ID: 959988982

View in Genome Browser
Species Human (GRCh38)
Location 3:112609880-112609902
Sequence GAATCATTTTGAATGATCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 201}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
959988981_959988982 -4 Left 959988981 3:112609861-112609883 CCTGAACAGTCTGAACTAGGAAT 0: 1
1: 0
2: 0
3: 9
4: 107
Right 959988982 3:112609880-112609902 GAATCATTTTGAATGATCTAAGG 0: 1
1: 0
2: 0
3: 40
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
959988982 Original CRISPR GAATCATTTTGAATGATCTA AGG Intronic
907195922 1:52686834-52686856 GAACAATTTTGAGTGACCTACGG - Exonic
907226187 1:52948995-52949017 TAATCATTTAAAATGATGTAGGG - Intronic
908222687 1:62023789-62023811 CAATCATTTTGAATTCTGTAAGG + Intronic
909143768 1:71901503-71901525 CAATCAATTTCATTGATCTAGGG + Intronic
910335515 1:86125443-86125465 GAATCATTTTTTATGATATTTGG + Exonic
911181982 1:94869224-94869246 GAAACATTTTGAATTACCAAGGG - Intronic
911365367 1:96931169-96931191 GAAGCATTTTAAATGTTCCAAGG + Intergenic
911650615 1:100383788-100383810 GAATCAGTCTGACTGAGCTAAGG - Intronic
912928384 1:113933289-113933311 GAAACATGTTGAAGGAACTAGGG + Intronic
913395456 1:118365825-118365847 GATGCAGTTTTAATGATCTAAGG - Intergenic
913938289 1:125077483-125077505 GAATCTTTTAGAATAATCTAAGG + Intergenic
913944547 1:125146518-125146540 GAATCTTTTAGAATAATCTAAGG - Intergenic
913954632 1:143277247-143277269 GAATCTTTTAGAACAATCTAAGG + Intergenic
913982806 1:143538112-143538134 GAATCTTTTAGAACAATCTAAGG - Intergenic
917069791 1:171137779-171137801 TCCTCATTTTGAATGCTCTAAGG - Intronic
919135296 1:193500272-193500294 GAATCATTTTGGCTGTCCTAGGG + Intergenic
922013333 1:221615305-221615327 GAATCTTTTTGAATAATTTTAGG + Intergenic
922864836 1:228851059-228851081 GAATCATTTTAAAAGCTCTCCGG + Intergenic
923842758 1:237691709-237691731 GAATCAATTAGAATAATTTATGG + Intronic
923873899 1:238026833-238026855 AAATCATTGTGAATGATAGAAGG + Intergenic
923911403 1:238448498-238448520 GAATCATTTTAAATTTTATAAGG - Intergenic
924001344 1:239555971-239555993 CAATCATTTTTAGTGATCTTTGG + Intronic
924057048 1:240134281-240134303 GAATTGTCTTGAATGATCAAAGG + Intronic
1064129591 10:12697180-12697202 GAATCATTTTGAGAGATTTTAGG - Intronic
1064521900 10:16211257-16211279 TTATCATTTTCAATGATCTTAGG + Intergenic
1064573378 10:16719333-16719355 GAATGATTTTGAATGACATTGGG - Intronic
1068317198 10:55361870-55361892 GAATTATTTTATATGATCTTGGG - Intronic
1069055873 10:63844226-63844248 GTATCAATTTGATTGAGCTAAGG + Intergenic
1069151464 10:64966072-64966094 GAAGCATTTTGAAATTTCTAGGG + Intergenic
1070250547 10:74769315-74769337 GAATCCTTTAGTATGATCTTGGG - Intergenic
1079601924 11:22319677-22319699 GACTCACTCTGAATGAACTAAGG + Intergenic
1080755785 11:35196922-35196944 GAATAATTTTGATTGACCTCTGG + Intronic
1083392151 11:62360432-62360454 TACTCATTTTCAATAATCTAAGG - Intronic
1085020940 11:73207234-73207256 TAATAATTTTTAATGATCTCTGG - Intergenic
