ID: 959985029

View in Genome Browser
Species Human (GRCh38)
Location 3:112562362-112562384
Sequence AGGGTAGTCCCTGACTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959985024_959985029 12 Left 959985024 3:112562327-112562349 CCAGTGAAGAGCCCTACTGCGCA 0: 1
1: 0
2: 0
3: 2
4: 73
Right 959985029 3:112562362-112562384 AGGGTAGTCCCTGACTGTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 101
959985026_959985029 0 Left 959985026 3:112562339-112562361 CCTACTGCGCATGTGTGACTAGA 0: 1
1: 0
2: 0
3: 4
4: 49
Right 959985029 3:112562362-112562384 AGGGTAGTCCCTGACTGTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 101
959985025_959985029 1 Left 959985025 3:112562338-112562360 CCCTACTGCGCATGTGTGACTAG 0: 1
1: 0
2: 0
3: 5
4: 70
Right 959985029 3:112562362-112562384 AGGGTAGTCCCTGACTGTGAAGG 0: 1
1: 0
2: 0
3: 11
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959985029 Original CRISPR AGGGTAGTCCCTGACTGTGA AGG Intronic
900137857 1:1126073-1126095 CGGGGGGTCCCTGACTGTGACGG - Intergenic
903153657 1:21430081-21430103 GGGGTGGGCCCTGACTTTGAGGG - Intergenic
904265954 1:29318708-29318730 AGGCCAGTCCCTGACGGGGAGGG - Intronic
906068068 1:42996443-42996465 AGGGCAGTCCCGCACTCTGATGG + Intergenic
906858270 1:49331367-49331389 AGGGTAGTGCCTGCCTCAGAAGG + Intronic
910746607 1:90581582-90581604 AGGGTTGTTCCTGCCTATGATGG - Intergenic
912694453 1:111830517-111830539 AGGGTTGTCCCTGAGAGTGAGGG - Intronic
917967210 1:180186370-180186392 AGGGTTGTCCCTGGCAGTGTGGG - Intronic
919064670 1:192678812-192678834 AGGGTAGCCTCTGACATTGAGGG + Intergenic
920233704 1:204487878-204487900 AGTGTGGTCCCTGACCTTGAGGG - Intronic
1063158341 10:3400210-3400232 AGTGTATTCTCTGACGGTGATGG + Intergenic
1065851561 10:29794398-29794420 AAGGAAGACCATGACTGTGAGGG - Intergenic
1066456965 10:35580958-35580980 AGGGTAGGCTCTGCCTTTGATGG - Intergenic
1069340444 10:67403016-67403038 AGGGTAGTGCCTGCCTGAGATGG + Intronic
1070568233 10:77620073-77620095 AGGGTGGCTCCTGACCGTGAGGG + Intronic
1071513663 10:86282965-86282987 AGGCCTGGCCCTGACTGTGAAGG - Intronic
1072898540 10:99387896-99387918 AGTGGAGTCCCCGTCTGTGAAGG - Exonic
1072907211 10:99465428-99465450 AAGGGAGACCCTGACTGTGGTGG - Intergenic
1075848123 10:125563328-125563350 ACGCTAGTCCCTGGCTGAGAGGG - Intergenic
1075878039 10:125823802-125823824 AGGGTCTTCCCTGACCCTGAGGG + Intronic
1076235666 10:128862143-128862165 AGGGTTGTCCTTGACTGAGGAGG + Intergenic
1077613841 11:3661151-3661173 AGAGTAGACCCTGGCTCTGATGG + Intronic
1083801011 11:65046265-65046287 ACTGTAGTCACTGACTTTGAGGG + Exonic
1093726790 12:22522283-22522305 AGGGTTGTCCCTTGCTGTGCGGG + Intronic
1096621409 12:52867950-52867972 AGGGTAGTGCCTGCCTGGGCAGG - Intergenic
1097693785 12:62758381-62758403 AGGGAGGTCCCTGCCTGTGTGGG + Intronic
1099289769 12:80762106-80762128 CGGGTACTCCCTGAATGTGGGGG + Intergenic
1104402473 12:128487764-128487786 AGGGTGTTCCTTGACTATGAAGG - Intronic
