAGG - Intergenic
963456295 3:145551876-145551898 ATTCATACAAAACTGTATCCAGG - Intergenic
963468997 3:145715424-145715446 ATTCATACAAAACTGTATCCAGG + Intergenic
963887883 3:150601752-150601774 ATTCATACAAAACTGCATCCAGG + Intronic
964124994 3:153226809-153226831 ATTCATACAAAACTGTATCCAGG - Intergenic
964299763 3:155275089-155275111 ATTCATACAAAACTGTATCCAGG - Intergenic
965639588 3:170818264-170818286 ATTCATACAAAACTGTATCCAGG - Intronic
965713802 3:171581453-171581475 ATTCATACAAAACTGTATCCAGG + Intergenic
965972891 3:174584758-174584780 ATTTATACACAACAGAATCCAGG - Intronic
966085872 3:176066662-176066684 ATTCATACAAAACTGTATCCAGG + Intergenic
966397182 3:179515941-179515963 ATTCATACAAAACTGTATCCAGG - Intergenic
967243795 3:187466959-187466981 ATTCATACAAAACTGTATCCAGG - Intergenic
968993754 4:3932399-3932421 ATTCATACAAAACTGTATCCAGG + Intergenic
969003406 4:4000737-4000759 ATTCATACAAAACTGTATCCAGG - Intergenic
969653631 4:8483087-8483109 ATTCATACAAAACTGTATCCAGG - Intronic
970087963 4:12369008-12369030 ATTCATACAAAACTGTATCCAGG + Intergenic
970533182 4:17003203-17003225 ATTCATACAAAACTGTATCCAGG + Intergenic
970746349 4:19301210-19301232 ATTGAAATAAAATTGGATCATGG - Intergenic
972979671 4:44680492-44680514 ATTGTTGCACACGTGGATCATGG + Exonic
973688339 4:53398123-53398145 ATAGAAACACAACAGGATCCTGG - Intronic
973751517 4:54024842-54024864 ATTCATACAAAACTGTATCCAGG + Intronic
974773819 4:66453134-66453156 ATTCATACACAAATGGGTAATGG + Intergenic
975588882 4:75980216-75980238 ATTGATACTCAGCTGGTACATGG - Intronic
978438999 4:108714180-108714202 ATTCATACAAAACTGTATCCAGG + Intergenic
980002922 4:127511633-127511655 ATTCATACAAAACTGTATCCAGG - Intergenic
980389313 4:132123210-132123232 ATTCATACAAAACTGTATCCAGG + Intergenic
980575258 4:134678593-134678615 ATTCATACAAAACTGTATCCAGG - Intergenic
981040632 4:140218524-140218546 ATTCATACAAAACTGTATCCAGG + Intergenic
982083563 4:151813131-151813153 ATTCATACAAAACTGTATCCAGG - Intergenic
982319432 4:154063121-154063143 ATTCATACAAAACTGCATCCAGG + Intergenic
982413785 4:155108970-155108992 ATTCATACAAAACTGTATCCAGG - Intergenic
982496739 4:156104169-156104191 ATTCATACAAAACTGTATCCAGG - Intergenic
983796690 4:171872952-171872974 ATAGATACACAAATGAATTATGG + Intronic
984191770 4:176614132-176614154 ATTGATACACATCTAGCTCCAGG - Intergenic
985436143 4:189931187-189931209 ATTCATACAAAACTGTATCCAGG + Intergenic
986554625 5:8999016-8999038 ATTCATACAAAACTGTATCCAGG - Intergenic
986962223 5:13228445-13228467 TTTAATAAACAACTGGATTAAGG - Intergenic
987282384 5:16424746-16424768 ATTCATACAAAACTGTATCCAGG + Intergenic
987756218 5:22099870-22099892 ATTCATACAAAACTGTATCCAGG + Intronic
988141861 5:27253542-27253564 ATTTATTCACAACTGGAGGAAGG - Intergenic
988730599 5:33969102-33969124 ATTGATAAACAAATGGGTCAAGG - Intronic
989225332 5:39021333-39021355 AATGATACAGAGCTGGACCATGG - Intronic
993248106 5:85478106-85478128 GTTGATCCAGAGCTGGATCAAGG + Intergenic
994295599 5:98084649-98084671 ATTCATACAAAACTGTATCCAGG + Intergenic
996202876 5:120698287-120698309 ATTCATACAAAACTGTATCCAGG - Intergenic
998506298 5:142675142-142675164 TTTAATACACAGCTGGTTCAGGG - Intronic