1086257816 11:84900032-84900054 GAAATATTCTTAATGATCTAAGG - Intronic
1086665239 11:89472249-89472271 GGATCATTTGGAATGAATTATGG - Intronic
1086990336 11:93296175-93296197 GAATCATTTGGAATTGTCTCTGG - Intergenic
1093224947 12:16471456-16471478 GAATTATGCTTAATGATCTATGG + Intronic
1093859594 12:24147981-24148003 GAATCATTGTTCATAATCTATGG - Intergenic
1094679513 12:32655670-32655692 GAATCATTCAGAATCATCAATGG - Intergenic
1097680344 12:62643117-62643139 AAACTATTTTGAATGATCCACGG - Intergenic
1097723176 12:63045835-63045857 GGAACATTTTTAAAGATCTAAGG - Intergenic
1098351852 12:69571065-69571087 GAATAATTTTCATTCATCTAAGG - Intronic
1098674528 12:73272206-73272228 GGATCATTTTTAATGATCAGTGG + Intergenic
1098674529 12:73272227-73272249 GGATCATTTTTAATGATCAGTGG + Intergenic
1098877374 12:75880414-75880436 AAATAATTTTGAATGCTTTAAGG + Intergenic
1100225829 12:92554746-92554768 TCATCATTCTGAATGAACTAAGG - Intergenic
1104118758 12:125777066-125777088 GATTCATTTTGATTGGTTTATGG - Intergenic
1105233999 13:18528800-18528822 GAATCTTTTAGAATAATCTAAGG - Intergenic
1105246083 13:18651403-18651425 GATACATTTTGAAACATCTAAGG - Intergenic
1106834395 13:33617974-33617996 GTTGCATTTTGAATGATATAAGG + Intergenic
1107035244 13:35895338-35895360 GAATAATTCTGAATGACCAAAGG - Intronic
1108216555 13:48190825-48190847 GAATAATTTTTAATGATGTAGGG - Intergenic
1108268378 13:48734448-48734470 GAATCATTGTGAAGATTCTATGG - Intergenic
1111000880 13:82179873-82179895 TAATCATTTTAAATGTACTAAGG - Intergenic
1112680773 13:101762681-101762703 CAATTATTTTGATTGAACTATGG - Intronic
1114739386 14:25079619-25079641 TTTTCATTTTGAATGATCTTTGG + Intergenic
1115040667 14:28921913-28921935 AAATATTTTTGAATCATCTAAGG + Intergenic
1116314271 14:43367351-43367373 GAATTATTCTGAATGAAATAAGG + Intergenic
1116672127 14:47856412-47856434 TGCTCATTTTGAATGATATAAGG + Intergenic
1116754567 14:48930101-48930123 CATTGATTTTGCATGATCTAAGG - Intergenic
1126266447 15:46759883-46759905 GATTCAGTTTGAAAAATCTAGGG + Intergenic
1134299444 16:12976634-12976656 GAATCATTTTAGGTGTTCTAAGG + Intronic
1134309698 16:13064544-13064566 TAAGAATTTTGAATGATATAAGG + Intronic
1135734449 16:24919624-24919646 GAATCATTTTGTATCATGTATGG - Exonic
1136935306 16:34457384-34457406 GAATCTTTTAGAATAATCTAAGG + Intergenic
1136938136 16:34495147-34495169 GAATCTTTTAGAATAATCTAAGG + Intergenic
1136940990 16:34581485-34581507 GAATCATGTGGAATCATCTAAGG + Intergenic
1136946377 16:34656511-34656533 GAATATTTTAGAATAATCTAAGG - Intergenic
1136949230 16:34695045-34695067 GAATCTTTTAGAATAATCTAAGG - Intergenic
1136961679 16:34853410-34853432 GAATCTTTTAGAATAATCTAAGG - Intergenic
1136964512 16:34891196-34891218 GAATCTTTTAGAATAATCTAAGG - Intergenic
1136968653 16:34945756-34945778 GAATCTTTTAGAATAATCTAAGG - Intergenic
1137089116 16:36166306-36166328 GAATCTTTTAGAATAATCTAAGG - Intergenic
1137093654 16:36225524-36225546 GAATCTTTTAGAATAATCTAAGG - Intergenic
