ID: 959985029

View in Genome Browser
Species Human (GRCh38)
Location 3:112562362-112562384
Sequence AGGGTAGTCCCTGACTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959985024_959985029 12 Left 959985024 3:112562327-112562349 CCAGTGAAGAGCCCTACTGCGCA 0: 1
1: 0
2: 0
3: 2
4: 73
Right 959985029 3:112562362-112562384 AGGGTAGTCCCTGACTGTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 101
959985026_959985029 0 Left 959985026 3:112562339-112562361 CCTACTGCGCATGTGTGACTAGA 0: 1
1: 0
2: 0
3: 4
4: 49
Right 959985029 3:112562362-112562384 AGGGTAGTCCCTGACTGTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 101
959985025_959985029 1 Left 959985025 3:112562338-112562360 CCCTACTGCGCATGTGTGACTAG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 959985029 3:112562362-112562384 AGGGTAGTCCCTGACTGTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959985029 Original CRISPR AGGGTAGTCCCTGACTGTGA AGG Intronic