998693301 5:144612007-144612029 ATTCATACAAAACTGTATCCAGG - Intergenic
1000519011 5:162276087-162276109 ATTCATACAAAACTGTATCCAGG - Intergenic
1001331072 5:170762733-170762755 ATTCATACAAAACTGTATCCAGG - Intergenic
1004575616 6:16890975-16890997 ATTCATACAAAACTGTATCCAGG + Intergenic
1004768184 6:18754782-18754804 ATTCATACAAAACTGTATCCAGG - Intergenic
1010894042 6:81344607-81344629 ATTCATACAAAACTGTATCCAGG - Intergenic
1011005942 6:82645747-82645769 CTTGAGACACAATTGGACCAGGG - Intergenic
1013843325 6:114423138-114423160 ATTCATACAAAACTGTATCCAGG - Intergenic
1015165623 6:130197550-130197572 ATTCATACAAAACTGTATCCAGG + Intronic
1015172485 6:130269101-130269123 ATTAATTCAAAAATGGATCACGG - Intronic
1015271743 6:131343843-131343865 ATTCATACAAAACTGTATCCAGG + Intergenic
1016113758 6:140258152-140258174 ATTCATACAAAACTGTATCCAGG - Intergenic
1016572458 6:145530454-145530476 ATTGATACAGAAATGTAGCAAGG + Intronic
1016626923 6:146181608-146181630 ATTGATAGAGAACTGAATTATGG + Intronic
1016853663 6:148644829-148644851 ATTCATACAAAACTGTATCCAGG + Intergenic
1018078685 6:160239814-160239836 ATTGCTATTAAACTGGATCATGG + Intronic
1018084115 6:160287259-160287281 ATTCATACAAAACTGTATCCAGG - Intergenic
1018135212 6:160772361-160772383 ATTGATTTACAACTGGAGCTTGG + Intergenic
1018521087 6:164652799-164652821 ATTCATACAAAACTGTATCCAGG - Intergenic
1021637776 7:22708650-22708672 ATTCATACAAAACTGTATCCAGG + Intergenic
1021744946 7:23730722-23730744 ATTGAAACACACATGAATCAAGG + Intronic
1022572370 7:31467509-31467531 ATTCATACAAAACTGTATCCAGG - Intergenic
1022709489 7:32837603-32837625 ATTCATACAAAACTGTATCCAGG + Intergenic
1024738725 7:52333277-52333299 ATTCATACAAAACTGCATCCAGG - Intergenic
1028193824 7:87881566-87881588 GTTCACACACAACTGGAACACGG + Intronic
1030163110 7:106528428-106528450 ATTCATACAAAACTGTATCCAGG - Intergenic
1031005044 7:116460472-116460494 ATTCATACAAAACTGTATCCAGG + Intronic
1031686229 7:124734055-124734077 ATTCATACAAAACTGTATCCAGG + Intergenic
1033464531 7:141578725-141578747 ATTCATACAAAACTGCATCCAGG - Intronic
1033625957 7:143109855-143109877 ATTCATACAAAACTGCATCCAGG + Intergenic
1034390330 7:150782081-150782103 ACTGACATACAACTGGTTCAGGG + Intergenic
1035880236 8:3238653-3238675 ATTCATACAAAACTGTATCCAGG - Intronic
1036060139 8:5308053-5308075 AATGAAACAAAACTGGAACAAGG + Intergenic
1036373813 8:8183192-8183214 ATTCATACAAAACTGTATCCAGG + Intergenic
1036877090 8:12482449-12482471 ATTCATACAAAACTGTATCCAGG - Intergenic
1037115121 8:15216558-15216580 ATTTATACACAACTTGTACAGGG - Intronic
1039661464 8:39471426-39471448 ATTGATACACTACTGAACCACGG - Intergenic
1040648542 8:49425694-49425716 ATTCATACAAAACTGCATCCAGG + Intergenic
1041436707 8:57849594-57849616 ATTTATACCCAACTAGAACAAGG - Intergenic
1043079899 8:75753861-75753883 TTTGATCCACAAATAGATCATGG - Intergenic
1043500978 8:80855594-80855616 AATGATACACAACAGTAACAGGG + Intronic
1043717457 8:83505344-83505366 ATTCATACAAAACTGTATCCAGG - Intergenic
1046481706 8:114828158-114828180 ACTGATACAAAACTGGATAATGG + Intergenic
1046610362 8:116416657-116416679 ATTGACACACAACTGGTAAACGG + Intergenic
