ID: 959984708

View in Genome Browser
Species Human (GRCh38)
Location 3:112559980-112560002
Sequence CAGTTTGCACAGGAGTATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959984701_959984708 25 Left 959984701 3:112559932-112559954 CCTTGCCCTCCCTAAGCAGGAAA 0: 1
1: 0
2: 1
3: 31
4: 276
Right 959984708 3:112559980-112560002 CAGTTTGCACAGGAGTATCAAGG 0: 1
1: 0
2: 2
3: 14
4: 134
959984702_959984708 20 Left 959984702 3:112559937-112559959 CCCTCCCTAAGCAGGAAACTGTA 0: 1
1: 0
2: 0
3: 8
4: 182
Right 959984708 3:112559980-112560002 CAGTTTGCACAGGAGTATCAAGG 0: 1
1: 0
2: 2
3: 14
4: 134
959984703_959984708 19 Left 959984703 3:112559938-112559960 CCTCCCTAAGCAGGAAACTGTAA 0: 1
1: 0
2: 3
3: 11
4: 119
Right 959984708 3:112559980-112560002 CAGTTTGCACAGGAGTATCAAGG 0: 1
1: 0
2: 2
3: 14
4: 134
959984706_959984708 15 Left 959984706 3:112559942-112559964 CCTAAGCAGGAAACTGTAAGGAT 0: 1
1: 1
2: 3
3: 23
4: 207
Right 959984708 3:112559980-112560002 CAGTTTGCACAGGAGTATCAAGG 0: 1
1: 0
2: 2
3: 14
4: 134
959984705_959984708 16 Left 959984705 3:112559941-112559963 CCCTAAGCAGGAAACTGTAAGGA 0: 1
1: 0
2: 2
3: 22
4: 187
Right 959984708 3:112559980-112560002 CAGTTTGCACAGGAGTATCAAGG 0: 1
1: 0
2: 2
3: 14
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959984708 Original CRISPR CAGTTTGCACAGGAGTATCA AGG Intronic
901972930 1:12921941-12921963 CAGATGGCACATGAGTCTCATGG - Intronic
902012251 1:13279822-13279844 CAGATGGCACATGAGTCTCATGG + Intergenic
902846368 1:19113742-19113764 CAGTTGGCTCAGGAGTATTGTGG - Exonic
904463922 1:30696935-30696957 CAGTTTGTAGAGTAGTGTCAAGG - Intergenic
906460045 1:46030000-46030022 CAGTGTGCACAGGTGTTTCTAGG - Intronic
909976176 1:82048151-82048173 CAGTTTTCACTTGAGTAACATGG + Intergenic
910767151 1:90793071-90793093 CAGTTTCCTCAGTTGTATCATGG + Intergenic
911729769 1:101280923-101280945 CAGTTTGCCCAGGACTGTCCTGG + Intergenic
912701654 1:111882538-111882560 CAGTGTGCAACGGAGTCTCAGGG + Intronic
912837628 1:113010307-113010329 TAATTTGTACTGGAGTATCATGG - Intergenic
913520453 1:119640590-119640612 CTGTTTGCACAGCTGAATCAAGG - Intronic
920384087 1:205555556-205555578 CTGGTTGCTCAGGAGGATCATGG + Intergenic
923101425 1:230820836-230820858 CAGCTGGCACAGGGCTATCAGGG - Intergenic
1069744743 10:70708104-70708126 CAGTGCTCACAGGAGTATCCCGG + Intronic
1070638827 10:78151264-78151286 CACTGGGCACAGGAGTACCAAGG + Intergenic
1070730739 10:78826530-78826552 CAGTTTGCTCAGGACTTTCTTGG + Intergenic
1071995014 10:91139201-91139223 CAGTTTGCTCAGGACTGTCCTGG - Intergenic
1075162726 10:120039035-120039057 CATTTTGCAAAAGATTATCATGG - Intergenic
1077877856 11:6322703-6322725 CAGCTTCCCCAGGAGTATTAGGG + Intergenic
1078737416 11:14033201-14033223 CAGTTCCCACATGAGAATCAAGG - Intronic
1079115118 11:17635662-17635684 CACTGTGCACAGGAATACCACGG + Exonic
1080018020 11:27527511-27527533 CAGTTTCCTCAGGAGTAAAATGG + Intergenic
1081520805 11:43879335-43879357 CAGTTTGCCCAGGACTGTCCTGG + Intergenic