1137215714 16:46387595-46387617 GAATCATGTGGAATCATCTAAGG + Intergenic
1137216644 16:46399640-46399662 GAATCATGTGGAATCATCTAAGG + Intergenic
1137218387 16:46423028-46423050 GAATATTTTAGAATAATCTAAGG + Intergenic
1138401040 16:56744225-56744247 GAAACAATTAAAATGATCTATGG - Intronic
1140542867 16:75775363-75775385 GCATAATTTTGAATAATCTATGG + Intergenic
1143932622 17:10445655-10445677 GATTCATTTTAAATGAGCTGTGG - Intronic
1147124673 17:38358365-38358387 GAACCATTTGGAATGATAAAAGG - Intronic
1203184215 17_KI270729v1_random:97091-97113 GAATCTTTTAGAATAATCTAAGG - Intergenic
1203188859 17_KI270729v1_random:158264-158286 GAATCAAATGGAATCATCTAAGG - Intergenic
1203188931 17_KI270729v1_random:159291-159313 GAATCAAATGGAATCATCTAAGG - Intergenic
1153370617 18:4311505-4311527 AAATCCTTTTGAATTGTCTAGGG + Intronic
1154442836 18:14408261-14408283 GATACATTTTGAAACATCTAAGG + Intergenic
1154515538 18:15161077-15161099 GAATCTTTTAGAATAATCTAAGG + Intergenic
1155896905 18:31341012-31341034 GAAGCATTTAGCATGTTCTATGG + Intronic
1156544813 18:37953962-37953984 GAGTCATTTGTAATGATTTATGG + Intergenic
1156758082 18:40552925-40552947 GATCCATTCTGAATGCTCTAGGG - Intergenic
1159733128 18:72056648-72056670 GACTCAGTTTGAATGTTCAAAGG + Intergenic
1159854939 18:73574929-73574951 GAATAAGTTTGAGAGATCTATGG - Intergenic
1160102015 18:75930554-75930576 AAATCATTTTTATTGGTCTAAGG - Intergenic
1161696428 19:5771163-5771185 TCATCATTTTGAGGGATCTAGGG - Intronic
1167981013 19:53275709-53275731 GAATAATTTTTTAAGATCTATGG - Intergenic
934332170 2:92079105-92079127 GAATCTTTTAGAATAATCTAAGG - Intergenic
935480699 2:103585259-103585281 GAAACATTTTGAAAGATAGAAGG + Intergenic
938163542 2:129007513-129007535 TAAGCATTTTTAATGTTCTATGG - Intergenic
938515800 2:132005848-132005870 GAATCTTTTAGAATAATCTAAGG + Intergenic
939120690 2:138112812-138112834 GAATTATTTTGAAGAATGTATGG + Intergenic
939675139 2:145062965-145062987 GTATCAACTTGAGTGATCTAAGG - Intergenic
939688302 2:145226632-145226654 GAATGATTTTGTATTATCTGTGG + Intergenic
940504104 2:154530717-154530739 GCAGCATTTAGAATGATATAAGG + Intergenic
941931874 2:170949271-170949293 ACATTATTTAGAATGATCTAGGG - Intronic
943284026 2:185974110-185974132 GTATCAATTTGACTGAACTAAGG + Intergenic
943759967 2:191597232-191597254 AAAATATTTTGGATGATCTAGGG + Intergenic
944378622 2:199078937-199078959 AAATCATTTTTACTGTTCTAGGG - Intergenic
947090494 2:226505387-226505409 ATATAATTTTCAATGATCTATGG + Intergenic
947143973 2:227047117-227047139 GCATCATTTTAAATGATAGAGGG + Intronic
1169931269 20:10835655-10835677 GAAACATTTAGAATCATTTAGGG + Intergenic
1170520400 20:17179306-17179328 GAATCATTTTGAATAGTATTAGG - Intergenic
1172592022 20:36124427-36124449 GAATAATTTCCAATGATCTATGG - Intronic
1173654763 20:44691963-44691985 GAAACATTTAGCATGATCTAGGG - Intergenic
1174807119 20:53614432-53614454 GAATCATTCTGATTCATTTACGG - Intergenic
1176453251 21:6882943-6882965 GATACATTTTGAAACATCTAAGG - Intergenic