1046966055 8:120167012-120167034 ATTTATACATATCAGGATCAAGG + Intronic
1047569014 8:126077346-126077368 ATTAATACACATCTGGAAAAGGG - Intergenic
1047958495 8:129993937-129993959 AGAGACACACAACTGGATGATGG - Intronic
1048135873 8:131745956-131745978 ATTCATACAAAACTGTATCCAGG + Intergenic
1048168058 8:132080932-132080954 ATTCATACAAAACTGTATCCAGG - Intronic
1048763807 8:137825292-137825314 ATTCATACAAAACTGTATCCAGG - Intergenic
1049006951 8:139861813-139861835 AGTGATGCAGCACTGGATCATGG - Intronic
1050140966 9:2515229-2515251 ATTCATACAAAACTGCATCTAGG + Intergenic
1050672653 9:8015443-8015465 ATTGAAACAGAACAGGAACAGGG - Intergenic
1050733492 9:8736070-8736092 ATTAACTGACAACTGGATCAGGG + Intronic
1053783232 9:41631890-41631912 ATTCATACAAAACTGCATCCAGG - Intergenic
1054171185 9:61842032-61842054 ATTCATACAAAACTGCATCCAGG - Intergenic
1054666348 9:67738780-67738802 ATTCATACAAAACTGCATCCAGG + Intergenic
1056363251 9:85879865-85879887 ATTCATACAAAACTGCATCCAGG - Intergenic
1056525261 9:87437534-87437556 ATTCAAACACAACATGATCAGGG - Intergenic
1058612814 9:106793583-106793605 ATTCATACAAAACTGTATCCAGG + Intergenic
1060737446 9:126075095-126075117 ATTCATACAAAACTGTATCCAGG - Intergenic
1061133918 9:128722799-128722821 ATTGCTAAAGAAATGGATCAGGG + Intronic
1061369500 9:130190483-130190505 AATGTCACACAACTGGAACATGG + Intronic
1185958693 X:4521730-4521752 ATAGATACATAGATGGATCATGG + Intergenic
1186784470 X:12944857-12944879 ATTCATACAAAACTGTATCCAGG + Intergenic
1187099589 X:16179865-16179887 ATTCATACAAAACTGTATCCAGG - Intergenic
1188431458 X:30108574-30108596 ATTCATACAAAACTGTATCCAGG + Intergenic
1188462974 X:30449588-30449610 ATTCATACAAAACTGTATCCAGG - Intergenic
1188681289 X:33010723-33010745 ATTGATTCTCAACTGGAAAAAGG + Intronic
1190118321 X:47639952-47639974 AATGATACAGAAGTGGAACAGGG + Intronic
1191013804 X:55788996-55789018 ATTCATACAAAACTGCATCCAGG - Intergenic
1192730947 X:73802071-73802093 ATTCATACAAAACTGTATCCAGG - Intergenic
1193416454 X:81229943-81229965 ATTGATACAGAAGAGGAGCATGG - Intronic
1193537534 X:82732248-82732270 ATTCATACAAAACTGCATCCAGG + Intergenic
1193886310 X:86986816-86986838 ATTCATACAAAACTGTATCCAGG + Intergenic
1193941883 X:87686923-87686945 ATTCATACAAAACTGTATCCAGG + Intergenic
1194257053 X:91646965-91646987 ATTGAGAGATAACTGAATCATGG + Intergenic
1194351548 X:92828624-92828646 ATTCATACAAAACTGTATCCAGG + Intergenic
1195016543 X:100787033-100787055 ATTCATACAAAACTGTATCCAGG - Intergenic
1195091813 X:101467634-101467656 ATTGATTCAGAAAAGGATCATGG - Intronic
1195686414 X:107590737-107590759 ATTTATACACTGCTGGGTCATGG + Intronic
1195908402 X:109866792-109866814 ATTCATACAAAACTGTATCCAGG - Intergenic
1196524989 X:116720972-116720994 ATTCATACAAAACTGAATCCAGG - Intergenic
1197793684 X:130279558-130279580 ATTCATACAAAACTGTATCCAGG + Intergenic
1198598831 X:138263832-138263854 ATTCATACAAAACTGTATCCAGG + Intergenic
1198599015 X:138265003-138265025 ATTCATACAAAACTGTATCCAGG - Intergenic
1200575763 Y:4886231-4886253 ATTGAGAGAGAACTGAATCATGG + Intergenic
1201307035 Y:12559848-12559870 ATTCATACAAAACTGTATCCGGG - Intergenic
1201540363 Y:15099467-15099489 ATTCATACAAAACTGCATCCAGG - Intergenic