1085414705 11:76312344-76312366 CAGTTTGAACAGCACTATCCTGG - Intergenic
1088129672 11:106472296-106472318 GAGTTTGCACAGGACTGTGAGGG + Intergenic
1088327777 11:108618435-108618457 CAGTTTTCACTGGAGTTTCTGGG + Intergenic
1092397659 12:8142484-8142506 CAATTTGCACAGGAGTCTTTGGG - Intronic
1092400732 12:8175593-8175615 TAGTCTTCACAGGGGTATCAGGG - Intronic
1093524403 12:20090771-20090793 GAGTTTGCACAGGATTGTAAGGG + Intergenic
1095284322 12:40390011-40390033 CAGTTTGCACAGGACCATGCTGG + Intergenic
1096069547 12:48767362-48767384 CAGGTTGCACAGGAGTGGGATGG - Exonic
1096283481 12:50277334-50277356 CAGTGTCCACCGGAGTAGCAAGG - Intronic
1098063677 12:66589028-66589050 CAGTTTGCTCATGTGTAACAGGG + Intronic
1099566150 12:84249171-84249193 AAGTTTGCAGAGGAGTATTAAGG + Intergenic
1101735063 12:107457181-107457203 AGGTTTGCCCAGGATTATCAAGG - Intronic
1102445549 12:112999484-112999506 CCGTTTGCACAGAAGTTTGAAGG + Intronic
1103158293 12:118706518-118706540 CAGTTTGCTCAAGTGTATGATGG - Intergenic
1105451355 13:20502777-20502799 AAGTTTACACTGGAGTATCAAGG + Intronic
1108547136 13:51507323-51507345 CACTTAGCACTGGAGTACCAGGG + Intergenic
1112009009 13:95278391-95278413 CAGTTGGCCCAGGAGAATCCTGG - Intronic
1112639394 13:101255868-101255890 TACGTTGCAAAGGAGTATCAAGG - Intronic
1118121945 14:62855479-62855501 CAATTTGCACAGGGCTATGAGGG - Intronic
1119688338 14:76651113-76651135 GAGTTTGGACAGGGGTATCATGG + Intergenic
1120063284 14:80010390-80010412 CAGTTTGTCCAGGACTATCCTGG + Intergenic
1124072980 15:26413069-26413091 AAGTTTTCACAGGAGGATCTGGG + Intergenic
1125206432 15:37158978-37159000 CAGTTTGCTCTGGATAATCATGG - Intergenic
1126423832 15:48504158-48504180 CAGTTTTCTAGGGAGTATCATGG + Intronic
1128662330 15:69511119-69511141 CAGCTTGCAGAGGCATATCATGG + Intergenic
1129486535 15:75879104-75879126 CACTGTGCAAAGGACTATCAGGG - Exonic
1129891671 15:79075713-79075735 CAGTTTGCTCAGGACTGTCTTGG - Intronic
1130266367 15:82408293-82408315 CACTGTGCAAAGGACTATCAGGG - Intergenic
1130728065 15:86461547-86461569 AAGATTTCACAGGAGTATCACGG + Intronic
1131143627 15:89998243-89998265 AAGTTTGCACTGGAGGAGCAGGG - Intergenic
1131637632 15:94253925-94253947 CAGTGTGCTCTGGAGCATCAAGG - Intronic
1135158040 16:20071154-20071176 CAGTTTCCACAGCAGTAAAATGG - Intronic
1135827334 16:25740726-25740748 CAGTTTCCTTATGAGTATCAGGG - Intronic
1137863078 16:51866300-51866322 CATTTTGCCCAGGAATAACAGGG + Intergenic
1137980233 16:53063207-53063229 CTGTTTGCTCAGTAGTAACATGG - Intronic
1138286283 16:55812718-55812740 CAGTTTTCACCGGGGTATCAGGG - Intronic
1140272349 16:73478508-73478530 CAGTTTGCCCAGGGGAATCCTGG - Intergenic
1141491662 16:84378021-84378043 CTGTTTGCACTTGAGTTTCAAGG - Intronic
1145853884 17:28133602-28133624 CACTTTGCCCAGGAATGTCAGGG - Intronic
1146597313 17:34181381-34181403 CAGATTACAGAGGAGTTTCAGGG + Intergenic
1148329497 17:46805152-46805174 CAGTTTGCACTTGAGGACCAGGG - Intronic
1151755192 17:76071269-76071291 CAGTTTGCATAAAAGTATTAAGG + Intronic
1153994986 18:10432886-10432908 CTGTTTGCACAGCAGTAGAATGG + Intergenic