1176777986 21:13157062-13157084 GAATCTTTTAGAATAATCTAAGG - Intergenic
1176831425 21:13747991-13748013 GATACATTTTGAAACATCTAAGG - Intergenic
1177015198 21:15778668-15778690 GAAACAGTTTGATTCATCTAAGG + Intronic
1177123133 21:17163485-17163507 GGTTCACTTTGAATGATCTTTGG - Intergenic
1177345645 21:19865418-19865440 AAATAATTTTCAATCATCTAGGG + Intergenic
1177487852 21:21782421-21782443 CAATCTTTTTGAATGTTTTAAGG + Intergenic
1177639296 21:23825918-23825940 AGATCATTCTGAATTATCTATGG - Intergenic
1177818693 21:26006562-26006584 TAATCATTTTGTATAATCCAGGG - Intronic
1177975606 21:27846078-27846100 GAATCTTTTAGAATAATCTAAGG - Intergenic
1180525764 22:16258488-16258510 GAATCTTTTAGAATAATCTAAGG - Intergenic
1183584677 22:38746067-38746089 AAAACATTTTGAATGAGTTAGGG + Intronic
1203322608 22_KI270737v1_random:82415-82437 GAATCTTTTAGAATAATCTAAGG + Intergenic
949168986 3:976174-976196 TACTCATTTTGCATTATCTATGG - Intergenic
949211259 3:1504617-1504639 AAAGAATTTTGATTGATCTATGG - Intergenic
949834060 3:8248845-8248867 CAATCGTTGTGAATGATCTGGGG + Intergenic
951009161 3:17656332-17656354 CAAACAATTTGAATCATCTATGG + Intronic
954622307 3:52003163-52003185 GAATTATTCTGAATGAACAAGGG + Intergenic
959180854 3:102978802-102978824 AAATCATTTTGAAAGATATTGGG - Intergenic
959849246 3:111069277-111069299 GAATCATCTTGAGAGATCAATGG + Intergenic
959988982 3:112609880-112609902 GAATCATTTTGAATGATCTAAGG + Intronic
961976567 3:131031281-131031303 GAATCATAATGCATGTTCTAAGG - Intronic
962457426 3:135577535-135577557 GAATCATTTTGGATGGTACAAGG - Intergenic
962582370 3:136809799-136809821 CAATCAATTTGAATGAGGTAAGG - Intergenic
964909584 3:161763168-161763190 GAATGACTTTGAAGGATTTAAGG + Intergenic
965049088 3:163621073-163621095 GAATCACTTTTAATGATGTTAGG + Intergenic
965576959 3:170227258-170227280 AACTCAGTTTGAATGATCTCTGG - Intronic
966531000 3:180979978-180980000 GCATCTTTTTGAATTATCAAAGG - Exonic
967769864 3:193322835-193322857 TAATCATTTAGAAAGATCCATGG - Intronic
969356266 4:6628245-6628267 CACTCATTTTGATTGCTCTATGG - Intergenic
969948575 4:10810148-10810170 GGTTCATTTTGACTGCTCTATGG - Intergenic
971016363 4:22493341-22493363 GGATCTTTTTGAAAGATCTTTGG - Intronic
971396145 4:26229324-26229346 GTATCAGTGTGTATGATCTATGG + Intronic
973902384 4:55489384-55489406 GAATCAGTTTAAAAGATCCAAGG - Exonic
974089304 4:57294591-57294613 GAATGATTGTAAATAATCTAAGG + Intergenic
974435735 4:61855666-61855688 GAACTATTTTGAATGGTTTAAGG - Intronic
974598208 4:64040350-64040372 GAAGCATTTTGAAATGTCTATGG - Intergenic
976018028 4:80583639-80583661 TTATTATTTTGAATGATCCAAGG + Intronic
978368197 4:108004396-108004418 GCTTCCTTTTGAATGATCAAAGG - Intronic
979443049 4:120775453-120775475 GAATTATTTTGAATAATCAAGGG + Intronic
980410925 4:132417937-132417959 AAATCATTTTGAATGTTCATTGG - Intergenic
981963697 4:150575197-150575219 AAATAATATTTAATGATCTAAGG - Intronic
982262604 4:153508090-153508112 GAATCATATTTAATGATGTTAGG + Intronic