1108018385 13:46099301-46099323 AGGGTAGGACCTGATTGTTAAGG + Intronic
1108250743 13:48565328-48565350 AGGAAACTCCCTGACTGAGATGG + Intergenic
1109464774 13:62716014-62716036 ATGGAAGTCCCTGACTGGCAAGG - Intergenic
1111746182 13:92272485-92272507 AGGGTACTCAGTGGCTGTGATGG - Intronic
1113342384 13:109439769-109439791 AGGGTTGTCCAGAACTGTGAGGG + Intergenic
1120616751 14:86715746-86715768 AGTGTAGTCAATGACAGTGAGGG + Intergenic
1122971181 14:105152855-105152877 AGGGTAGTTCCTGATTCTGCAGG + Intronic
1126694824 15:51317043-51317065 AGGGTAGCCCAGGACTGGGAAGG - Intronic
1129971318 15:79780336-79780358 AGGGTAGTGCCTACCTGAGATGG + Intergenic
1133969947 16:10560346-10560368 AGGGTAGTACCTGTCAGTGAGGG + Intronic
1136626532 16:31465252-31465274 AGGGCAGTCCCTGGCAGTGCTGG - Intronic
1137431360 16:48420427-48420449 AGGGTGGAGACTGACTGTGAAGG + Intronic
1145817496 17:27805979-27806001 GGGGTAGTCCCAGGGTGTGATGG + Intronic
1149269164 17:54957628-54957650 AGGGAAGTCCCTGAATTTCATGG - Intronic
1150158786 17:62876208-62876230 AGGGCAGGCCCAGGCTGTGAAGG - Intergenic
1162838299 19:13336274-13336296 AGGGGAGTCTATGACTGTGTTGG - Intronic
1163134999 19:15304044-15304066 AAGGTAATCCTTCACTGTGACGG - Intronic
1163804426 19:19386979-19387001 AGGGGAGTCCCTTTCTCTGAGGG + Intronic
1164615124 19:29663154-29663176 AGGGTAGGCCCTGGCTGGGGTGG - Intergenic
1167271728 19:48510013-48510035 GGGGCAGTACCTGAGTGTGAAGG + Exonic
927502421 2:23591552-23591574 AGAGTAGTCACTGGCTGTGGGGG - Intronic
927540425 2:23905848-23905870 AAGGTAGTCCCTGCCTTTCATGG + Intronic
928274256 2:29885143-29885165 AGGGTAGTCCCTTACTAGCAAGG - Intronic
929830257 2:45341460-45341482 AGGGCAGGGCCTGACTGTGATGG + Intergenic
932363910 2:71134237-71134259 AGGAAAGTCTCTGACTGTAAAGG + Intronic
932834528 2:75023800-75023822 AGGGTGGCACCTGACTGTGTGGG - Intergenic
934107894 2:88712806-88712828 AGGAAATTTCCTGACTGTGAAGG - Intronic
935814572 2:106835224-106835246 AGGACAGTGCCTGTCTGTGAGGG + Intronic
938063166 2:128267595-128267617 GGGGTGGGCCCTGACTTTGAGGG + Exonic
938646287 2:133333769-133333791 AGTGCAGTCCCTCACTGTGTAGG - Intronic
943850328 2:192712613-192712635 AGGTTATTCTCTGACTATGATGG - Intergenic
945257457 2:207814150-207814172 AGGGGAGTCACTGTGTGTGAAGG - Intergenic
946385386 2:219381309-219381331 AGGGTGGGCCCTGCCTGGGAAGG - Intronic
948082782 2:235220183-235220205 AGGGAGGTCCCAGACTGTGTAGG - Intergenic
1172600902 20:36182290-36182312 CGGGTAGAACTTGACTGTGAAGG - Exonic
1174370703 20:50085492-50085514 AGGGGAGCCCCTGCCTTTGAGGG - Intronic
1176108950 20:63402506-63402528 ATGGGGGTCCCTGACTGTGGGGG + Intergenic
1183843406 22:40519325-40519347 AGGGTAGTCTCTAAGTGAGAAGG - Intronic
949796519 3:7857193-7857215 ACGCTAGTCCCTAACTGTGGAGG - Intergenic
952600765 3:35079447-35079469 AAGGTAGTCCCTCACTGGTAAGG + Intergenic
954702269 3:52456465-52456487 CGGGTAGTTCCCGACTTTGACGG + Intronic
955516667 3:59732633-59732655 AGGGGAATCATTGACTGTGAGGG + Intergenic
958915793 3:100048487-100048509 AGGGTGGGCTCTGACTGAGATGG - Intronic