1166015987 19:39979843-39979865 GAGTTTGTACAGAAGTATCTGGG + Exonic
1166345530 19:42162997-42163019 CATTTTCCACAGCAGTGTCATGG - Intronic
1166484193 19:43198862-43198884 CAGTTTTCCCAGGTGTCTCATGG + Intronic
1167066299 19:47188686-47188708 CATTTTGCAGAGGAGGCTCAGGG + Intronic
1167873832 19:52395399-52395421 CAGTATGGAAAGCAGTATCATGG - Intergenic
926884770 2:17586785-17586807 CAGTTGGCAGAGAAGTATCATGG + Intronic
929482949 2:42329112-42329134 CTCTGTGCACTGGAGTATCATGG - Intronic
930013731 2:46956858-46956880 CAGTTTGCCCAGGATCAGCATGG - Exonic
930343535 2:50148691-50148713 CAGTGTGAACAGTAGCATCAGGG - Intronic
930537374 2:52660400-52660422 CAGTTTGGATAGGAGTGTCAGGG - Intergenic
931326386 2:61229729-61229751 TAGTTTGCACAAGATTATCTTGG + Intronic
931856062 2:66302959-66302981 CACTTTGCATAGGATAATCAGGG + Intergenic
935539149 2:104328889-104328911 AAGCTTGCACAGGAGATTCAAGG - Intergenic
935547835 2:104419434-104419456 CAGTGTTCAAAGGTGTATCAGGG - Intergenic
937888679 2:126918097-126918119 CAGTTTGCATGGGAGTCCCAGGG + Intergenic
939409676 2:141808283-141808305 CAGAATTCACAGGAGGATCAGGG + Intronic
940518977 2:154718489-154718511 CAGTTTGCACAGGACTTTCTTGG - Intronic
940789805 2:158020278-158020300 CACTTTGCAAAGGAGGACCATGG - Intronic
941311577 2:163938804-163938826 CAGTTTGCACATAACTAGCAAGG + Intergenic
943003691 2:182362526-182362548 CAGTTTGCATGGGAGTTTCTTGG - Intronic
1173786522 20:45797246-45797268 CAGTTTTCCCAGCAGGATCATGG - Intronic
1176002235 20:62837421-62837443 CAGTTCCCACAGGATTACCAAGG - Intronic
1177242699 21:18480231-18480253 CAGTTTGCACAGTATTATGCTGG + Intronic
1182047275 22:27285080-27285102 CAGCTTGCACAGAAGTCTGAAGG - Intergenic
1182091974 22:27602154-27602176 CATTCAGCACAGGAGTATCATGG - Intergenic
1182759548 22:32711133-32711155 CAGTTTGCCCAGGAGTTTCCTGG - Intronic
950268887 3:11597216-11597238 CAGATTGCACTTGAATATCAAGG + Intronic
950463953 3:13142296-13142318 CAGGCTGCACAGGAGAGTCAGGG + Intergenic
952198303 3:31098905-31098927 CAGTTTGCCCAGGACTTTCTGGG - Intergenic
955189086 3:56743692-56743714 CAGTTTGCTCAGCAGGTTCAAGG + Intronic
957276821 3:78100700-78100722 CAGTGTGCAAATGAGTGTCATGG - Intergenic
957288618 3:78248861-78248883 CATTTTTCAAGGGAGTATCAGGG - Intergenic
957311649 3:78527567-78527589 AGGTATGCACAGGAGTTTCATGG + Intergenic
958991858 3:100855304-100855326 ATGTTTCCACAGCAGTATCAGGG - Intronic
959984708 3:112559980-112560002 CAGTTTGCACAGGAGTATCAAGG + Intronic
962858902 3:139378040-139378062 CTCTTTGGACAGGACTATCAAGG - Exonic
963645926 3:147914533-147914555 CAGTTTGCTCAGGACTATTCAGG - Intergenic
965608172 3:170517400-170517422 CAGTTTCCAGAGGTGTTTCAGGG + Intronic
968811987 4:2804298-2804320 CAGTTTCCCCAGGAGTAACTGGG - Intronic
972601348 4:40575710-40575732 CAGTTTGCCCAGGACTGTCCTGG + Intronic
976954984 4:90885164-90885186 CAGTTTGTGAAGGAGTCTCATGG - Intronic
977696423 4:99971440-99971462 CAGGTTGCACAGTACTACCAGGG - Intergenic
981243790 4:142509769-142509791 CAGTTTTCTCATGAGTATAAAGG + Intronic