983422751 4:167541161-167541183 TAAACATTTTTAATGAGCTAAGG - Intergenic
983711006 4:170715259-170715281 GAATAAATTTGAATGATGAATGG - Intergenic
984350424 4:178584812-178584834 GAAACATTTTGACAGCTCTAAGG - Intergenic
987021309 5:13874964-13874986 GAATCATTCAGAAAGGTCTATGG + Intronic
987315783 5:16722004-16722026 GAAACAAGTAGAATGATCTATGG - Intronic
987947172 5:24625743-24625765 GCATCATTTTGAAGCATCTTAGG + Intronic
988098493 5:26648125-26648147 GAATCATTTTCAACCATCTTTGG + Intergenic
988318928 5:29668042-29668064 GACTCATTTTCAATTATATATGG + Intergenic
989776246 5:45210918-45210940 ATATCATTTTGAGTGTTCTAAGG - Intergenic
989783533 5:45299448-45299470 AAATTATTTTGAATCATCTGGGG + Intronic
991370682 5:65916337-65916359 GAATCCTATGGAAGGATCTAAGG - Intergenic
993981896 5:94552929-94552951 GAATAAGTTTGAATCTTCTATGG + Intronic
995058146 5:107785286-107785308 CAATAATTTTGAATGGTATAGGG + Intergenic
995152346 5:108863557-108863579 GAATGATTTTTAATGTTCTAAGG - Intronic
995617073 5:113976702-113976724 GAATCTTTTTCAGTGGTCTAGGG + Intergenic
996035383 5:118753059-118753081 AAATCATTTTAAATGCTCCAAGG - Intergenic
996441052 5:123491397-123491419 GAATCAGTTCCAATGATGTATGG + Intergenic
999045310 5:148461272-148461294 GAATCACTTTGAATGATAATTGG + Intronic
1001112731 5:168911252-168911274 CACACATTTTGAATGATTTATGG + Intronic
1002767227 6:252789-252811 GAAGCATTTTGAATGAGTTCGGG - Intergenic
1003206302 6:4015780-4015802 GAAACATTTTTAATGATAAAAGG + Intergenic
1006103330 6:31700817-31700839 GAATCATTGAGAATGGTTTAAGG - Intronic
1008571040 6:52816856-52816878 GAAACACTTTGAAGTATCTAAGG - Intergenic
1009446783 6:63752278-63752300 GAATAATAGTGAATTATCTAAGG - Intronic
1010967035 6:82222674-82222696 ATTTCATTTTGAATGATTTAAGG - Intronic
1011075649 6:83435551-83435573 GAAACATTTTGAATAAATTAAGG - Intergenic
1011409858 6:87056657-87056679 GAAACATTCTAAATGATTTATGG + Intergenic
1012047094 6:94290754-94290776 AAATCATTTTGTATGCTGTAAGG - Intergenic
1014121358 6:117729023-117729045 GAATCATTTGGGATTATTTAAGG + Intergenic
1015066146 6:129031479-129031501 GAGTCACTTTGAATTCTCTATGG - Intronic
1015305652 6:131704379-131704401 GATTCATTTTAAATAATCTGTGG + Intronic
1015387547 6:132641811-132641833 GAAACATTCAGAATGATTTATGG - Intergenic
1016627367 6:146187558-146187580 ATATTCTTTTGAATGATCTATGG + Intronic
1017540645 6:155399077-155399099 GAAACATTTTGAATGGTAGATGG + Intronic
1021997156 7:26190889-26190911 CAAACATTTTGAGTGAACTAGGG - Exonic
1023005892 7:35867091-35867113 GAAACATTCTGAAAGAACTAAGG - Intronic
1024205068 7:47151209-47151231 GAATCAACATGAATAATCTAAGG + Intergenic
1025321947 7:58104129-58104151 GAATCTTTTAGAATAATCTAAGG - Intergenic
1025475089 7:60909456-60909478 GAATCTTTTAGAATAATCTAAGG - Intergenic
1025487809 7:61073533-61073555 GAATCTTTTAGAATAATCTAAGG + Intergenic
1025511911 7:61580438-61580460 GAATCTTTTAGAATAATCTAAGG + Intergenic
1025556469 7:62315510-62315532 GAATCTTTTAGAATAATCTAAGG + Intergenic