959985029 3:112562362-112562384 AGGGTAGTCCCTGACTGTGAAGG + Intronic
961684694 3:128621574-128621596 AGGGGAGTCAGTGACTCTGAGGG + Intronic
962587317 3:136855228-136855250 TGGGTACACCATGACTGTGATGG + Exonic
973606146 4:52589458-52589480 AGGCTAGCCCCTGGCTGTCAGGG + Intergenic
975638497 4:76475357-76475379 AGGGTTGTCAAGGACTGTGAAGG + Intronic
977339145 4:95735456-95735478 AAGGTAGTCCCTCACTGTAAAGG + Intergenic
982120512 4:152138769-152138791 GGGGTTGTCCCTGCCTGTGTTGG - Intergenic
984444528 4:179818345-179818367 AAGGCAGTCCCTGACTGGCAAGG + Intergenic
985672811 5:1214866-1214888 AGGGTGGGCCCTGGGTGTGAGGG + Intronic
992536545 5:77710738-77710760 AGTGTAATGCCTGACTGTTAAGG - Intronic
993638636 5:90375652-90375674 AAGGCAGTCCCTTACTGTCAAGG + Intergenic
996771751 5:127093639-127093661 AGTCTAGCCCCTGCCTGTGAGGG + Intergenic
1000160626 5:158593985-158594007 AGGGTACCCACTGAGTGTGATGG + Intergenic
1001767023 5:174257822-174257844 AGGTTATTCCCTCAATGTGATGG + Intergenic
1002388886 5:178893703-178893725 AGGGCAGTCCCTTACTGGCAAGG + Intergenic
1004142803 6:13036091-13036113 TGGCTAGTCGCTGACAGTGATGG + Intronic
1006257938 6:32845804-32845826 AGGGTAGTCCCCGGCTCTGACGG - Intronic
1006673914 6:35748568-35748590 AGGAGACTCCCTGACTGTGTGGG - Exonic
1008925228 6:56885182-56885204 AGGGGAGTCCCTGAAGGGGAGGG - Intronic
1010926410 6:81751667-81751689 AGGGGAGTTTCAGACTGTGAAGG - Exonic
1011137874 6:84118663-84118685 AGGGTAGAGCCTGCCTGAGAAGG - Intergenic
1013363406 6:109415937-109415959 AAGGTAGTCCCTTACTGGCAAGG + Intronic
1020394544 7:7699555-7699577 AGGGTGGTCCCTGGATGTGATGG + Intronic
1024646599 7:51376167-51376189 AGGGCAGTCTCTGAATGGGAAGG - Intergenic
1032570119 7:132987026-132987048 AGGGTAGTCCTTTACTGGCAAGG - Intronic
1034776029 7:153827803-153827825 AGCGCAGCCCCTGACTGTGTGGG - Intergenic
1037334981 8:17783240-17783262 AGTGAAGTCTCTGGCTGTGAAGG + Intronic
1038358767 8:26856693-26856715 AGGGTGGTCCTGGACTGGGAGGG - Intronic
1040639858 8:49320768-49320790 AGGTTAGAGCCAGACTGTGAAGG - Intergenic
1044720774 8:95143757-95143779 AGGTTAGGACTTGACTGTGAAGG + Intronic
1045074261 8:98545276-98545298 TGGCTAGTGCCAGACTGTGAAGG + Intronic
1047536586 8:125725647-125725669 AGGGCAGTCCCTGGCTCTGAAGG - Intergenic
1051192003 9:14523066-14523088 AGGGTAGTGTCTGGCTGAGAGGG + Intergenic
1052079748 9:24189498-24189520 CAGGCAGTCCCTGACTATGATGG + Intergenic
1053157485 9:35791376-35791398 AGGGTAGGCCCTGAGAGTGAGGG + Intergenic
1055858188 9:80717381-80717403 AAAGTAGTCCATGACTGTGTGGG + Intergenic
1057286936 9:93764381-93764403 AGGGTGGGGCCTGACTGTGGAGG - Intergenic
1057410187 9:94810998-94811020 AGGTTAGCCACTGACTCTGAGGG - Intronic
1060611039 9:124964726-124964748 AAGGTAGTCCCTTACTGGCAAGG + Intronic
1192723519 X:73724621-73724643 AGGGTAGCACCTGCCTGAGATGG - Intergenic
1197924671 X:131633936-131633958 AGGCTACTCCCTAACTGTGATGG - Intergenic
1201652383 Y:16304029-16304051 AACATAGTCCCTGTCTGTGAGGG - Intergenic