988564066 5:32306753-32306775 CAGTTTGCACATCTGTATGATGG + Intronic
988813261 5:34806028-34806050 CAGATTGCACAGCAGTAAAAAGG + Intronic
989268997 5:39510024-39510046 CAGTTTGCACATCAGTAAAATGG + Intergenic
989745299 5:44821856-44821878 TATTTTGCACAGGATTTTCAAGG + Intergenic
991124365 5:63052896-63052918 TTGTTTGCACAGGAATAGCATGG - Intergenic
993288446 5:86032784-86032806 CAGTTTGCACAGCAGTAAAATGG - Intergenic
993756242 5:91733841-91733863 AAGTATGCACAGGAGAATCCTGG - Intergenic
995865419 5:116685238-116685260 CAGTCTGCATAGGACTATTATGG - Intergenic
996014640 5:118519565-118519587 CAGATTGCAAAAGAGCATCAGGG + Intergenic
1001136448 5:169106641-169106663 CAGTATGTACAGTAGCATCAGGG - Intronic
1005941601 6:30564451-30564473 AATTTTAGACAGGAGTATCATGG + Intergenic
1009700641 6:67174014-67174036 TTCTTTGCACAGAAGTATCAAGG - Intergenic
1013694170 6:112681757-112681779 CAGTTTATCCAGGAGTACCAAGG + Intergenic
1013806973 6:114006922-114006944 CAGTCTGCTCAGGACTTTCATGG + Intronic
1014369483 6:120586615-120586637 CAGTTTGCACAGGACTATATTGG - Intergenic
1015953050 6:138573188-138573210 TAGTTTGCAGAGGAGGCTCAGGG - Intronic
1022233607 7:28439551-28439573 CAGTTTGCAGAGGAGGAACCTGG + Intronic
1022926934 7:35065862-35065884 CACTACACACAGGAGTATCATGG + Intergenic
1023492407 7:40758044-40758066 CAGTTTGGACTTCAGTATCATGG + Intronic
1026254540 7:68699232-68699254 CAGTTTGGTCAGGACTATCGTGG + Intergenic
1028477988 7:91272509-91272531 CAGTTTGCCCAGGACTTTCCTGG - Intergenic
1030492623 7:110256823-110256845 CAGTTTGCAGAGGAGTATAAAGG - Intergenic
1036344510 8:7950398-7950420 TAGTCTTCACAGGGGTATCAGGG - Intronic
1036839852 8:12111165-12111187 TAGTCTTCACAGGGGTATCAGGG - Intronic
1036861642 8:12357409-12357431 TAGTCTTCACAGGGGTATCAGGG - Intergenic
1037375590 8:18224309-18224331 CTTATTGCACAGGAGTATCCTGG + Intergenic
1042132730 8:65604549-65604571 CAACTTCCACAGGAGTATCTTGG + Exonic
1046855597 8:119028264-119028286 GAAATTGCACAGGAGTATAAAGG + Intronic
1051824662 9:21206966-21206988 CATTTGTCCCAGGAGTATCAAGG + Exonic
1054769163 9:69068313-69068335 CTGTTTGCACAGCAAAATCAGGG + Intronic
1055204260 9:73708495-73708517 CAGTCTGCACGGGATGATCATGG - Intergenic
1058710464 9:107674722-107674744 CAGTAAGCCCAGGAGGATCAGGG + Intergenic
1060259743 9:122063749-122063771 CAGTTTGCCCAGGACTGTCCAGG + Intronic
1061756880 9:132820344-132820366 CAATTTGCTCAGCAGTATCCAGG - Intronic
1189537879 X:41955247-41955269 AAGTTTGCCCAGGAGTACCCAGG - Intergenic
1195162639 X:102185508-102185530 CAGTTTGCAGAGGAGTGTCAGGG - Intergenic
1195166699 X:102227116-102227138 CAGCTTGCAGAGGAGTGTCAGGG - Intergenic
1195192161 X:102459972-102459994 CAGCTTGCAGAGGAGTGTCAGGG + Intronic
1195965897 X:110429993-110430015 CAGTTTTCATAGGATTACCAAGG - Intronic
1199600477 X:149538749-149538771 CAGGTTGCTCAGGAGGCTCATGG + Intergenic
1199650111 X:149941192-149941214 CAGGTTGCTCAGGAGGCTCATGG - Intergenic
1200223391 X:154403235-154403257 CAGTTTGTACAGGAGGGACAAGG - Intronic