1025563460 7:62400791-62400813 GAATCTTTTAGAATAATCTAAGG - Intergenic
1025566176 7:62436891-62436913 GAAACTTTTAGAATAATCTAAGG - Intergenic
1028637175 7:93002357-93002379 GAATTATTTTGAAATATCTTTGG - Intergenic
1029156848 7:98523249-98523271 GAATCATTTTAAATGCACCAGGG - Intergenic
1030107734 7:106000637-106000659 GAGTAATTTTGAATGCTCTAAGG - Intronic
1030710487 7:112743138-112743160 GAATACTATTGAATAATCTATGG + Intergenic
1031152846 7:118074477-118074499 AAATCATTTTGCATGATACATGG - Intergenic
1031437295 7:121748656-121748678 GAATCATTGGGAAGGATCTGAGG - Intergenic
1032812809 7:135439339-135439361 GAATCATTTTGAAGCTTCTGGGG + Intronic
1032870680 7:135981195-135981217 AAATCTTTTTTAATCATCTAAGG - Intergenic
1033177970 7:139143944-139143966 AAATGAGTTTAAATGATCTAAGG - Intronic
1033739768 7:144262610-144262632 GATTCATTTTAAATAATCTGTGG + Intergenic
1040778414 8:51075418-51075440 ATATCATTTGGCATGATCTATGG - Intergenic
1043064745 8:75554577-75554599 GAATGAATTTTACTGATCTAGGG - Intronic
1043242900 8:77958397-77958419 TCATAGTTTTGAATGATCTAAGG + Intergenic
1043481603 8:80658221-80658243 GAAGAATTTTCAATGATGTATGG - Intronic
1043873001 8:85455733-85455755 GACGCTTTTTGAATGATGTAAGG + Intergenic
1045110694 8:98937255-98937277 GAATCAGCTTGAGTGAGCTATGG + Intronic
1045947959 8:107818196-107818218 GAATAATTTTGAAAGCTCTATGG + Intergenic
1052332688 9:27286082-27286104 GAATCAATTTGAATGTCGTATGG + Intronic
1052420659 9:28239535-28239557 GCATCATTTGAAATGATCTATGG - Intronic
1053946676 9:43316525-43316547 GAATCTTTTAGAATAATCTAAGG - Intergenic
1055943136 9:81669204-81669226 GAATCATTTGAGATGATCTGTGG + Intronic
1056265546 9:84893237-84893259 GATTCATTTTGCCTGTTCTAGGG + Intronic
1058054974 9:100440210-100440232 GAATCATTTGGAGTGACCCAAGG + Intronic
1058320992 9:103630757-103630779 GATTCATTGTGAATGATCCTTGG + Intergenic
1060121527 9:120995024-120995046 TGCTCATTGTGAATGATCTATGG - Intronic
1062211934 9:135369627-135369649 GAAACATTTTGAATGAATAAGGG - Intergenic
1062229482 9:135473700-135473722 GAATCATTTCCATGGATCTAGGG + Intergenic
1203515930 Un_GL000213v1:1572-1594 GATACATTTTGAAACATCTAAGG + Intergenic
1203589806 Un_KI270747v1:45083-45105 GAATCTTTTAGAATAATCTAAGG - Intergenic
1185754740 X:2644417-2644439 GACATTTTTTGAATGATCTATGG - Intergenic
1186405845 X:9301676-9301698 GAATCATTTTTAATGTTAGACGG - Intergenic
1187102597 X:16210060-16210082 GAATCATTTTGAGTCATTTCAGG - Intergenic
1190465207 X:50719224-50719246 GACTCATTGTGAATGACCTTAGG - Intronic
1194416654 X:93620675-93620697 GAATTATTTTGAATAGACTATGG - Intergenic
1196907257 X:120449695-120449717 GAAGCATCTTCTATGATCTAAGG + Intronic
1197424458 X:126278361-126278383 GGATAATTATGAATGATCTCTGG + Intergenic
1198176557 X:134161814-134161836 GAATAATTTGAAATGAACTATGG - Intergenic
1201322123 Y:12711047-12711069 GAATCAATGTGAGGGATCTAGGG - Intronic
1201549083 Y:15200056-15200078 AAATCTTTTTGAGTTATCTAGGG - Intergenic
1201958003 Y:19647337-19647359 GAGCCCTTTTGAATGATATATGG - Intergenic